ID: 1108521621

View in Genome Browser
Species Human (GRCh38)
Location 13:51251632-51251654
Sequence CGGCGGCGGAAGCCCCCCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108521602_1108521621 23 Left 1108521602 13:51251586-51251608 CCCCGACCTCCCGCTGTTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 1449
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1108521614_1108521621 -3 Left 1108521614 13:51251612-51251634 CCGAGAGGCGGGCGTCCCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1108521608_1108521621 13 Left 1108521608 13:51251596-51251618 CCGCTGTTCCGGGTGTCCGAGAG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1108521612_1108521621 5 Left 1108521612 13:51251604-51251626 CCGGGTGTCCGAGAGGCGGGCGT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1108521606_1108521621 17 Left 1108521606 13:51251592-51251614 CCTCCCGCTGTTCCGGGTGTCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1108521605_1108521621 21 Left 1108521605 13:51251588-51251610 CCGACCTCCCGCTGTTCCGGGTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1108521600_1108521621 26 Left 1108521600 13:51251583-51251605 CCACCCCGACCTCCCGCTGTTCC 0: 1
1: 0
2: 1
3: 43
4: 423
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1108521607_1108521621 14 Left 1108521607 13:51251595-51251617 CCCGCTGTTCCGGGTGTCCGAGA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1108521604_1108521621 22 Left 1108521604 13:51251587-51251609 CCCGACCTCCCGCTGTTCCGGGT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1108521621 13:51251632-51251654 CGGCGGCGGAAGCCCCCCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108521621 Original CRISPR CGGCGGCGGAAGCCCCCCAA GGG Exonic