ID: 1108518056

View in Genome Browser
Species Human (GRCh38)
Location 13:51221552-51221574
Sequence AAGTTGGCAGGGCGGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108518056_1108518064 3 Left 1108518056 13:51221552-51221574 CCTTCCGCCCGCCCTGCCAACTT 0: 1
1: 0
2: 0
3: 12
4: 259
Right 1108518064 13:51221578-51221600 TCCCTCTTCACCCTCCTAATAGG 0: 1
1: 0
2: 3
3: 38
4: 463
1108518056_1108518067 6 Left 1108518056 13:51221552-51221574 CCTTCCGCCCGCCCTGCCAACTT 0: 1
1: 0
2: 0
3: 12
4: 259
Right 1108518067 13:51221581-51221603 CTCTTCACCCTCCTAATAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108518056 Original CRISPR AAGTTGGCAGGGCGGGCGGA AGG (reversed) Intergenic
900018411 1:170425-170447 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
900048667 1:529020-529042 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
900070896 1:770844-770866 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
900387067 1:2415590-2415612 TAAATGGCAGGGCCGGCGGAGGG - Intergenic
901777049 1:11567240-11567262 GAGGTGGCAGGGAGGGCTGAGGG + Intergenic
902332727 1:15738444-15738466 AGGGTGGCAGGGCTGGGGGATGG + Intronic
902336234 1:15756518-15756540 AGCCTGGCAGGGAGGGCGGAGGG + Intergenic
902756625 1:18553234-18553256 GGGTTGGCAGGGCCAGCGGAGGG - Intergenic
903360824 1:22775976-22775998 AAGTTGGCAGAGTGGGAGGTGGG + Intronic
906943065 1:50272775-50272797 AAGATGGAAGGGTGGGCAGATGG + Intergenic
908982466 1:69975743-69975765 AAGTTGGCATGGTGGAAGGAGGG - Intronic
909487157 1:76186991-76187013 AAGTGGGAAGGGTGGGAGGAAGG - Intronic
915161283 1:153922597-153922619 AAGGTGGAGGGGCGGGGGGAGGG - Intronic
915286446 1:154856360-154856382 ATGTTGGCAGGGTGGGCTGCGGG - Intronic
916792648 1:168137083-168137105 CAGCCGGGAGGGCGGGCGGACGG - Intronic
917345263 1:174022433-174022455 CAGGAGGCGGGGCGGGCGGAGGG + Intergenic
918923403 1:190746053-190746075 AAGTTTGGAGGGTGGGAGGAGGG + Intergenic
919451152 1:197775007-197775029 AGGTTGGCCGGGCGGGCTGGGGG - Intronic
919471712 1:197987473-197987495 CACTTGGCAGGGCGTGGGGAAGG - Intergenic
920685526 1:208106125-208106147 AAGTTGGCAGGGGTGGAGGGGGG + Intronic
922106262 1:222516290-222516312 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
922490664 1:226013970-226013992 CAGTGTGCAGTGCGGGCGGAAGG - Intergenic
924348442 1:243093855-243093877 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
1065245134 10:23748592-23748614 AAGATGGAAGGGAGGGAGGATGG + Intronic
1066313922 10:34224627-34224649 AAGTGCACAGGGCGGGCAGAGGG + Intronic
1066727918 10:38411046-38411068 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1067726274 10:48773683-48773705 ATGATGGGAGGGTGGGCGGAGGG + Intronic
1070329587 10:75408036-75408058 AAGTTTGCAGGGCAGGCGGCGGG - Intergenic
1070806089 10:79271574-79271596 AAGTGTGCAGGGTGGGCGGAGGG - Intronic
1072826451 10:98611365-98611387 AAGTTGACTGGGCAGGGGGAGGG + Intronic
1074997710 10:118772154-118772176 AAGTTGGCAGAGCAGGAAGATGG + Intergenic
1075906385 10:126085466-126085488 ACGTTGGCTGGGTGGGCGGATGG - Intronic
1076135136 10:128040477-128040499 GAGTTAGCAGGGCGAGTGGAGGG + Intronic
1076585717 10:131546274-131546296 CAGTTGGCAGGGCTGGCTGAAGG - Intergenic
1076975014 11:165621-165643 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
1077321059 11:1942134-1942156 AAGGTGGGAGGGAGGGGGGAGGG + Intergenic
1080315012 11:30938064-30938086 AGGTTGGCAGGGCTCGGGGAAGG - Intronic
1081089667 11:38847633-38847655 AAGGTGGGAGGGCAGGAGGAGGG - Intergenic
1082250312 11:49971609-49971631 AAGTTGGGAGGGTGGGAGAATGG + Intergenic
1084008747 11:66336287-66336309 AAGTTGGCAGGGCAGCCAGGTGG - Intronic
1084067936 11:66716043-66716065 CAGTTGGCAGGGGTGGGGGATGG + Intronic
1084150078 11:67284035-67284057 AAGCTGGCAGGGCTGGCACAGGG - Intronic
1085142563 11:74160587-74160609 AAGGTAGCAGGGAGGGAGGATGG + Intronic
1091095563 11:132818509-132818531 AAGTCTGCAGGGTGGGCGGCAGG - Intronic
1091388389 12:109706-109728 AGGTTGGCAGGGCTGGGGGAAGG - Intronic
1091826853 12:3519373-3519395 AGGTTGGCAGGGCTGGGGGAAGG + Intronic
1092171341 12:6375593-6375615 AGGTGAGCAGGGCGGGGGGAGGG + Intronic
1092214767 12:6673230-6673252 AAGGTGGGAGAGCTGGCGGAAGG + Exonic
1096073878 12:48789849-48789871 AAGTTGGCAGGTGCGGGGGAGGG - Intergenic
1096238895 12:49948868-49948890 AAGTTGGGAGGGATGGCTGAGGG + Intergenic
1097874746 12:64632614-64632636 AAGGTGGCTGGGTGGGAGGATGG + Intronic
1100623667 12:96307005-96307027 AAGTAGGCAGGCCAGGCGCAGGG + Intronic
1101801886 12:108029502-108029524 AAGTGGACAGGGAAGGCGGAGGG + Intergenic
1102237679 12:111304333-111304355 AAGTGAGCAGGGAGGGCAGAGGG + Intronic
1103098393 12:118150797-118150819 AAGTTGACACGGGGGGAGGAAGG + Exonic
1107888799 13:44896293-44896315 GGGTTGGGAGGGCGGGAGGAAGG - Intergenic
1108518056 13:51221552-51221574 AAGTTGGCAGGGCGGGCGGAAGG - Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1119148118 14:72334371-72334393 AAGCTGGCAGGGCAGGGGGTGGG + Intronic
1119751687 14:77082996-77083018 GAGTTAGCAGGGCGAGGGGATGG + Intergenic
1120526712 14:85584925-85584947 TGGGTGGCAGGGCGGGGGGAAGG + Intronic
1121561680 14:94880835-94880857 AAGTAGGACGGGCGGGCGGGCGG + Intergenic
1121777504 14:96600137-96600159 TAGCTGGCAGAGCGGGGGGAGGG - Intergenic
1121832734 14:97066010-97066032 AAGGAGGCAGGGAGGGAGGAAGG - Intergenic
1121995947 14:98603013-98603035 AAGATGGCAGGGAGAGCAGAAGG + Intergenic
1122546501 14:102525665-102525687 AAGGAGGCAGGGAGGGAGGAAGG - Intergenic
1125533497 15:40429065-40429087 GAGTGGGCAGGCTGGGCGGAGGG - Intronic
1126020905 15:44400554-44400576 AAGGCGGCAAGGCGGGCAGATGG - Intronic
1126876501 15:53047444-53047466 CAGTTGCCAGGGCTGGTGGAGGG - Intergenic
1131313157 15:91309086-91309108 TAGTTGGCAGGGGCGGAGGAGGG - Intergenic
1131431928 15:92394579-92394601 AAGTGGGCAGGGGGCGCGCAGGG + Intronic
1131561702 15:93449291-93449313 AGTTTGGCAGGGATGGCGGAGGG + Intergenic
1132049479 15:98595165-98595187 AAGTTAGCAGGGCGGGGTGGTGG + Intergenic
1133496597 16:6324137-6324159 AGGGTGGGAGGGCGGGAGGAAGG - Intronic
1135317359 16:21460952-21460974 AAGTTAGCAGGGCGTGGTGATGG - Intergenic
1135370257 16:21892764-21892786 AAGTTAGCAGGGCGTGGTGATGG - Intergenic
1136228909 16:28875852-28875874 AGGCTGGCAGGGCTGGGGGAGGG - Intergenic
1136314148 16:29440692-29440714 AAGTTAGCAGGGCGTGGTGATGG - Intergenic
1136327587 16:29542457-29542479 AAGTTAGCAGGGCGTGGTGATGG - Intergenic
1136442276 16:30282457-30282479 AAGTTAGCAGGGCGTGGTGATGG - Intergenic
1136774703 16:32865633-32865655 AGGTCAGCAGGGCGGGCCGAGGG + Intergenic
1139136065 16:64206191-64206213 AAGTGGGCAGGGTGGGGGGTGGG + Intergenic
1139889082 16:70236180-70236202 AAGTTAGCAGGGCGTGGTGATGG - Intergenic
1141673553 16:85505607-85505629 AAGTTGGGAGTGCCGGCGGGGGG + Intergenic
1142020460 16:87779103-87779125 AAGTTGGCAGGTGTGGCGGGTGG - Intergenic
1142445249 16:90132038-90132060 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1203077130 16_KI270728v1_random:1127769-1127791 AGGTCAGCAGGGCGGGCCGAGGG + Intergenic
1142462260 17:103428-103450 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
1143492893 17:7294363-7294385 AAGGCGGCGGGGCGGGCGGCGGG - Exonic
1145290087 17:21536226-21536248 AAGTTGCCAGGGCTGTGGGATGG + Intronic
1146441157 17:32896368-32896390 AAGTTGGGTGGGCAGGAGGAAGG - Intergenic
1147949277 17:44097955-44097977 CAGGTGGCAGGGCAGGCAGAGGG + Intronic
1148095768 17:45051744-45051766 AGGTTGGGCGGGCGGGCGGGCGG + Intronic
1148095783 17:45051776-45051798 AGGTTGGGCGGGCGGGCGGGCGG + Intronic
1148095798 17:45051808-45051830 AGGTTGGGCGGGCGGGCGGGCGG + Intronic
1148095813 17:45051840-45051862 AGGTTGGGCGGGCGGGCGGGCGG + Intronic
1148736609 17:49868690-49868712 AGGCAGGCAGGGCGGGCGGCGGG - Intergenic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1151996099 17:77610009-77610031 AAGTTGGAAGGGGGTGAGGAAGG + Intergenic
1158418112 18:57267825-57267847 AAGATGGCAGGGAGGGAGGGAGG + Intergenic
1160580850 18:79884035-79884057 AAGATGGCAGGGCGGGGGTTGGG - Intronic
1160651966 19:235804-235826 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
1161131359 19:2590805-2590827 TAGTTGGTTGGGTGGGCGGATGG - Intronic
1161252171 19:3286063-3286085 AGGTGGACAGGGCGGGCAGAGGG - Intronic
1161497219 19:4593202-4593224 AAGTTGGGCGGGCGGTGGGAGGG + Intergenic
1161701711 19:5799470-5799492 GAGATGGCAGGGCAGGCGGGTGG + Intergenic
1162200743 19:9018327-9018349 CTGTTGGCTGGGCGGGCGGAGGG - Intergenic
1162950816 19:14071405-14071427 CAGTTGGCATGGCTGGAGGAAGG + Intergenic
1162955055 19:14092828-14092850 AAGTGGGCTGGGAGGGCTGAGGG + Exonic
1164646012 19:29859060-29859082 AAGATGGCAGGTCGAGGGGAGGG + Intergenic
1165020885 19:32923015-32923037 AATCTGCCAGGGCAGGCGGATGG + Intronic
1165422164 19:35727662-35727684 AAGTTAGCAGGGCTGGGGGTGGG - Intronic
1168081184 19:54011849-54011871 AAGGTGCCAGGGTGGGCGGGAGG + Intronic
925100882 2:1244406-1244428 AAGTTTGCAGGCCGGGCGCGGGG + Intronic
926202588 2:10812553-10812575 AAGTGGGCCTGGCGGGCGGGAGG - Intronic
926535566 2:14107108-14107130 TAGTTGCCAGGGCTGGCGGGAGG + Intergenic
926920717 2:17937349-17937371 AAGGAGGCAGGGAGGGAGGAAGG - Intronic
927739244 2:25552672-25552694 CAATGGGCAGGGCAGGCGGAAGG - Intronic
933858586 2:86441934-86441956 CAGCAGGGAGGGCGGGCGGAGGG - Intronic
934780759 2:96968376-96968398 TGGTTTGCAGGGCGGGAGGAGGG - Intronic
937338002 2:121074011-121074033 GAGCTGGCAGGGCGGGCGTGGGG + Intergenic
937515569 2:122651211-122651233 AAGGTGGCAGGTCGGGAGGAAGG + Intergenic
938423916 2:131168319-131168341 AAGAGGGAAGGGCGGGGGGAGGG - Intronic
939959356 2:148552635-148552657 ATGTTGGGAGGGTGGGTGGAGGG + Intergenic
941339331 2:164287045-164287067 AAGGAGGCAGGGAGGGAGGAAGG + Intergenic
941583699 2:167331360-167331382 CAGTGGGCTGGGTGGGCGGATGG + Intergenic
941987458 2:171522884-171522906 AAGTCGGCTGGGCGGGAGGGAGG + Intronic
943073214 2:183166211-183166233 AAGTTGGGAGGGTGGGAGAAGGG - Intergenic
943627436 2:190216148-190216170 AGATTGGCAGGGCTGGGGGAAGG + Intronic
946057583 2:216915699-216915721 AGGTGGGCAGGGCTGGCGGTAGG - Intergenic
946132711 2:217619663-217619685 CAGTTAGCAGGGTGGGAGGATGG + Intronic
947179431 2:227399033-227399055 AAGGAGGCAGGGAGGGGGGAGGG + Intergenic
1169756275 20:9046395-9046417 AAGGTGGCAGGGCGGGGAGGGGG + Intergenic
1170023335 20:11861653-11861675 AAGTTGGCAGGGAGTTGGGAAGG - Intergenic
1170134764 20:13060602-13060624 AAGTTGGAAGGGTGGGAGGGTGG - Intronic
1170845760 20:19960746-19960768 AAATTCACAGGGCAGGCGGAGGG - Exonic
1171324903 20:24282719-24282741 ATATTGGCAGGGAGGGCAGAGGG + Intergenic
1172510069 20:35494476-35494498 AAGATGGCAGGGCAGGGGGCCGG - Intronic
1172613029 20:36265865-36265887 GATTGGGCAGGGCGGGCGGTGGG + Intronic
1173530936 20:43769168-43769190 AAGGAGGCAGGGAGGGAGGAAGG + Intergenic
1174151121 20:48487036-48487058 AAGATGGCAGGGCGGGGTGTTGG + Intergenic
1174595160 20:51678122-51678144 TGGGTGGCAGGGCGGGGGGAAGG + Intronic
1174881029 20:54279802-54279824 AATTTGGCAGGGGCGGCGGGGGG + Intergenic
1175750374 20:61492930-61492952 AAGTTGGCAGTGGAGGTGGATGG + Intronic
1179370811 21:40804611-40804633 AAGTGGGCAGGGCAGGAGGCAGG - Intronic
1180074740 21:45456730-45456752 AGGGTGGCGGGGCGGGCGGCGGG - Intronic
1180668829 22:17536839-17536861 AAGGTGGCAGGGCAGGCACAGGG - Intronic
1181102444 22:20550496-20550518 AAGATGGCAGGGCAGAGGGAAGG - Intronic
1181623470 22:24106464-24106486 AAGCTGGCAGGGCAGGCAGCAGG - Intronic
1182401685 22:30082597-30082619 GAGTTGGGCGGGCGGGTGGAGGG - Intronic
1182741680 22:32572362-32572384 AAGATGGGAGGGAGGGTGGAAGG - Intronic
1182751361 22:32644550-32644572 AAGTGTGCTGGGCTGGCGGATGG + Intronic
1183442347 22:37830339-37830361 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1185288554 22:50013090-50013112 AAGCTGGCTGGGCTGGCAGAGGG + Intergenic
950583868 3:13879684-13879706 AAGTTGGCACGGCCCGGGGAGGG - Intronic
950630203 3:14277120-14277142 AAGTGGGGAGGGTGGGGGGAGGG - Intergenic
953492289 3:43362351-43362373 AAGTTGGCAGGGAAGGAGGCTGG + Intronic
954322454 3:49841396-49841418 AGGTTGGCAGGAAGGGTGGAGGG - Intronic
958193268 3:90210416-90210438 AAGATGGGAGGGTGGGAGGAGGG + Intergenic
958254258 3:91306913-91306935 ATGTTGGCAGCGGGGGCGGGAGG + Intergenic
958416573 3:93881360-93881382 AAGATGGGAGGGTGGGAGGAGGG + Intronic
960582875 3:119295331-119295353 ACGTTGGAAGGGAGGGAGGAGGG + Intronic
961552984 3:127679726-127679748 AGGCTGGCAGGGCAGGCGGGAGG - Intronic
961624316 3:128249596-128249618 AGGTTGCCAGGGTGGGAGGAAGG - Intronic
962405694 3:135097959-135097981 AAGTTGGCACAGAGGGAGGATGG - Intronic
962716278 3:138128794-138128816 ACAGTGGCAGGGCGGGCAGAGGG - Intronic
963834008 3:150037843-150037865 AAGGAGGCAGGGAGGGAGGAAGG + Intronic
965520117 3:169662712-169662734 AAGTTGCGCGGGCGGGCGGGTGG - Intronic
966711931 3:182980450-182980472 CAGCCGGCAGGGCGGGCGGGCGG + Intronic
967200187 3:187066068-187066090 GGGTTGGCAGGGCGGGTGGGAGG + Intronic
967239143 3:187419169-187419191 CAGTTGGCTGGGCGAGGGGAGGG + Intergenic
968365864 3:198184168-198184190 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
968817198 4:2828288-2828310 AAGGAGGCAGGGCGGACGCAGGG - Intronic
969056800 4:4407388-4407410 GAGATGGGAGGGCGGGCGGTGGG + Intronic
969160423 4:5252975-5252997 AAGTTGGCAGTGGTGGCAGAAGG - Intronic
969714801 4:8863292-8863314 AAGTTGCAAGGTGGGGCGGAAGG + Intronic
970547819 4:17147682-17147704 AAGGTGGCAGGGTGGGAGGGAGG + Intergenic
971452402 4:26812264-26812286 AAGATGGCAGTGCTGGGGGAGGG - Intergenic
973246437 4:48015883-48015905 GAGTGGGCAGGGCTGGCGGGTGG - Intronic
975332910 4:73139614-73139636 CAGTTGGCAGGGCTGGGGCAAGG - Exonic
976214072 4:82699134-82699156 TAGATGGCAGGGTGGGGGGATGG - Intronic
979254902 4:118599326-118599348 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
982596729 4:157395050-157395072 AAGATGGGAGGGAGGGAGGAAGG + Intergenic
982668068 4:158291129-158291151 ACGATGGCAGGGCTGGGGGAGGG + Intergenic
982824241 4:159982254-159982276 AAGGTGGGAGGGTGGGAGGAGGG - Intergenic
984149400 4:176108012-176108034 AAGTGGGGAGGGCAGGAGGAAGG - Intronic
985324064 4:188747749-188747771 AAGATGGGAGGGAGGGAGGAGGG - Intergenic
985710316 5:1424144-1424166 AGGTTGGCCGGGTGGGCAGATGG + Intronic
986142400 5:5043377-5043399 AAGAAGGCAGGGAGGGAGGAAGG + Intergenic
987868138 5:23573439-23573461 AAGGTGGGAGGGTGGGAGGAGGG - Intergenic
988348533 5:30070632-30070654 AAGTGGGGAGGGTGGGAGGAGGG - Intergenic
989125017 5:38044610-38044632 AGATTGGCAGGGCTGGGGGAGGG - Intergenic
991011011 5:61883085-61883107 ATGTTGGCAGAGCGGGGGGAGGG - Intergenic
997352243 5:133239230-133239252 ACGTTGGCAGGGAGGGGGGTGGG - Intronic
997659570 5:135578997-135579019 AAGAGGCCAGGGCGGGCGGAGGG - Exonic
1000730203 5:164825697-164825719 AAGATGGGAGGGTGGGAGGACGG + Intergenic
1001527168 5:172437184-172437206 GAGAGGGCAGGGCGGTCGGATGG + Intronic
1001939595 5:175731118-175731140 AAGTGGGCAGAGAGGCCGGATGG + Intergenic
1001940359 5:175735853-175735875 AAGCTGGGTGGGCGGGCGGTGGG - Intergenic
1002121349 5:177006710-177006732 ACGTTGGGAGCGCGGGGGGAGGG + Intronic
1002725090 5:181289392-181289414 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1005158078 6:22831268-22831290 AGGTTGGGAGGGAGGGAGGAAGG - Intergenic
1006030014 6:31171520-31171542 AATTTGGCAGGCTGGGCAGATGG - Intronic
1006472312 6:34235929-34235951 AAGATGGCGGGGAGGGCGGTGGG - Intergenic
1007647518 6:43394429-43394451 AAGTTGGCTGGGCTGGGGGAAGG + Intergenic
1007885895 6:45229974-45229996 AAGTTGGGAGGGTGGGGGAAAGG - Intronic
1009189571 6:60613570-60613592 ATGTTGGCAGCGGGGGCGGGGGG - Intergenic
1010401370 6:75450147-75450169 AAGTGGCCCGGGCGGGTGGAGGG + Intronic
1011734235 6:90296313-90296335 AAGCGGGCAGGGCGCGGGGAGGG + Intronic
1015024571 6:128519161-128519183 AAGTTGTCAGGACTGGCGGGAGG + Intronic
1015846088 6:137522570-137522592 AAGATGGCAGGGAGGGAGGGAGG - Intergenic
1017743527 6:157427184-157427206 AAGGAGGAAGGGCGGGTGGAGGG + Intronic
1018302979 6:162423375-162423397 AAGGTGGAAGGGAGGGAGGAAGG - Intronic
1020063078 7:5167180-5167202 AAGTTAGCAGGGCGTGGTGATGG + Intergenic
1020130177 7:5555222-5555244 AAGTGGGCCGGGCCGGCCGAGGG - Intronic
1023427912 7:40058563-40058585 AAACGGGCAGGGCGGGCGGGGGG + Intronic
1023523463 7:41072721-41072743 AAGGTGGCGGGGCGGGGGGGGGG + Intergenic
1024069990 7:45777003-45777025 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1025187308 7:56871195-56871217 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
1025188727 7:56881003-56881025 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
1025683207 7:63695917-63695939 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1025684617 7:63705725-63705747 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1025990324 7:66492437-66492459 AGGTTGGCAGGGCTGGGGAAGGG + Intergenic
1025992835 7:66508587-66508609 AAGTAGGGAGGGAGGGAGGAAGG - Intergenic
1026038426 7:66846157-66846179 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1026145236 7:67740872-67740894 TGGTTGGCAGGGAGGGGGGATGG - Intergenic
1026960601 7:74405118-74405140 AAGATGGCAGGGCGAGGGGTTGG - Exonic
1026962837 7:74420077-74420099 AAGGAGGCAGGGAGGGAGGAGGG - Intergenic
1028060781 7:86312326-86312348 AAATTGGCAGGGGGGGTGGGGGG - Intergenic
1032047388 7:128621291-128621313 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1032395968 7:131590266-131590288 AAGGTGGGAGGGTGGGAGGAGGG + Intergenic
1032706938 7:134428733-134428755 AGGATGGCAGGGTGGGAGGATGG - Intergenic
1033595658 7:142856155-142856177 AAGTTCCCCTGGCGGGCGGAGGG - Intronic
1034353717 7:150434251-150434273 AAGCTGGGAGGTCGGGAGGAAGG - Intergenic
1034463012 7:151208966-151208988 GAGGTGGCAGGGAGGGCGGGTGG - Intronic
1035231448 7:157468424-157468446 AGGCTGGCCGGGCGGGCAGATGG - Intergenic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036074654 8:5482364-5482386 AAGGTGGGAGGGTGGGAGGAGGG + Intergenic
1036485049 8:9171890-9171912 GAGATGGCTGGGCAGGCGGAAGG + Intergenic
1037805624 8:22056753-22056775 AAGTGGGGAGGGCGCGGGGAGGG + Intronic
1038446709 8:27609674-27609696 AAGTGGGCACGGCGGGGGGCTGG - Intronic
1038482469 8:27911095-27911117 AGGTTGGCAGGGAGGGCTCATGG - Intronic
1038950478 8:32408880-32408902 AAGATGGGAGGGTGGGAGGAGGG - Intronic
1039486810 8:37916511-37916533 TAATTGGAAGGGCGGGAGGAGGG - Intergenic
1039877614 8:41600765-41600787 TGGTTGCCAGGGCTGGCGGAGGG - Intronic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1042665433 8:71199458-71199480 AAGCTGGCAGGGCTGGCGCTGGG - Intronic
1048690326 8:136955769-136955791 AAGAAGGCAGGGAGGGAGGAAGG - Intergenic
1051484983 9:17598542-17598564 AAGTGGGCAGGTCGGGGGGTGGG - Intronic
1052703668 9:31968205-31968227 GAGGTGGTAGGGCGGGAGGAGGG + Intergenic
1053106701 9:35415799-35415821 AAGCTACCAGGGCGGGTGGAGGG - Intergenic
1057836254 9:98447801-98447823 AAGTTGGTAGGGTGGGTGGTGGG + Intronic
1060435637 9:123590430-123590452 AAGTTGGCACAGCTGGTGGATGG - Intronic
1061445388 9:130634499-130634521 CAGCTGGCAGGGCTGGGGGAAGG - Intronic
1062104889 9:134749934-134749956 AGGTTGGCTGGGCGTGAGGAGGG + Intronic
1062222446 9:135424557-135424579 ATGTGTGCAGGGGGGGCGGAGGG + Intergenic
1062519774 9:136952803-136952825 AAGCTGCCAGGGAGGGCGGGAGG + Intronic
1062750234 9:138247035-138247057 AGGTTGGCAGGGCTGGGGAAGGG - Intergenic
1186362869 X:8861095-8861117 AAGTTGGCAGGGCTTGGAGAAGG + Intergenic
1190070179 X:47273064-47273086 ATGTTGGCAGGAGGGGCAGAGGG + Intergenic
1190764139 X:53462075-53462097 AAGTTGGCGGGGCGGGGTGGGGG - Intergenic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1192486914 X:71535262-71535284 ACGTTGGGAGGGAGGGAGGATGG - Intronic
1192821726 X:74653407-74653429 AAGTGGGCAAAGCGGGGGGACGG - Intergenic
1196486006 X:116207844-116207866 AAGTTGGGAGGATGGGAGGAGGG + Intergenic
1197774600 X:130110938-130110960 AAGGAGGCAGGGCGGGAGGGAGG + Intergenic
1197788958 X:130231569-130231591 AAGTTGGGAGGGAGGGAGGAAGG + Intronic
1197898095 X:131338846-131338868 AAGTTGGGAGGGAGGAAGGAAGG + Intronic
1200418226 Y:2935347-2935369 CGGCTGGTAGGGCGGGCGGAGGG - Intronic