ID: 1108505484

View in Genome Browser
Species Human (GRCh38)
Location 13:51108863-51108885
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108505484_1108505489 -5 Left 1108505484 13:51108863-51108885 CCCATGTGCCTCTGCACAGCCAT No data
Right 1108505489 13:51108881-51108903 GCCATTCAAAGGGCTAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108505484 Original CRISPR ATGGCTGTGCAGAGGCACAT GGG (reversed) Intergenic
No off target data available for this crispr