ID: 1108502911

View in Genome Browser
Species Human (GRCh38)
Location 13:51084500-51084522
Sequence ACCTTGGCCTGGCCTTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502903_1108502911 7 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502911 13:51084500-51084522 ACCTTGGCCTGGCCTTGAAGGGG No data
1108502899_1108502911 20 Left 1108502899 13:51084457-51084479 CCAAATGGTGTCGCCATGGGGGC No data
Right 1108502911 13:51084500-51084522 ACCTTGGCCTGGCCTTGAAGGGG No data
1108502905_1108502911 -2 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502911 13:51084500-51084522 ACCTTGGCCTGGCCTTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502911 Original CRISPR ACCTTGGCCTGGCCTTGAAG GGG Intergenic
No off target data available for this crispr