ID: 1108502923

View in Genome Browser
Species Human (GRCh38)
Location 13:51084551-51084573
Sequence ATTTTAATATGTCCAGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502917_1108502923 16 Left 1108502917 13:51084512-51084534 CCTTGAAGGGGAAGGACGGGTGG No data
Right 1108502923 13:51084551-51084573 ATTTTAATATGTCCAGTGCATGG No data
1108502912_1108502923 27 Left 1108502912 13:51084501-51084523 CCTTGGCCTGGCCTTGAAGGGGA No data
Right 1108502923 13:51084551-51084573 ATTTTAATATGTCCAGTGCATGG No data
1108502914_1108502923 21 Left 1108502914 13:51084507-51084529 CCTGGCCTTGAAGGGGAAGGACG No data
Right 1108502923 13:51084551-51084573 ATTTTAATATGTCCAGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502923 Original CRISPR ATTTTAATATGTCCAGTGCA TGG Intergenic
No off target data available for this crispr