ID: 1108521602

View in Genome Browser
Species Human (GRCh38)
Location 13:51251586-51251608
Sequence CCCGGAACAGCGGGAGGTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1465
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 1449}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108521602_1108521616 6 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521616 13:51251615-51251637 AGAGGCGGGCGTCCCGGCGGCGG 0: 1
1: 0
2: 5
3: 15
4: 190
1108521602_1108521613 0 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521602_1108521610 -9 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521610 13:51251600-51251622 TGTTCCGGGTGTCCGAGAGGCGG 0: 1
1: 0
2: 1
3: 2
4: 46
1108521602_1108521621 23 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1108521602_1108521617 9 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521617 13:51251618-51251640 GGCGGGCGTCCCGGCGGCGGCGG 0: 1
1: 2
2: 8
3: 101
4: 697
1108521602_1108521611 -8 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521611 13:51251601-51251623 GTTCCGGGTGTCCGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1108521602_1108521615 3 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521615 13:51251612-51251634 CCGAGAGGCGGGCGTCCCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 142
1108521602_1108521620 22 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521620 13:51251631-51251653 GCGGCGGCGGAAGCCCCCCAAGG 0: 1
1: 0
2: 2
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108521602 Original CRISPR CCCGGAACAGCGGGAGGTCG GGG (reversed) Exonic