ID: 1108502908

View in Genome Browser
Species Human (GRCh38)
Location 13:51084490-51084512
Sequence GCCAGGCCAAGGTCCAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502908_1108502915 -5 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502915 13:51084508-51084530 CTGGCCTTGAAGGGGAAGGACGG No data
1108502908_1108502913 -9 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502913 13:51084504-51084526 TGGCCTGGCCTTGAAGGGGAAGG No data
1108502908_1108502918 -1 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502918 13:51084512-51084534 CCTTGAAGGGGAAGGACGGGTGG No data
1108502908_1108502922 10 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data
1108502908_1108502921 9 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502921 13:51084522-51084544 GAAGGACGGGTGGTGAGGGCTGG No data
1108502908_1108502919 4 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502919 13:51084517-51084539 AAGGGGAAGGACGGGTGGTGAGG No data
1108502908_1108502920 5 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502920 13:51084518-51084540 AGGGGAAGGACGGGTGGTGAGGG No data
1108502908_1108502916 -4 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502916 13:51084509-51084531 TGGCCTTGAAGGGGAAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502908 Original CRISPR GCCAGGCCAAGGTCCAGCTG AGG (reversed) Intergenic
No off target data available for this crispr