ID: 1108512581

View in Genome Browser
Species Human (GRCh38)
Location 13:51169665-51169687
Sequence TTTTAGCCATGGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108512581_1108512592 5 Left 1108512581 13:51169665-51169687 CCCAGCTCCAGCCATGGCTAAAA No data
Right 1108512592 13:51169693-51169715 CAAGGTATAGCTCAGGCAGAGGG No data
1108512581_1108512589 -2 Left 1108512581 13:51169665-51169687 CCCAGCTCCAGCCATGGCTAAAA No data
Right 1108512589 13:51169686-51169708 AAGGGGCCAAGGTATAGCTCAGG 0: 28
1: 422
2: 1065
3: 1601
4: 1465
1108512581_1108512593 24 Left 1108512581 13:51169665-51169687 CCCAGCTCCAGCCATGGCTAAAA No data
Right 1108512593 13:51169712-51169734 AGGGTGCCAGCCATAAGCCTTGG No data
1108512581_1108512591 4 Left 1108512581 13:51169665-51169687 CCCAGCTCCAGCCATGGCTAAAA No data
Right 1108512591 13:51169692-51169714 CCAAGGTATAGCTCAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108512581 Original CRISPR TTTTAGCCATGGCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr