ID: 1108518918

View in Genome Browser
Species Human (GRCh38)
Location 13:51227255-51227277
Sequence ATGGAGACTCAGAGGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 410}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108518913_1108518918 15 Left 1108518913 13:51227217-51227239 CCTCACTATTCTAATAATTATAT 0: 1
1: 1
2: 3
3: 39
4: 438
Right 1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG 0: 1
1: 0
2: 0
3: 45
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108518918 Original CRISPR ATGGAGACTCAGAGGGCACA TGG Intronic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
902162755 1:14544931-14544953 AGGGAGACTCACAGAGCACAGGG - Intergenic
902652428 1:17845347-17845369 ATCCTGACTCAGAGGCCACATGG - Intergenic
903845354 1:26276700-26276722 ATTGTGACCCAGAGGGCCCAGGG + Exonic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
904235771 1:29116051-29116073 ATGAAGACTCAGAGGGTAGCTGG - Intronic
904293713 1:29504220-29504242 ATGGAGACCCAGAGACAACAGGG - Intergenic
904311679 1:29633112-29633134 ATGGGGACTCAAAGGGAACTGGG + Intergenic
906659750 1:47573878-47573900 ATGGAGTCTCAGAGAGGGCAAGG + Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
907192447 1:52660600-52660622 ACAAACACTCAGAGGGCACAGGG + Intronic
908784651 1:67722928-67722950 ATAGAGAATCTGAGGGCTCAGGG - Intronic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
911038440 1:93573502-93573524 ATGGAGACAAAGAGGGAAAATGG - Intronic
911084705 1:93966668-93966690 CTGGAGACTCAGGAGGCACCTGG - Intergenic
912384276 1:109263556-109263578 GTGGAGCCTCAGAGGGCCCTGGG - Intronic
912406521 1:109443196-109443218 CATGAAACTCAGAGGGCACAGGG + Intergenic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
912736522 1:112153927-112153949 ATTGAGGCTCAGGGTGCACAGGG - Intergenic
913054720 1:115147768-115147790 ATGGAGACTCAGAGGGTAAGGGG + Intergenic
913220240 1:116654323-116654345 CTGCAGTCTCAGAGGGCTCACGG + Intronic
916501300 1:165389639-165389661 CTAGAGACCCAGAGGGCAAAGGG - Intergenic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
919752483 1:201047000-201047022 ATGGAGACATAGAGGGAAAAAGG - Intronic
920648990 1:207822936-207822958 ATGGAGACACAGAGAGCGCAAGG + Intergenic
920928261 1:210363276-210363298 AGGGACACTCAGAGGCCAGAAGG - Intronic
921297993 1:213722640-213722662 AGGGAGACCCAGAGTGAACAAGG + Intergenic
921723233 1:218496543-218496565 ATGGAGAAGCAGAGGGCATTAGG + Intergenic
921723698 1:218501452-218501474 ACAGAGACTTAGAAGGCACATGG + Intergenic
922035668 1:221845761-221845783 ATAAACACTCAGAGGGGACAAGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922986541 1:229870297-229870319 CAGGAGACCCAGAGGGCCCATGG + Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924626806 1:245702414-245702436 ATGGAGACGCAGAGCAAACAGGG - Intronic
924918454 1:248599507-248599529 ACGGAGACGCAAAGGGCATAGGG + Intergenic
1062929720 10:1344873-1344895 ATGGAGAAACAGCGGGCACACGG - Intronic
1063768683 10:9172687-9172709 ATGCAGGTTCAGAGGACACAGGG - Intergenic
1063957781 10:11282269-11282291 ATGGGGACCGAGAGGGCAGAGGG + Intronic
1063998108 10:11640290-11640312 AGGGAGAGTCAAAGGGCACATGG - Intergenic
1064473314 10:15659766-15659788 ATGTAGACAGAGAGGGCAGAAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1067583241 10:47458717-47458739 ATGGAGACTGAGAAGTCCCACGG - Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068465639 10:57387166-57387188 ATGGAGACTCAGAAGCCCAAGGG + Intergenic
1068635184 10:59340526-59340548 ATGGAGAGTCCGAAGGAACAAGG - Intronic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069718102 10:70533682-70533704 AGAGCGACTCAGAGGGCACCAGG - Intronic
1070600848 10:77865314-77865336 ATGAAGGATCAGAGGTCACAGGG + Intronic
1070827943 10:79401999-79402021 ATGTAGAAACAGAGGCCACAGGG + Intronic
1071049951 10:81435179-81435201 ATGGTGAATCAGAGGCCACAAGG + Intergenic
1071249043 10:83797130-83797152 CTGGAGACTCAGAGGGCATGAGG - Intergenic
1072429208 10:95356215-95356237 AGAGAGGCTCAGAAGGCACAAGG + Intronic
1073248784 10:102109190-102109212 ACGGAGACTCAGATGGGAGAGGG + Intronic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1075033652 10:119044104-119044126 ATAGAGATTCAGAAGGCACCTGG - Exonic
1075870592 10:125770176-125770198 CTGGAAGCTCTGAGGGCACAAGG - Intronic
1076194984 10:128511346-128511368 ATGGAGATTCAGAGGCCTCCAGG + Intergenic
1076367012 10:129927691-129927713 AGGTAGACTCAAAGGGCAGAGGG - Intronic
1076559101 10:131349588-131349610 ATGCATATGCAGAGGGCACATGG - Intergenic
1077199923 11:1301595-1301617 ATTGACCCTGAGAGGGCACAAGG - Intronic
1077378704 11:2217831-2217853 ATAGGGACCCAGTGGGCACAGGG - Intergenic
1077383527 11:2258485-2258507 ATGCCTGCTCAGAGGGCACAGGG + Intergenic
1077888699 11:6403885-6403907 ATGGGGTCTCAGAGGGGACCGGG - Intronic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1078965571 11:16336707-16336729 ATGGAGTCTCATAGGCTACAGGG - Intronic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1081838894 11:46181068-46181090 ATGGAGAGAGAGAGGCCACATGG + Intergenic
1081927424 11:46842613-46842635 ATGGTGAGACAGAGGGCAAATGG + Intronic
1082167121 11:48962702-48962724 ATGGAGACTCCCATGGCCCAAGG - Intergenic
1082901510 11:58258474-58258496 TTGGAGACTCAGAGGGGAAGAGG - Intergenic
1084116720 11:67046677-67046699 AGGGAGAGGCAGAGGACACATGG - Intronic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1084890717 11:72235638-72235660 AGGGAGACTCAGAGGAGACCTGG - Intronic
1085022261 11:73217294-73217316 ATGGAGCCCAAGAGGGCCCAAGG + Intergenic
1085339859 11:75724049-75724071 ATTGAGCCACAGAGGGGACAGGG + Intronic
1085397040 11:76211631-76211653 ATGGAGACTTAGTGAGGACACGG + Intergenic
1085516290 11:77113701-77113723 GTGGAGACTCAGTGGCCACCAGG - Intronic
1086101696 11:83106896-83106918 TTGCAGACTCTGAGGGCCCATGG - Intergenic
1086254935 11:84864511-84864533 ATGGAGGCTGAGAGGGTAGAGGG - Intronic
1087275551 11:96157000-96157022 AGGCAGACTCAGAAGGCAAAAGG + Intronic
1088927729 11:114319437-114319459 ATGGAGACTCTAAGGGGGCAAGG + Intergenic
1089324877 11:117650164-117650186 ATCCAGACTGAGAAGGCACAGGG - Intronic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1089842041 11:121426903-121426925 AGGGCGACTCAGAGATCACAGGG - Intergenic
1090936715 11:131349376-131349398 TTGGAGAGTGAGAGGGCACGAGG + Intergenic
1092546886 12:9460064-9460086 ATGAAGACTGATTGGGCACAGGG - Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1094506051 12:31062008-31062030 ATGAAGACTGATGGGGCACAGGG + Intergenic
1095121730 12:38426906-38426928 ATGGAGACTCAGATAATACATGG - Intergenic
1096427729 12:51518286-51518308 GAGGAGGCTCAGAGGGCACATGG - Intergenic
1096532165 12:52249015-52249037 CAGGAGACTGAGAAGGCACATGG + Intronic
1097083623 12:56451313-56451335 ATGGACAACCAGAGGTCACAGGG - Exonic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097468724 12:59961071-59961093 AGGGATTCTCAAAGGGCACAAGG + Intergenic
1098300740 12:69051867-69051889 TTGGAGACTCAGTGGGAAAAGGG + Intergenic
1098891088 12:76011444-76011466 ATGGAGTCTCAAATGGCACCTGG + Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099150170 12:79101469-79101491 ATGGAGAGTCAGAGTATACAAGG + Intronic
1099597185 12:84681935-84681957 ATGGAAACTCAGAAGTCCCATGG - Intergenic
1100480894 12:94977882-94977904 ATGGAGTATGAGAGGGAACAGGG + Intronic
1100549761 12:95636184-95636206 ATGGAGACTCAGTGGAGAAACGG + Intergenic
1101159853 12:101962389-101962411 ATAGAGACACAGAGGGGAAAAGG + Intronic
1102030958 12:109739866-109739888 ATGGAGCCACAGAGGCCACGAGG + Intronic
1102111084 12:110366260-110366282 ATGGAGACTGATAGGGAAGATGG + Intergenic
1106483710 13:30155226-30155248 AGGGAGGCTCAGAGGGCTGAAGG - Intergenic
1106581070 13:31018838-31018860 ATGGAACCTCAGAGTGCCCAGGG + Intergenic
1107550099 13:41465896-41465918 TAGGAGGCTCAGAGGGCAGAAGG + Intronic
1108167479 13:47708638-47708660 TTGCAGACACAGAGGGCACGAGG - Intergenic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1108844612 13:54662229-54662251 ATGGACCCCCACAGGGCACAAGG - Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112620936 13:101052947-101052969 AAGGAGACTCAAAGGGAACAAGG - Intergenic
1112621011 13:101053560-101053582 TTGTAGGCTTAGAGGGCACAGGG + Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113668806 13:112160987-112161009 ATGGAGAGTCAGAGAGCTGAAGG - Intergenic
1114152415 14:20058656-20058678 ATGTGGCATCAGAGGGCACACGG - Intergenic
1114415963 14:22544539-22544561 ATAGAGATTCAGAGGGGATAGGG + Intergenic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1115406347 14:33021336-33021358 ATTGAGACACAGAGGGCAGTTGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1117708717 14:58500629-58500651 CGGGAGGCTCAGAGGGCAGAGGG + Intronic
1118816800 14:69319667-69319689 CTGGAGACTCTGGGAGCACAGGG + Intronic
1118913494 14:70081521-70081543 ATGGAGGCCCAGAGGGCAGTTGG - Intronic
1120263916 14:82224868-82224890 ATGCAGAGTCACAGCGCACAAGG + Intergenic
1120594173 14:86413668-86413690 ATTGAAACTCAGAGGGCTCATGG - Intergenic
1120847320 14:89138100-89138122 TTGCATACTCACAGGGCACAGGG + Intronic
1121410514 14:93745613-93745635 GTGGCCACTCAGAGGGCAGAGGG - Intronic
1121493792 14:94378320-94378342 AGGGAGACTCAGAGAAAACATGG + Exonic
1121615017 14:95307924-95307946 ATGCAGACTCCGAGGTCAGAGGG - Intronic
1122772853 14:104104957-104104979 ATGCAGTCTGAGAAGGCACAAGG - Intronic
1126070375 15:44860677-44860699 ATGGAGAGTCAGCTGGGACAAGG + Intergenic
1126087660 15:45024440-45024462 ATGGAGAGTCAGCTGGGACAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1128220066 15:65962796-65962818 ATGCAGACTCAGAGGAGACCAGG + Intronic
1128748805 15:70133872-70133894 ATGGAGAAGCAAAGGGCAGATGG - Intergenic
1129607860 15:77033567-77033589 GTGGATGCTCACAGGGCACATGG - Intronic
1129829182 15:78656851-78656873 ATGTAGAATAAGAGGGCCCAGGG - Intronic
1130069494 15:80634612-80634634 CTGGAGACTGTGAGGGCACCAGG + Intergenic
1130712278 15:86294911-86294933 ATGGAGACTCGGAAGGGTCAGGG - Intronic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1131433253 15:92403181-92403203 ATGGAGACTCAGAGAGGTCTCGG + Intronic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1133423910 16:5670928-5670950 ATTGAGGCTCAGAGAGCACAAGG + Intergenic
1134059070 16:11188197-11188219 TTGGAGACTCAACAGGCACATGG + Intergenic
1134103943 16:11471851-11471873 GTGGAGACTCAGAGGGCTCTGGG + Intronic
1134435525 16:14253061-14253083 AGGAAGGCTCAGAGGCCACATGG - Intronic
1134515888 16:14886587-14886609 ATGGAGTCTCAGATGACAGAGGG + Intronic
1134703561 16:16285231-16285253 ATGGAGTCTCAGATGACAGAGGG + Intronic
1134963982 16:18426883-18426905 ATGGAGTCTCAGATGACAGAGGG - Intronic
1134968269 16:18509419-18509441 ATGGAGTCTCAGATGACAGAGGG - Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135997935 16:27267415-27267437 ACTGAGACTAAGAGGGCACAAGG + Intronic
1137396644 16:48120321-48120343 ATGGAGGATGAGAGGGCGCACGG + Intronic
1137686776 16:50391923-50391945 ATGGAAACTAAGATGGCCCAAGG - Intergenic
1138001075 16:53280506-53280528 ATGGGGACTCAGGGGGGAAAGGG + Intronic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139658797 16:68405991-68406013 AGGGTGCCTCAGAGGGGACAAGG - Intronic
1141055046 16:80805718-80805740 ATGGAGAGTGAGATGGCAGAGGG + Intergenic
1141849663 16:86636709-86636731 GAGGAGACTCAGAGGGAACGAGG - Intergenic
1142062516 16:88039887-88039909 GTGGGGACTCAGAGGGGCCACGG - Intronic
1143096732 17:4482342-4482364 AATCAGACTCAGAGGACACAGGG - Intronic
1143164255 17:4890017-4890039 ATGGGGAAGAAGAGGGCACAGGG - Intronic
1143881214 17:10031415-10031437 ATGGAGTCTCCGGGGGGACAAGG + Intronic
1144306484 17:13973355-13973377 ATGAAGACTGAGAGGGCCCAGGG + Intergenic
1144313308 17:14034607-14034629 ACAGAGACTGAGAGGGCATAGGG + Intergenic
1145308591 17:21688996-21689018 ACTGAGACCCAGAGGGGACAGGG + Intergenic
1145732642 17:27203099-27203121 ATTGAGACTCACAGGGAACAGGG - Intergenic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1146255281 17:31388740-31388762 CTGGAGAATCAGAGGTCACCTGG + Intergenic
1147879096 17:43642489-43642511 ATGGAGACCCAGAGGTCCCAGGG + Intronic
1147980558 17:44271416-44271438 AGGGAGACTCTGTGGGCAGAGGG + Intergenic
1148029138 17:44608090-44608112 ATGGAGAGGCAGGGAGCACATGG - Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1150274090 17:63884767-63884789 ATGGTGACTCAGAGGACTCTAGG + Intergenic
1150276246 17:63899572-63899594 ATGGTGACTCAGAGGACTCTAGG + Intergenic
1150278403 17:63914301-63914323 ATGGTGACTCAGAGGACTCTAGG + Intronic
1150279499 17:63920932-63920954 ATGGTGACTCAGAGGACTCTAGG + Intergenic
1151311817 17:73297574-73297596 ATAAAGACTAAAAGGGCACATGG + Intronic
1151523049 17:74644863-74644885 ATGAAGACACAGAGGGGTCAGGG - Intergenic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1152813468 17:82393243-82393265 GTTGAGACTCAGAGGACACCGGG + Intronic
1153466261 18:5390977-5390999 TTTTAGATTCAGAGGGCACATGG - Intergenic
1155150902 18:23122128-23122150 ATGGTGTCCCAGAGGGCAAAGGG + Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1157184715 18:45529008-45529030 ATGGAGAAAGAGAGGCCACATGG + Intronic
1157312498 18:46562609-46562631 CTGTAGACTCAGAGGCCACAGGG + Intronic
1158177242 18:54670419-54670441 ATGGAGACACAAAGGCCACGTGG - Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1159998939 18:74997544-74997566 ATGGACACAAAAAGGGCACAAGG - Intronic
1160397762 18:78584476-78584498 AGGGAGGCTCAGAGAGGACAGGG - Intergenic
1160397815 18:78584779-78584801 AGGGAGGCTCAGAGAGGACAGGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160820359 19:1054946-1054968 AGGGAGCCTCAGGGGGCACCTGG + Intronic
1160827713 19:1088499-1088521 ATGCAGCCTCAGAAGGAACAAGG - Exonic
1161713970 19:5865215-5865237 ATTGAGGCTCAGAGAGCACCTGG + Intergenic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1161977360 19:7613809-7613831 ATGGAGAGACAGTGGACACAGGG - Intronic
1163011982 19:14432314-14432336 ACTGAGACTCAGAGGCCACAGGG + Intergenic
1163467073 19:17474459-17474481 ATGGACACCCACAGGGCCCATGG - Intronic
1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG + Intronic
1167662845 19:50806158-50806180 ATGCAGGCTGAGAGGGGACAGGG - Intergenic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926151909 2:10429940-10429962 ATGGAGGCTGAGAGGTCCCAAGG + Intergenic
927010692 2:18900718-18900740 ATGAAGACTCAGAGGTCTCTGGG - Intergenic
927203836 2:20594626-20594648 AGCGAGTCTCAGAGGGCACTTGG - Intronic
928219619 2:29392840-29392862 TTGAACATTCAGAGGGCACAGGG - Intronic
928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG + Intergenic
929195892 2:39183788-39183810 ATGGGGAGTCTGAGAGCACAGGG + Intronic
929913033 2:46108496-46108518 GTGGAGACTCAGAGAGGTCAAGG + Intronic
930003397 2:46877232-46877254 ATGGAGAGACAGAAGCCACATGG - Intergenic
930740910 2:54831777-54831799 AGGGAGTCGGAGAGGGCACAGGG + Intronic
931868779 2:66438232-66438254 AAGGAGTCTGAGAGGGGACAAGG - Intronic
934524271 2:95042008-95042030 ATGGGGACTGAGAGGGTGCATGG - Intronic
936252827 2:110880255-110880277 ATGGGGACTGAGAGGGGACAGGG - Intronic
936350227 2:111706893-111706915 ATGGAGGCTCAGGAGGCACAAGG - Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937691478 2:124760649-124760671 ATGGAGTCTACAAGGGCACATGG - Intronic
938337945 2:130515739-130515761 AGTGAGACTCAGAGGGTGCATGG - Intergenic
938351894 2:130604999-130605021 AGTGAGACTCAGAGGGTGCATGG + Intergenic
938986592 2:136582460-136582482 ATGGATCCTCAGAGAGGACAAGG - Intergenic
939834107 2:147106981-147107003 ATGGAGACTCAGAGAGCAGTTGG + Intergenic
940048663 2:149437529-149437551 ATGGAGAGCAACAGGGCACAAGG - Intronic
941754822 2:169173837-169173859 ATGGGGACTGAGAGAGGACATGG - Intronic
943027091 2:182642984-182643006 ATGGAAAATCAGAGGTTACAAGG + Intergenic
943774712 2:191752504-191752526 ATGGAGAATAAAAGGGAACATGG - Intergenic
945833139 2:214809755-214809777 ATAGGGACTCGCAGGGCACAGGG + Intergenic
945956420 2:216090378-216090400 AAGGACACTCAGATGGCCCATGG + Intronic
945977656 2:216283297-216283319 GTGGAGAATCAGAGGGAAAAGGG - Intronic
946078425 2:217095548-217095570 AAGGAGTCTCAGAGGGAACATGG + Intergenic
946638638 2:221758599-221758621 ATGGAGACTCAAAAGGCTCGGGG - Intergenic
946668089 2:222072404-222072426 GTGGACACTCAGAGGGCAGATGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
1169030179 20:2400642-2400664 ATGTAGACTCAGAGGTCAGGAGG + Intronic
1169399831 20:5270433-5270455 ATGGGTACACAGAGGACACATGG - Intergenic
1169774916 20:9241964-9241986 ATAGAGGCTGAGAGGCCACATGG - Intronic
1169891857 20:10461973-10461995 ATGGAGTCTCAGAGCGAAAAAGG + Intronic
1170043197 20:12059861-12059883 ATGGAGACTGAGATAGCTCAAGG - Intergenic
1171312665 20:24157737-24157759 ATGGAGACTCAAAAGACAAAGGG - Intergenic
1172201826 20:33132196-33132218 AGTGACACTCAGAGGGCACTGGG + Intergenic
1172752366 20:37259660-37259682 GTGGAGCCTGATAGGGCACAGGG - Intronic
1172875515 20:38161684-38161706 GTGGGGAGTAAGAGGGCACAAGG - Intronic
1172973174 20:38888237-38888259 GAGGAGGCTCAGAGGGCTCAGGG + Intronic
1173322474 20:42000915-42000937 ATGGAGACTGAGATGGCAATTGG + Intergenic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1176155914 20:63620367-63620389 ATGGAGAGTGAGAGGGCAACAGG - Intronic
1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG + Intronic
1177274810 21:18896144-18896166 ATGTAGTCTCAGAGGCCATATGG - Intergenic
1177535675 21:22423857-22423879 ATAGGGCCTCAGAGGGGACATGG - Intergenic
1179057999 21:37953847-37953869 ATGGAGACACAGAGAGCTGAAGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180717510 22:17881770-17881792 ATGGAGGCTCAAAGGGCTCCAGG + Intronic
1180821540 22:18832342-18832364 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1181142484 22:20816670-20816692 GAGGAAACTCAGAAGGCACAGGG + Intronic
1181191438 22:21143703-21143725 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1181207760 22:21266807-21266829 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1181317403 22:21979468-21979490 CTGGGGACTCAGAGTCCACATGG - Intronic
1182990709 22:34764707-34764729 ATTGAGACTCAGATGGGACTTGG - Intergenic
1183346296 22:37310156-37310178 GTGGAGAGTCAGAGGGCTCATGG - Intronic
1183664071 22:39237334-39237356 ATGGAGACTCAGGGGTTTCAGGG - Intronic
1183806187 22:40213259-40213281 ATGGAAAGTCAAAGAGCACATGG + Intronic
1184100687 22:42340484-42340506 ACTGAGGCTCAGAGGGCCCAGGG + Intronic
1184722414 22:46322613-46322635 AAGCAGGCTCAGAGGGCAAAGGG - Intronic
1184899054 22:47432812-47432834 ATGGAGACCCAGAGGACCCGCGG + Intergenic
1203219160 22_KI270731v1_random:28609-28631 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1203271665 22_KI270734v1_random:58218-58240 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
949456837 3:4247911-4247933 ATTGAGACTCAGAGAGATCAAGG - Intronic
949516354 3:4810716-4810738 ATGGAGACTCAGAGGGGATGAGG + Intronic
950552484 3:13675205-13675227 ATGGAGACTCGGGGAGCAGAGGG - Intergenic
952613918 3:35246131-35246153 ATGGAGACTTAGATGTCACTAGG + Intergenic
952929129 3:38346401-38346423 GTGGTGACTCAGGGGCCACAGGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953867234 3:46595055-46595077 ATGTAGGCTCAGAGGGTTCATGG + Intronic
953927679 3:46990641-46990663 ACTGAAACTCAGAGGGCAGAAGG - Intronic
954426892 3:50448042-50448064 ATAGCAACTCAGAGGGCTCAAGG - Intronic
955060774 3:55489726-55489748 ATGGAGACTCAGGAGGTAAAGGG - Intronic
955691083 3:61591374-61591396 TTGGAGATTGAGAGGGCACAGGG + Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
958774080 3:98460426-98460448 ATAGAGACCCAGAGGGCTCTGGG + Intergenic
958832638 3:99108194-99108216 AAGGAGACACAGGGGGAACAAGG - Intergenic
960024283 3:112990699-112990721 CTTGAGACTCAAAGGCCACATGG + Intergenic
962391326 3:134975213-134975235 ATGGGGACTCAGAGAGCTCAGGG + Intronic
963042804 3:141081726-141081748 ATGGAGGCTCAGCAGGCTCAGGG - Intronic
963541195 3:146591185-146591207 ATGTAGAATCACAGGACACATGG - Intronic
963570668 3:146990968-146990990 TTGGAGAGTGAGAAGGCACAAGG - Intergenic
963677181 3:148327157-148327179 GTGAAGAGTTAGAGGGCACATGG - Intergenic
963751631 3:149185746-149185768 ATGGTGACTGAGAGGGGAAAGGG - Intronic
964888169 3:161508576-161508598 ATGAAGACAGAGAGGACACATGG - Intergenic
966139619 3:176741076-176741098 AGGCAGACTTAGAGAGCACAGGG + Intergenic
967322085 3:188204663-188204685 ATTGAGGCTCAGAGAGCAGATGG + Intronic
967839848 3:193996422-193996444 CTGGAGACTCAGCAGGCACCTGG - Intergenic
968037856 3:195563453-195563475 ATGGGGAGACAGAGGGCAAAAGG - Intergenic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
969694603 4:8727599-8727621 CTGCAGAGTCAGAGGGCTCAGGG + Intergenic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
971512226 4:27440955-27440977 CAGGTGACTCAGAGGACACATGG + Intergenic
972275733 4:37555910-37555932 GAGGAGACTCAGGGGGAACAAGG - Intronic
972877003 4:43374897-43374919 ATGGAGCCTGAGAGGTCCCACGG + Intergenic
973710821 4:53628962-53628984 ATGGAGGCTCAGAAGGGAAAGGG + Intronic
974298671 4:60036710-60036732 ATGGAGACTGAGAAGTCCCATGG - Intergenic
974500825 4:62699807-62699829 ATGGAGACTAAGTGGGTACAAGG + Intergenic
976559751 4:86487974-86487996 ATTGGGACTCAGAGGCCTCAAGG + Intronic
979597523 4:122550705-122550727 TTGTAGACTCAGGGGGTACATGG - Intergenic
980468757 4:133221536-133221558 ATGGAGACACAGAGGCTAGAAGG - Intergenic
980841193 4:138263611-138263633 AAGCTGACTCAGAGAGCACATGG + Intergenic
981985256 4:150846551-150846573 ATGGAGACTCAGAACTCAGAAGG + Intronic
982493988 4:156066772-156066794 ATGGAGGCTGAGAAGCCACAAGG - Intergenic
984669422 4:182465395-182465417 AGGGAGACTCAGGGAGCACACGG + Intronic
985687000 5:1287057-1287079 GTGGAGAATCAGAGTGCACCAGG + Intronic
985941161 5:3137379-3137401 CTGGATGCTCACAGGGCACATGG - Intergenic
986314527 5:6577665-6577687 ATGCATATTCAGAGGGCCCATGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987014669 5:13805800-13805822 ATGGAAACTGAGAGGGCTGAGGG + Intronic
988261536 5:28892551-28892573 ATGGAGACACAGACGGGAAAGGG + Intergenic
988428940 5:31096480-31096502 CTGGAGACAGAGAGGACACATGG - Intergenic
988490455 5:31701056-31701078 ATGGAGACTCAGGTGTCAGACGG - Intronic
990969057 5:61483157-61483179 GTGGGGACTCTGTGGGCACAGGG + Intronic
991451414 5:66754858-66754880 ATAGAGACCCAGAGGACAGAGGG + Intronic
992275256 5:75109850-75109872 GAGAAGACTGAGAGGGCACAGGG + Intronic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
995654599 5:114411398-114411420 ATGGAGACTGAGAAGTCCCAAGG + Intronic
996318677 5:122189938-122189960 ATGGAGGCTGAGAGGGCATGGGG + Intergenic
998077576 5:139248900-139248922 AAGGAGAGTCACAGGGCACAGGG + Intronic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999720259 5:154394227-154394249 ATGAAGACTCAGAGGAGACTGGG + Intronic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
999829116 5:155302461-155302483 ATGAGGATTCAGAGGCCACAAGG - Intergenic
1000245677 5:159446854-159446876 CTGGAGACTCTGAGGGCAGGTGG - Intergenic
1000863856 5:166488878-166488900 ATGGAGACCCTGAGGGAACAGGG - Intergenic
1001294603 5:170490036-170490058 AATGAGACTGAGAGGGCTCAAGG + Intronic
1002137045 5:177114076-177114098 AGGGAGAAGCAGAGGGCTCATGG - Intergenic
1003102894 6:3190763-3190785 ATGAAGCTTTAGAGGGCACACGG - Intergenic
1003885110 6:10514546-10514568 AGGGAACCTCAGAGGCCACAAGG - Intronic
1004248717 6:14004515-14004537 ATGCAGACACAGAGAGCAAAGGG - Intergenic
1005996916 6:30937119-30937141 ATGGAAAGTCAGAGGGCAGTGGG + Intergenic
1006797002 6:36738145-36738167 ACTGAGACCCAGAGGGCAGATGG + Intergenic
1006944897 6:37778585-37778607 AGGGAGACCCAGAGGGTAGAAGG - Intergenic
1006961796 6:37939359-37939381 ATAGAGACTCACAGGGGAGAAGG - Intronic
1007572755 6:42905047-42905069 ATGGAGTGTCAGAGGGCAGAGGG + Intergenic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1011495541 6:87933667-87933689 ATGGCAAAACAGAGGGCACAGGG - Intergenic
1014995313 6:128135674-128135696 TTTGAGGCTCAGAGGGCATAGGG - Intronic
1015550837 6:134410851-134410873 ATGAGGTCTCAGAGGGCACTGGG - Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016518221 6:144921009-144921031 AATGAGACTCAGAGGGAAAATGG + Intergenic
1018322631 6:162628193-162628215 ATGAAGACGCAGAGGAAACAAGG + Intronic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021224934 7:18015380-18015402 AAGGAGAAACAGAGGGCATATGG + Intergenic
1022159793 7:27698154-27698176 AATGAGACTCAGAGTGTACAAGG - Intergenic
1023598616 7:41858692-41858714 ATAGAGATACAGAAGGCACAGGG - Intergenic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1023896658 7:44439428-44439450 CTGGGCACTCAGAGGGCACGTGG - Intronic
1025728172 7:64087208-64087230 ATGGGGCCTCAGAGGGCCCTGGG + Intronic
1026040368 7:66863394-66863416 ATGATCACTCAGAGGGCAAAAGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026902200 7:74043497-74043519 ATGGGGAGTCAGAGGACACGGGG - Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027838132 7:83272713-83272735 TCGGAGACTCAGAAGGGACAGGG - Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1029729370 7:102429458-102429480 CTGGAGTCTCAAAGGCCACAGGG + Intergenic
1029974150 7:104816893-104816915 ATGGAAACCCAGAAGACACAAGG - Intronic
1030733236 7:113014367-113014389 ATGGAGGCTGACATGGCACAGGG + Intergenic
1032297055 7:130648768-130648790 AGGAAGACTCTGAGGGCAAAAGG - Intronic
1032496409 7:132366196-132366218 ATCAAGACTCAGAAAGCACAGGG - Intronic
1032522433 7:132555989-132556011 ATGGAGCCACAGAGGGCTCTAGG - Intronic
1034844380 7:154430832-154430854 ATGGAAGCTCAGCTGGCACATGG + Intronic
1035006511 7:155666158-155666180 ATGGAGACTGAGAAGTTACACGG + Intronic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035463519 7:159061317-159061339 TTTTAGACTCAGGGGGCACATGG - Intronic
1037568413 8:20137322-20137344 ACGGAGAATCAAATGGCACAGGG + Intergenic
1037877127 8:22553806-22553828 ATGAGGACTCAGAGGGCTCCGGG - Intronic
1037972016 8:23178905-23178927 ATGGAGACTGAGTGAGCACCCGG + Intergenic
1038628003 8:29212914-29212936 ATGTATAATCAGATGGCACATGG + Intronic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1039678420 8:39699987-39700009 CTGGACACTCAGAGTGCATAGGG + Intronic
1042732884 8:71956543-71956565 GTGGAGGCTCAGAAGCCACAGGG + Intronic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045661895 8:104446673-104446695 ATTGAGGCTCAGTGGCCACAAGG - Intronic
1046837521 8:118819480-118819502 ATGGAGATTTAGAGGGCATCTGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047905718 8:129471162-129471184 ATGGAGACTGAGAAGTCCCAAGG + Intergenic
1047916592 8:129590648-129590670 CTTGAGGCTCAGAGGGCTCAAGG - Intergenic
1048066376 8:130973443-130973465 CTGGAGGATGAGAGGGCACATGG + Intronic
1049469224 8:142768070-142768092 ATGGTGACTGTGAGGACACAGGG + Intronic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1050286520 9:4108401-4108423 ATGGAAACTCTGAGGGAAGAAGG + Intronic
1050860939 9:10429721-10429743 ATGAAGACTCAGGGGGCTAAGGG + Intronic
1051853062 9:21531527-21531549 GAGGAGACTCAGTTGGCACAAGG - Intergenic
1052862407 9:33445217-33445239 AGGGACACTCAGGGGGCTCAGGG - Intronic
1052955612 9:34251253-34251275 ATGGAGACTCACGGGGCTCTGGG + Intronic
1054741823 9:68813842-68813864 ATCGAGTCTCAGAGGGAGCATGG + Intronic
1055922614 9:81477321-81477343 ATGGAGACACAATGGGAACAAGG + Intergenic
1056197905 9:84246189-84246211 ATGGTCACTCATCGGGCACAGGG - Intergenic
1057950701 9:99367069-99367091 ATGGGGACTCAGGGGGCATTTGG + Intergenic
1058451217 9:105098239-105098261 AGGGAGACTCAGAAGGCAACTGG - Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058935139 9:109763192-109763214 AGGGAAACTCAGAGGGCGGAGGG + Intronic
1059193654 9:112350207-112350229 TTGGGGACTCAGAGGGTAAAGGG + Intergenic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060377146 9:123126524-123126546 GTGGGGGCTCAGAGGGCACAGGG + Intronic
1061165953 9:128922303-128922325 ATGGAGACGCTCAGGGCACTGGG - Exonic
1061629639 9:131863972-131863994 ATGGAGACGCAGAGAGGATAAGG - Intronic
1061957469 9:133971158-133971180 ACTGAGGGTCAGAGGGCACACGG - Intronic
1062189929 9:135242731-135242753 ATGGAAACTCAGAGAGCCCAGGG - Intergenic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1062570885 9:137184829-137184851 ATGCAGACACAGAGGAGACACGG + Intronic
1185962466 X:4560176-4560198 ATGGAGACTCAGAGAGCTCGAGG - Intergenic
1186997161 X:15135912-15135934 TTGGAGACTCAGGGGGGAAAGGG + Intergenic
1187098490 X:16169713-16169735 ATGGGGGCTCAGAGTGGACAGGG + Intronic
1187287855 X:17923290-17923312 ATGGAGGCTCAGAGAGGACGTGG - Intergenic
1188607450 X:32049527-32049549 ATGGAGACTCTGAAGGGATAAGG - Intronic
1189175570 X:38953866-38953888 ATGGAGGCTCAGAAGGATCAAGG + Intergenic
1189248809 X:39584059-39584081 ATGGAGACTGAGAAGGCATGTGG - Intergenic
1190237320 X:48626403-48626425 CTGGAGACTGAGAGGCCACATGG - Intergenic
1190247481 X:48700125-48700147 ATCCAGACTCAGAGAGCACCTGG + Exonic
1190394063 X:49962041-49962063 CTGAAGACTTAAAGGGCACATGG - Intronic
1190444102 X:50505764-50505786 ATTGAGACTCAGAGGCCCAAAGG + Intergenic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1192591563 X:72364235-72364257 AAGGAGACTGAGAAGGAACAGGG - Intronic
1194677172 X:96807854-96807876 AAGGACACTCAGAGGACACCTGG + Intronic
1194966033 X:100289722-100289744 ATTGAGACTCAGAGAGCTTAGGG - Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195540617 X:106058683-106058705 ATGGTGAGACAGAAGGCACAGGG + Intergenic
1197152789 X:123238322-123238344 ATGGAGGCTCAGAGGGCCTAGGG + Intronic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1199223886 X:145348993-145349015 CTTGAGAGTCAGGGGGCACAAGG + Intergenic
1199671345 X:150150848-150150870 AGGGAGCCTCAGATGGGACATGG + Intergenic
1199686267 X:150268305-150268327 ATGGTGACTCAGAGGACCCAGGG + Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1200135740 X:153873771-153873793 ATGGAAACTCAGAGGCAGCAGGG - Intronic
1200210304 X:154344190-154344212 ATGAAGAGCCAGAGAGCACACGG - Intergenic
1200220548 X:154387902-154387924 ATGAAGAGCCAGAGAGCACACGG + Intergenic
1201693371 Y:16794449-16794471 ATGTAGAATCAGTGGGAACATGG - Intergenic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic
1202193622 Y:22272526-22272548 CTGAAGATCCAGAGGGCACATGG + Intergenic