ID: 1108502913

View in Genome Browser
Species Human (GRCh38)
Location 13:51084504-51084526
Sequence TGGCCTGGCCTTGAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502903_1108502913 11 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502913 13:51084504-51084526 TGGCCTGGCCTTGAAGGGGAAGG No data
1108502905_1108502913 2 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502913 13:51084504-51084526 TGGCCTGGCCTTGAAGGGGAAGG No data
1108502899_1108502913 24 Left 1108502899 13:51084457-51084479 CCAAATGGTGTCGCCATGGGGGC No data
Right 1108502913 13:51084504-51084526 TGGCCTGGCCTTGAAGGGGAAGG No data
1108502908_1108502913 -9 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502913 13:51084504-51084526 TGGCCTGGCCTTGAAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502913 Original CRISPR TGGCCTGGCCTTGAAGGGGA AGG Intergenic
No off target data available for this crispr