ID: 1108521609

View in Genome Browser
Species Human (GRCh38)
Location 13:51251597-51251619
Sequence CGCTGTTCCGGGTGTCCGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108521595_1108521609 27 Left 1108521595 13:51251547-51251569 CCTGCAGGAGGCCATCGACAACG 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1108521609 13:51251597-51251619 CGCTGTTCCGGGTGTCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 37
1108521594_1108521609 28 Left 1108521594 13:51251546-51251568 CCCTGCAGGAGGCCATCGACAAC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1108521609 13:51251597-51251619 CGCTGTTCCGGGTGTCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 37
1108521600_1108521609 -9 Left 1108521600 13:51251583-51251605 CCACCCCGACCTCCCGCTGTTCC 0: 1
1: 0
2: 1
3: 43
4: 423
Right 1108521609 13:51251597-51251619 CGCTGTTCCGGGTGTCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 37
1108521599_1108521609 3 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521609 13:51251597-51251619 CGCTGTTCCGGGTGTCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 37
1108521597_1108521609 16 Left 1108521597 13:51251558-51251580 CCATCGACAACGTCCTGGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1108521609 13:51251597-51251619 CGCTGTTCCGGGTGTCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 37
1108521593_1108521609 29 Left 1108521593 13:51251545-51251567 CCCCTGCAGGAGGCCATCGACAA 0: 1
1: 0
2: 0
3: 1
4: 99
Right 1108521609 13:51251597-51251619 CGCTGTTCCGGGTGTCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108521609 Original CRISPR CGCTGTTCCGGGTGTCCGAG AGG Exonic