ID: 1108521611

View in Genome Browser
Species Human (GRCh38)
Location 13:51251601-51251623
Sequence GTTCCGGGTGTCCGAGAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108521602_1108521611 -8 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521611 13:51251601-51251623 GTTCCGGGTGTCCGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1108521605_1108521611 -10 Left 1108521605 13:51251588-51251610 CCGACCTCCCGCTGTTCCGGGTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1108521611 13:51251601-51251623 GTTCCGGGTGTCCGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1108521600_1108521611 -5 Left 1108521600 13:51251583-51251605 CCACCCCGACCTCCCGCTGTTCC 0: 1
1: 0
2: 1
3: 43
4: 423
Right 1108521611 13:51251601-51251623 GTTCCGGGTGTCCGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1108521597_1108521611 20 Left 1108521597 13:51251558-51251580 CCATCGACAACGTCCTGGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1108521611 13:51251601-51251623 GTTCCGGGTGTCCGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1108521599_1108521611 7 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521611 13:51251601-51251623 GTTCCGGGTGTCCGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1108521604_1108521611 -9 Left 1108521604 13:51251587-51251609 CCCGACCTCCCGCTGTTCCGGGT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1108521611 13:51251601-51251623 GTTCCGGGTGTCCGAGAGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108521611 Original CRISPR GTTCCGGGTGTCCGAGAGGC GGG Exonic