ID: 1108502914

View in Genome Browser
Species Human (GRCh38)
Location 13:51084507-51084529
Sequence CGTCCTTCCCCTTCAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502914_1108502922 -7 Left 1108502914 13:51084507-51084529 CCTGGCCTTGAAGGGGAAGGACG No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data
1108502914_1108502921 -8 Left 1108502914 13:51084507-51084529 CCTGGCCTTGAAGGGGAAGGACG No data
Right 1108502921 13:51084522-51084544 GAAGGACGGGTGGTGAGGGCTGG No data
1108502914_1108502923 21 Left 1108502914 13:51084507-51084529 CCTGGCCTTGAAGGGGAAGGACG No data
Right 1108502923 13:51084551-51084573 ATTTTAATATGTCCAGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502914 Original CRISPR CGTCCTTCCCCTTCAAGGCC AGG (reversed) Intergenic
No off target data available for this crispr