ID: 1108502912

View in Genome Browser
Species Human (GRCh38)
Location 13:51084501-51084523
Sequence TCCCCTTCAAGGCCAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502912_1108502922 -1 Left 1108502912 13:51084501-51084523 CCTTGGCCTGGCCTTGAAGGGGA No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data
1108502912_1108502923 27 Left 1108502912 13:51084501-51084523 CCTTGGCCTGGCCTTGAAGGGGA No data
Right 1108502923 13:51084551-51084573 ATTTTAATATGTCCAGTGCATGG No data
1108502912_1108502921 -2 Left 1108502912 13:51084501-51084523 CCTTGGCCTGGCCTTGAAGGGGA No data
Right 1108502921 13:51084522-51084544 GAAGGACGGGTGGTGAGGGCTGG No data
1108502912_1108502919 -7 Left 1108502912 13:51084501-51084523 CCTTGGCCTGGCCTTGAAGGGGA No data
Right 1108502919 13:51084517-51084539 AAGGGGAAGGACGGGTGGTGAGG No data
1108502912_1108502920 -6 Left 1108502912 13:51084501-51084523 CCTTGGCCTGGCCTTGAAGGGGA No data
Right 1108502920 13:51084518-51084540 AGGGGAAGGACGGGTGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502912 Original CRISPR TCCCCTTCAAGGCCAGGCCA AGG (reversed) Intergenic
No off target data available for this crispr