ID: 1108521599

View in Genome Browser
Species Human (GRCh38)
Location 13:51251571-51251593
Sequence GGTCGGGGTGGATCCACGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108521599_1108521610 6 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521610 13:51251600-51251622 TGTTCCGGGTGTCCGAGAGGCGG 0: 1
1: 0
2: 1
3: 2
4: 46
1108521599_1108521601 -9 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521601 13:51251585-51251607 ACCCCGACCTCCCGCTGTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 220
1108521599_1108521603 -8 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521603 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 20
4: 239
1108521599_1108521613 15 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521599_1108521611 7 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521611 13:51251601-51251623 GTTCCGGGTGTCCGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1108521599_1108521609 3 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521609 13:51251597-51251619 CGCTGTTCCGGGTGTCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 37
1108521599_1108521616 21 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521616 13:51251615-51251637 AGAGGCGGGCGTCCCGGCGGCGG 0: 1
1: 0
2: 5
3: 15
4: 190
1108521599_1108521615 18 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521615 13:51251612-51251634 CCGAGAGGCGGGCGTCCCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 142
1108521599_1108521617 24 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521617 13:51251618-51251640 GGCGGGCGTCCCGGCGGCGGCGG 0: 1
1: 2
2: 8
3: 101
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108521599 Original CRISPR GGTCGGGGTGGATCCACGCC AGG (reversed) Exonic