ID: 1108502920

View in Genome Browser
Species Human (GRCh38)
Location 13:51084518-51084540
Sequence AGGGGAAGGACGGGTGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502908_1108502920 5 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502920 13:51084518-51084540 AGGGGAAGGACGGGTGGTGAGGG No data
1108502912_1108502920 -6 Left 1108502912 13:51084501-51084523 CCTTGGCCTGGCCTTGAAGGGGA No data
Right 1108502920 13:51084518-51084540 AGGGGAAGGACGGGTGGTGAGGG No data
1108502903_1108502920 25 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502920 13:51084518-51084540 AGGGGAAGGACGGGTGGTGAGGG No data
1108502905_1108502920 16 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502920 13:51084518-51084540 AGGGGAAGGACGGGTGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502920 Original CRISPR AGGGGAAGGACGGGTGGTGA GGG Intergenic
No off target data available for this crispr