ID: 1108517032

View in Genome Browser
Species Human (GRCh38)
Location 13:51213163-51213185
Sequence GGATGTTTAACCTAACTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108517029_1108517032 -10 Left 1108517029 13:51213150-51213172 CCCCTCAGCAGGTGGATGTTTAA No data
Right 1108517032 13:51213163-51213185 GGATGTTTAACCTAACTCCAAGG No data
1108517025_1108517032 18 Left 1108517025 13:51213122-51213144 CCTGGGGAACTCATGGACTCAAT No data
Right 1108517032 13:51213163-51213185 GGATGTTTAACCTAACTCCAAGG No data
1108517028_1108517032 -7 Left 1108517028 13:51213147-51213169 CCTCCCCTCAGCAGGTGGATGTT No data
Right 1108517032 13:51213163-51213185 GGATGTTTAACCTAACTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108517032 Original CRISPR GGATGTTTAACCTAACTCCA AGG Intergenic
No off target data available for this crispr