ID: 1108502922

View in Genome Browser
Species Human (GRCh38)
Location 13:51084523-51084545
Sequence AAGGACGGGTGGTGAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502905_1108502922 21 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data
1108502908_1108502922 10 Left 1108502908 13:51084490-51084512 CCTCAGCTGGACCTTGGCCTGGC No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data
1108502903_1108502922 30 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data
1108502912_1108502922 -1 Left 1108502912 13:51084501-51084523 CCTTGGCCTGGCCTTGAAGGGGA No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data
1108502914_1108502922 -7 Left 1108502914 13:51084507-51084529 CCTGGCCTTGAAGGGGAAGGACG No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502922 Original CRISPR AAGGACGGGTGGTGAGGGCT GGG Intergenic
No off target data available for this crispr