ID: 1108521613

View in Genome Browser
Species Human (GRCh38)
Location 13:51251609-51251631
Sequence TGTCCGAGAGGCGGGCGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108521599_1108521613 15 Left 1108521599 13:51251571-51251593 CCTGGCGTGGATCCACCCCGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521600_1108521613 3 Left 1108521600 13:51251583-51251605 CCACCCCGACCTCCCGCTGTTCC 0: 1
1: 0
2: 1
3: 43
4: 423
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521607_1108521613 -9 Left 1108521607 13:51251595-51251617 CCCGCTGTTCCGGGTGTCCGAGA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521602_1108521613 0 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521608_1108521613 -10 Left 1108521608 13:51251596-51251618 CCGCTGTTCCGGGTGTCCGAGAG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521605_1108521613 -2 Left 1108521605 13:51251588-51251610 CCGACCTCCCGCTGTTCCGGGTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521606_1108521613 -6 Left 1108521606 13:51251592-51251614 CCTCCCGCTGTTCCGGGTGTCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521597_1108521613 28 Left 1108521597 13:51251558-51251580 CCATCGACAACGTCCTGGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1108521604_1108521613 -1 Left 1108521604 13:51251587-51251609 CCCGACCTCCCGCTGTTCCGGGT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1108521613 13:51251609-51251631 TGTCCGAGAGGCGGGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108521613 Original CRISPR TGTCCGAGAGGCGGGCGTCC CGG Exonic