ID: 1108521080

View in Genome Browser
Species Human (GRCh38)
Location 13:51247450-51247472
Sequence GAGTTCATACATGTAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108521075_1108521080 11 Left 1108521075 13:51247416-51247438 CCTCCCCTTTCTATGGTGGTTGT 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1108521080 13:51247450-51247472 GAGTTCATACATGTAGAACATGG 0: 1
1: 0
2: 0
3: 13
4: 148
1108521076_1108521080 8 Left 1108521076 13:51247419-51247441 CCCCTTTCTATGGTGGTTGTAAG 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1108521080 13:51247450-51247472 GAGTTCATACATGTAGAACATGG 0: 1
1: 0
2: 0
3: 13
4: 148
1108521079_1108521080 6 Left 1108521079 13:51247421-51247443 CCTTTCTATGGTGGTTGTAAGGA 0: 1
1: 0
2: 0
3: 15
4: 283
Right 1108521080 13:51247450-51247472 GAGTTCATACATGTAGAACATGG 0: 1
1: 0
2: 0
3: 13
4: 148
1108521077_1108521080 7 Left 1108521077 13:51247420-51247442 CCCTTTCTATGGTGGTTGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1108521080 13:51247450-51247472 GAGTTCATACATGTAGAACATGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108521080 Original CRISPR GAGTTCATACATGTAGAACA TGG Intronic
902161715 1:14535755-14535777 CATTTCAGACATGTGGAACAGGG - Intergenic
902264426 1:15251865-15251887 GACTTCTTACCTGTAAAACAAGG - Exonic
903872447 1:26446180-26446202 GAAATAATGCATGTAGAACAGGG + Intronic
904663249 1:32100685-32100707 CAGTGCACACATGTAGCACAAGG + Intronic
905823838 1:41014811-41014833 TAGTTCATAGATGGAGACCAGGG + Intergenic
912170330 1:107092034-107092056 GAGTCCTTAAATGTAGAAGACGG + Intergenic
912396693 1:109350533-109350555 CATTTCAGTCATGTAGAACATGG - Intronic
913013322 1:114707279-114707301 AATTTCATACATGTACAAAATGG + Exonic
916430312 1:164721659-164721681 GTATTCATACCTGTGGAACATGG - Intronic
916999555 1:170341554-170341576 GACTTCATAGAGGTAGTACAAGG + Intergenic
917606828 1:176640012-176640034 GAGCTCATACAAGAAGAAAAGGG + Intronic
918031107 1:180812583-180812605 AAGTAAATACATTTAGAACATGG - Intronic
918851315 1:189694169-189694191 GAGTTTAAACATGAAGACCAAGG + Intergenic
918898985 1:190387974-190387996 GAATACATAAATGTAGAAGAAGG - Intronic
920456824 1:206107968-206107990 AAGTTGATACAGGTAGAAAAGGG + Intergenic
922497073 1:226065967-226065989 AAGGTCATACACGTAGAAAATGG + Intronic
924019213 1:239763237-239763259 GAGTTCATAAATGAAAAACATGG + Intronic
924319279 1:242831153-242831175 AAGATCACACAGGTAGAACATGG + Intergenic
1063810409 10:9698633-9698655 AAGTGCTTACATGTATAACATGG - Intergenic
1065743113 10:28814884-28814906 GAGCTCATACAAGTAAAAAAAGG + Intergenic
1067851211 10:49755840-49755862 GACTTCAAAAATGAAGAACAAGG - Intronic
1072622312 10:97088211-97088233 GAGATCATACGTGTAGAATGAGG - Intronic
1073821687 10:107271692-107271714 GAGTTCTTAAATGTGGAAGAAGG - Intergenic
1078753279 11:14185333-14185355 CAGTTCATACATATAGATCTTGG - Intronic
1086374055 11:86182790-86182812 GAGTTCATACAATTAATACATGG - Intergenic
1091967366 12:4755895-4755917 GAGTGAACACATGTGGAACACGG - Intronic
1093147767 12:15587314-15587336 AAGTTCATGCAACTAGAACATGG + Intronic
1095825199 12:46523791-46523813 GTTTTCTTACATGTATAACAGGG + Intergenic
1097658521 12:62399597-62399619 GAGTTCATATATTGAGAACAGGG + Intronic
1101033622 12:100684097-100684119 AAGTTCACACAGGTAGCACATGG + Intergenic
1101823443 12:108202023-108202045 GAGGTCAGATATGTAAAACAGGG - Intronic
1108521080 13:51247450-51247472 GAGTTCATACATGTAGAACATGG + Intronic
1108629457 13:52267441-52267463 TAGTTCAACCATGTAGAAGAGGG - Intergenic
1108656598 13:52539047-52539069 TAGTTCAACCATGTAGAAGACGG + Intergenic
1109790151 13:67236069-67236091 TAGTCCATAGATGTAAAACATGG - Intergenic
1112257708 13:97850057-97850079 GAGTTCATACCGGTAGCTCAGGG - Intergenic
1113262638 13:108582330-108582352 GAACTCATACATGTGGAACTGGG - Intergenic
1116043191 14:39710967-39710989 GAGTTCTTAAATGTACAAGAGGG - Intergenic
1117931783 14:60850715-60850737 GAGTTCCTCCATGGATAACATGG + Intronic
1120519083 14:85505256-85505278 GAGTTAAGACATGTAGCACCTGG - Intergenic
1123720712 15:23059404-23059426 GAGTTCAAACATGGACAACATGG + Intergenic
1125424323 15:39534030-39534052 GAGATAATACAGGCAGAACAGGG + Intergenic
1125544245 15:40490610-40490632 GACTTCAGAAATGTAGAACCAGG + Intergenic
1128267018 15:66275680-66275702 GACTTCATACAGGTAGCTCAGGG + Intergenic
1128877313 15:71212981-71213003 GTGCTCATACTTGGAGAACAAGG - Intronic
1132907571 16:2290790-2290812 GTGATCATACATGCAGGACATGG - Intronic
1135162991 16:20114109-20114131 GAGATCACACATGTAAAGCAAGG - Intergenic
1135812341 16:25599436-25599458 TAGTTCATAGATGTGGAACCTGG - Intergenic
1136123300 16:28156214-28156236 GAGTTCATTGATGCAGGACATGG + Exonic
1137526924 16:49244644-49244666 GGGTGCATACATGTAAAACTTGG + Intergenic
1139287001 16:65824505-65824527 CAGCTCATACATTTAGAACTAGG - Intergenic
1140750455 16:78018801-78018823 GAGTTCAGACCTGAAGGACAAGG + Intergenic
1142817298 17:2436472-2436494 GAGTAGAGACATGTAGCACAAGG - Intronic
1143044635 17:4067652-4067674 GAGTTTATATATTTAAAACATGG + Intronic
1143809248 17:9457442-9457464 GAGTTCTTAAATGTGGAAGAGGG - Intronic
1149110597 17:53024072-53024094 GAGCTCAAACATGTAAAATATGG + Intergenic
1149720669 17:58840984-58841006 GAGGGACTACATGTAGAACAAGG + Intronic
1150607233 17:66704128-66704150 GAGATTATAAATGTAGAAAAAGG - Intronic
1154020494 18:10660429-10660451 GAGTTCCTACATGGAAAACAGGG - Intergenic
1158009806 18:52715849-52715871 TAGTTCATACATGCAGGAGAAGG + Intronic
1159608172 18:70496552-70496574 GAGTTAATGCATGCCGAACAGGG + Intergenic
1160053704 18:75460133-75460155 GAGTTCTTAAAAGTAGAAGAGGG + Intergenic
1162260391 19:9528889-9528911 GAGTTCTTATATGTTGAATAAGG + Exonic
1162275755 19:9653218-9653240 GAGTTCTTACATGTTGAGTAAGG + Exonic
1162280234 19:9690608-9690630 GAGTTCTTACATGTTGAGTAAGG + Exonic
1162846155 19:13394231-13394253 GAGTTCACACAGCTAGCACATGG + Intronic
1165370231 19:35400838-35400860 GAATTTATACATGTAGAAAAGGG - Intergenic
1165480078 19:36057977-36057999 GACTTCTTACCTGTAAAACAGGG + Intronic
1165872217 19:38981039-38981061 GCGTTCAGACAAGGAGAACACGG - Intergenic
927751789 2:25676091-25676113 TAGTTTAGACATGTAGAACGTGG - Intergenic
928104846 2:28462852-28462874 TATTTCATATATGAAGAACAGGG - Intronic
928288400 2:30014788-30014810 GAGTACATGCATGTGGACCATGG + Intergenic
928957471 2:36885065-36885087 GTGTTCAGACATCTAGCACATGG - Intronic
929839855 2:45446925-45446947 AAGTTCATGCATGTTGAAAAAGG - Intronic
931786342 2:65622463-65622485 GGGTTGAGACATGTAGCACATGG + Intergenic
931899157 2:66768790-66768812 GATTCCATAGATGTAGTACAAGG + Intergenic
933290553 2:80433523-80433545 AAGTTCAGACAAGCAGAACAAGG + Intronic
933994470 2:87657747-87657769 GGTTTCATACATTTAGAACACGG - Intergenic
935163587 2:100550120-100550142 GTGGTCATACATGTAAAGCAAGG + Intergenic
936299388 2:111293166-111293188 GGTTTCATACATTTAGAACACGG + Intergenic
938716151 2:134023683-134023705 GAGATAATACATCTAGAACAGGG - Intergenic
939023993 2:136990159-136990181 GAGTTTATACATGTAGTTAACGG + Intronic
1183317906 22:37147010-37147032 GTGTTCTCAAATGTAGAACAAGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
954006581 3:47596138-47596160 GGAGTCATGCATGTAGAACAAGG + Intronic
956904127 3:73748100-73748122 GAGTTCATACATGGTGGACCAGG - Intergenic
957260935 3:77900361-77900383 CAGTTCATCCATCAAGAACAGGG + Intergenic
959149170 3:102588038-102588060 GAGGTCTTAAAAGTAGAACAGGG - Intergenic
961297677 3:125899944-125899966 GAGTCAATACATCTAGAACCAGG + Intergenic
964411403 3:156401540-156401562 AAGTTCATTCATGTAGTCCATGG + Intronic
964599533 3:158481799-158481821 GAGTTCATCCAAATAGAAAATGG - Intronic
964603426 3:158530098-158530120 GAGTTCAGGCAAGTAGAAAATGG - Intronic
966529691 3:180962054-180962076 GAGTTGATACATAAAGAGCAAGG + Intronic
968820853 4:2850154-2850176 GAGTTCATCCATGTTGTACCAGG - Intronic
969060447 4:4429788-4429810 CAGCTCATGCATCTAGAACAAGG - Intronic
969325704 4:6442644-6442666 GAGTTAATTCATATAAAACACGG - Intronic
970610191 4:17718052-17718074 AAGTTCACACATCTAGAAAAAGG - Intronic
971205466 4:24563643-24563665 GATGTCCTACATGTTGAACATGG - Intronic
972961599 4:44459951-44459973 GATTTCATACAGGCAGAAAATGG - Intergenic
973135710 4:46703717-46703739 TAGTACATACATGCAGAAAATGG + Intergenic
973834615 4:54796817-54796839 GGGTTCATACAGGTAGCATAAGG + Intergenic
974113453 4:57552084-57552106 GATTTCTTACATGTATGACAGGG + Intergenic
974618230 4:64318060-64318082 CAGTTCATTCATTTAGAAGATGG + Intronic
974819183 4:67044721-67044743 GTTTGCATTCATGTAGAACAGGG - Intergenic
975027769 4:69574276-69574298 GAGTTCTTACATGAAGACCGAGG - Intergenic
975927092 4:79470081-79470103 GAGTTAATGCATGGAGAATAAGG + Intergenic
976920409 4:90434375-90434397 GAATACATACAGGTAGAAAAGGG - Intronic
978169040 4:105647007-105647029 GGGATCATACATGGAGATCAGGG + Intronic
979691079 4:123559212-123559234 GAGATCATGTATGTAAAACAGGG - Intergenic
979936010 4:126697091-126697113 GAGTTCATAAATGTGAACCATGG + Intergenic
980225374 4:129977075-129977097 GATTTCATACCTATAAAACAGGG - Intergenic
980251499 4:130321134-130321156 GGGCTCATACATGTAGAACCTGG - Intergenic
981007224 4:139888432-139888454 GAATTCATCCATGTAGGGCAGGG + Intronic
982301631 4:153884658-153884680 GAGTTAATACTTGTTGAATAAGG + Intergenic
983677381 4:170311602-170311624 CAGTTTATACATGGATAACAAGG - Intergenic
983897706 4:173099393-173099415 GAGTTCAGACATCTAAAACTTGG + Intergenic
984483647 4:180337630-180337652 GAGTCCTTACAAGGAGAACAGGG - Intergenic
986524018 5:8653233-8653255 GAGTACACACATGTAGGACAGGG + Intergenic
986745202 5:10737566-10737588 AAGTTCAAACATGCAGATCATGG + Intronic
989646597 5:43640257-43640279 GATTTTGTACATGTATAACATGG - Intronic
990225072 5:53641186-53641208 GATTTCATACATGATGAAAAAGG + Intronic
990621830 5:57568167-57568189 GAGGTCAGACATGTAGTAAATGG - Intergenic
991201089 5:63993875-63993897 GAGTTCTTACATGTTTAAAATGG + Intergenic
991318254 5:65337431-65337453 GAATTTATACATGAAGAAGAAGG - Intronic
993560395 5:89400328-89400350 GAATTCAGACATGAAGATCATGG + Intergenic
995949065 5:117687529-117687551 GAATTTATGCATGAAGAACAAGG - Intergenic
999746109 5:154593331-154593353 GAGTGCATACATATACAGCATGG - Intergenic
1000121652 5:158203517-158203539 GAGATCATTCATGTAAAACATGG - Intergenic
1005141974 6:22642668-22642690 GAGCTAATGCATGTAGAGCATGG + Intergenic
1008872381 6:56287811-56287833 GGGTTCTTACAAGTAGAAGAGGG + Intronic
1010726897 6:79345289-79345311 GGGTTCATAAATGTGGAAAAAGG + Intergenic
1017225511 6:152016559-152016581 GATTTTATACTTGTAGAAGATGG + Intronic
1021849619 7:24795089-24795111 GAGTCCAGACATCTGGAACACGG - Intergenic
1024725931 7:52195101-52195123 AAGTTCATCCATGTAGGGCAGGG + Intergenic
1026429022 7:70325615-70325637 GAGTTTAAACAAGTAGAACCTGG + Intronic
1028770434 7:94614346-94614368 GAGATCACACTTGTAGAATAGGG - Intronic
1030741969 7:113120361-113120383 GAGACCAAACATGTACAACATGG - Intergenic
1031058227 7:117018118-117018140 CAGTTATTACATGTAGACCATGG + Intronic
1033865207 7:145682379-145682401 GAGTTCAAACATGTTGTTCAAGG + Intergenic
1034662847 7:152786805-152786827 GAGTTCATACATTTCCAATATGG + Intronic
1038758263 8:30361923-30361945 GAATGAATACATGTAGTACATGG - Intergenic
1039077419 8:33704365-33704387 GAGTTCTTAAAAGTAGAAGATGG + Intergenic
1040636526 8:49280730-49280752 GACTTCAAAAATGAAGAACAGGG - Intergenic
1042392281 8:68249788-68249810 GGGTTCATCCATGTTGAGCATGG + Intergenic
1044123431 8:88426437-88426459 AAGTTCATACATGAAGAATTAGG - Intergenic
1044533336 8:93332775-93332797 GAGTACATATATCTAGAGCATGG + Intergenic
1045737339 8:105312026-105312048 AAGTTCTTACATGCAAAACAAGG - Intronic
1046713984 8:117547230-117547252 GAGTTACTACATTTAGAACAGGG - Intergenic
1050900254 9:10939074-10939096 GACATCATAGATGTGGAACAGGG - Intergenic
1052322228 9:27180397-27180419 CAGTTCAGACATGCTGAACATGG - Intronic
1053096548 9:35333470-35333492 AATATCATACATGTAGAGCAGGG + Intronic
1186592949 X:10950673-10950695 GAGTTAATATATGTAGTATATGG + Intergenic
1188860383 X:35248477-35248499 GAATTCATACTTTTAGAATATGG - Intergenic
1190212779 X:48461017-48461039 GAGCCCATACATGCAGAACATGG + Exonic
1192385972 X:70670248-70670270 GAGTTCCCTCATATAGAACAAGG - Intronic
1192889276 X:75371127-75371149 AAGGCCATACATGTAGAAAAAGG + Exonic
1194658705 X:96604143-96604165 TAGTTCAAACATGTTCAACATGG - Intergenic
1197195578 X:123697241-123697263 GTGTTCATAAATTTAGAACCAGG - Intronic
1198820682 X:140645097-140645119 GCCTTTATACATGTACAACATGG - Intergenic
1200395185 X:155981963-155981985 GAGTTCATACAGTTAGAAAGTGG + Intergenic
1201472168 Y:14345309-14345331 GAATCCACAGATGTAGAACATGG - Intergenic
1202036698 Y:20643780-20643802 GAGTCCAGACATCTGGAACATGG + Intergenic