ID: 1108522659

View in Genome Browser
Species Human (GRCh38)
Location 13:51259671-51259693
Sequence CACAGCGAGGTGAAGGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108522659_1108522668 13 Left 1108522659 13:51259671-51259693 CCCGTCCCCTTCACCTCGCTGTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1108522668 13:51259707-51259729 CACTGTAAGCTGCCAGCGCACGG 0: 1
1: 0
2: 0
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108522659 Original CRISPR CACAGCGAGGTGAAGGGGAC GGG (reversed) Intronic
901381871 1:8879361-8879383 CGCAGCAAGGAGAAAGGGACAGG - Intergenic
901798378 1:11693085-11693107 CACGAGGAGGTGAAGGTGACAGG - Intronic
902589017 1:17460309-17460331 CACAGCGAAGGGAAGGGCATAGG - Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
904316726 1:29670663-29670685 CCCAGAGAGGTGAAGGGAAGGGG + Intergenic
904412012 1:30330318-30330340 CCCAGCGAGGGGAAGGGGGGTGG - Intergenic
905564041 1:38949154-38949176 CACAGCGACCTGGAGGAGACTGG + Intergenic
907716358 1:56929855-56929877 CACAGGGAATTGATGGGGACTGG - Intronic
908572964 1:65428374-65428396 CACAGAGAGGGGAAGGGGTTTGG - Intronic
910826892 1:91418675-91418697 AGCAGGGAGGTGAAGGGGAGGGG + Intergenic
911536290 1:99105070-99105092 CACTGCCAGGAGAAGGGGAGAGG - Intergenic
912495044 1:110086121-110086143 CCCAGCCGGGTGGAGGGGACTGG - Intergenic
913067112 1:115266413-115266435 CACAGCGAGGAGCAGGGCTCAGG - Intergenic
915361246 1:155287574-155287596 GACAGCGAGGGTCAGGGGACTGG - Intronic
915874591 1:159599013-159599035 CACAGTGAGGTGGAAGGCACAGG - Intergenic
916294047 1:163197269-163197291 GCCATCTAGGTGAAGGGGACAGG - Intronic
918107935 1:181429246-181429268 CCCAGAGAGGTGAAGAGGCCTGG - Intronic
922174986 1:223189805-223189827 CACAGCCAGGCGAGGGGGAAGGG + Intergenic
923220659 1:231889610-231889632 CCCTGAGAGGTGAAGGGGCCTGG + Intronic
923642229 1:235775746-235775768 CACAGCCAGGGGAAGGGTAAAGG + Intronic
924239481 1:242027364-242027386 CCCAGTGAGGGGAAGGGGACAGG + Intergenic
1063242806 10:4188555-4188577 CGGAGCGTGGTGCAGGGGACGGG + Intergenic
1063403940 10:5774880-5774902 CACACCCAGGGGAAGGGGAAGGG + Intronic
1065682975 10:28255892-28255914 CACTGGGAGGTGAAGAGGAGAGG + Intronic
1068610576 10:59056021-59056043 CACAGAGAGGTGGAGGACACAGG + Intergenic
1069869174 10:71522768-71522790 CATAGGGAGGTGAATGGGATGGG + Intronic
1071285357 10:84139563-84139585 AACTGCGAGGCGAAGGTGACCGG + Exonic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1071562402 10:86654732-86654754 CACAGAGAAGTCAAGGGCACAGG - Exonic
1071569180 10:86687133-86687155 CCCATCGAGGTGAAGGGGCTGGG + Exonic
1071759338 10:88583095-88583117 CACAGCAAGGTACAAGGGACCGG + Exonic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073206558 10:101772491-101772513 CACAGAGAGGTGAACAGGACAGG - Intronic
1076686903 10:132202283-132202305 CGCAGCGAGGTGACGTGGACAGG - Intronic
1076983632 11:219363-219385 GACAGCGAGGTGGGGAGGACAGG - Intronic
1077130857 11:971757-971779 CACAGTGAAGTGAGTGGGACCGG + Intronic
1077182070 11:1221190-1221212 CACAGCGACGTGAACGGAGCTGG - Intergenic
1077495675 11:2885530-2885552 GACAGCGAGAAGAAGGGGAAAGG + Exonic
1077675596 11:4191130-4191152 CACAGAGGGGAGAGGGGGACTGG - Intergenic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1079360314 11:19765451-19765473 CAGAGGGAGGGGAAGGGGAAGGG - Intronic
1082005256 11:47415633-47415655 CTCCGGGAGGTGAAGGTGACAGG - Exonic
1083001638 11:59297687-59297709 CACAGAGAGGGGAAAGGGAAGGG + Intergenic
1083802350 11:65053867-65053889 AACAGCTGGGTGAAGGGGCCTGG + Intronic
1088794499 11:113256369-113256391 CACAGTGAGGTGCAGGTGCCTGG - Intronic
1089132443 11:116223277-116223299 CAGAGCCAGGTGAGGGGGAGGGG - Intergenic
1089139678 11:116275703-116275725 CACAGGCAGGTGAGGGAGACAGG + Intergenic
1092123485 12:6060359-6060381 CACACCCAGGGGAAGGAGACCGG + Intronic
1092725735 12:11483924-11483946 CTCAGAGAGGTTAAGGGGATAGG + Intronic
1096685548 12:53286153-53286175 CACAGGTGGGTGAATGGGACAGG - Exonic
1100302846 12:93324065-93324087 CACAGGGAGGTTATGGGGATTGG - Intergenic
1100316765 12:93451954-93451976 CACAATGTGGTGAAGGAGACAGG - Intergenic
1101326949 12:103723983-103724005 CAAAGCCAGGGGATGGGGACAGG + Intronic
1104326028 12:127799572-127799594 CACAGGGAGCTGGAGGAGACGGG + Intergenic
1107595728 13:41961087-41961109 GGCAGCGCGGAGAAGGGGACAGG + Intronic
1107980521 13:45730251-45730273 CACAGAGAGGTGGGGGGAACTGG + Intergenic
1108014436 13:46059655-46059677 CACAGAGATGAGAAGGGGAGAGG + Intronic
1108504082 13:51094567-51094589 CACAAAGAGGTGAGGAGGACTGG - Intergenic
1108522659 13:51259671-51259693 CACAGCGAGGTGAAGGGGACGGG - Intronic
1108622219 13:52195467-52195489 CAGAGCCAGGTGCAGGGAACCGG + Intergenic
1109044725 13:57394844-57394866 CACAGTTAGATGAAGGGGAAGGG - Intergenic
1111646457 13:91038015-91038037 TACAGACAGGTGGAGGGGACAGG - Intergenic
1111882027 13:93969512-93969534 AACAGGGAGGTGAAGGGGTAAGG - Intronic
1112490743 13:99861093-99861115 TTCAGCGAGGTGGAGGGGACTGG - Intronic
1113436582 13:110296936-110296958 CAGAGCAAGGTGTAGGGGAAGGG + Intronic
1114472641 14:22974373-22974395 CAAAGGGAAGGGAAGGGGACAGG + Intronic
1114562965 14:23606697-23606719 TACAACAAGGTGAGGGGGACAGG - Intergenic
1114896428 14:26996195-26996217 CACAGCATGGTGAGGGGGAAGGG + Intergenic
1117735651 14:58765858-58765880 CACAGAGAGGTCAAGGGGAAGGG + Intergenic
1121334813 14:93070742-93070764 CACAGAGAGTTGAAGGGGCCTGG + Intronic
1121584142 14:95051398-95051420 CAGGGCGACGTCAAGGGGACAGG - Intergenic
1121604489 14:95230589-95230611 CACAGTGTGGTGAAAGGGATTGG + Intronic
1122160358 14:99779867-99779889 CACAGTGAGAGGAAGGAGACGGG + Intronic
1122307071 14:100773030-100773052 CCCAGGGAGGAGAAGGGGAGAGG + Intergenic
1122371376 14:101230540-101230562 CTCAGCGAGGACAAGGGCACAGG + Intergenic
1122501130 14:102200396-102200418 CACAGTGAGCTGAATGTGACCGG - Intronic
1122686836 14:103512667-103512689 CACAGGGAGGCGAGGGGCACTGG + Intergenic
1123469873 15:20541737-20541759 CACAGCGACGTAGAGGTGACTGG - Exonic
1123648182 15:22458944-22458966 CACAGCGACGTAGAGGTGACTGG + Intronic
1123730167 15:23136759-23136781 CACAGCGACGTAGAGGTGACTGG - Exonic
1123748305 15:23334169-23334191 CACAGCGACGTAGAGGTGACTGG - Intergenic
1124280684 15:28358057-28358079 CACAGCGACGTAGAGGTGACTGG - Intergenic
1124302021 15:28553573-28553595 CACAGCGACGTAGAGGTGACTGG + Intergenic
1124347939 15:28934815-28934837 CACAGCAAGGTGTAGGTGGCAGG - Intronic
1125508533 15:40281098-40281120 CCCAGCGAGGGGAGGGGGGCCGG + Intronic
1125673006 15:41486849-41486871 CGAGGGGAGGTGAAGGGGACAGG - Intergenic
1126109663 15:45167886-45167908 CTCAGCCAGGTGATGGGCACAGG + Exonic
1127769637 15:62220829-62220851 CAAAGCCAGGTGAAGGATACTGG - Intergenic
1128094332 15:64942474-64942496 CACAGCGAGGTGCAGAGGAGAGG - Exonic
1128249666 15:66155437-66155459 CACACAGAGGTGAAGGGCTCAGG + Intronic
1129254846 15:74328416-74328438 CTCAGAAAGGTGAAGGGGCCTGG + Intronic
1129469111 15:75740516-75740538 CACAGAGAGGAAAAGGGGAGAGG + Intergenic
1130969754 15:88722759-88722781 CACAGCCAGGTGATAGGGCCTGG + Intergenic
1131391314 15:92051180-92051202 CACAGTGAGGTGAAGGCTTCAGG + Intronic
1131641581 15:94299041-94299063 CAAAGGGAGGGGAAGGGGAAGGG - Intronic
1132560820 16:592855-592877 CACAGCCCGACGAAGGGGACAGG - Intronic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1135588772 16:23690821-23690843 CACAGGGAGGTGAGGTGGGCTGG - Exonic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136406932 16:30053506-30053528 CCCAGAGAGGGGAAGGGGCCCGG - Intronic
1139322825 16:66129216-66129238 CACAGAGAGCTGAAAGGGCCTGG - Intergenic
1139346682 16:66308242-66308264 GTCAGCCAGGTGAAGCGGACAGG - Intergenic
1139572946 16:67824771-67824793 CAGAGCGAGGTGAATGGAAGTGG + Exonic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139872463 16:70118510-70118532 GACAGTGAGGTCAATGGGACGGG + Intronic
1140025872 16:71289633-71289655 GACAGGGAGGCGAAGGGGAGGGG + Intronic
1142508243 17:379502-379524 CACAGCTGGGTGATGGAGACAGG + Intronic
1143614177 17:8039641-8039663 CACAGGAAGGGGTAGGGGACTGG + Intronic
1144329354 17:14210367-14210389 CACAGCAAGGAGGTGGGGACAGG - Intergenic
1145901237 17:28491660-28491682 CACTGGGAGGTGAATGGGGCTGG + Intronic
1148548093 17:48531983-48532005 TACAGCGGGGTGAAGAGGAGGGG + Intergenic
1148825031 17:50386632-50386654 CACTGAGAGGTGAAGGCAACAGG + Intronic
1150780546 17:68117945-68117967 CAAAGGTAGGTGAAGGGAACTGG + Intergenic
1151480836 17:74369331-74369353 CACAGGCAGGGGAAGGGGTCGGG - Intronic
1152100807 17:78300877-78300899 AACAGGAAGGTGGAGGGGACAGG - Intergenic
1152316632 17:79584615-79584637 CACAGCGACGTGGATGGAACTGG + Intergenic
1152521845 17:80860986-80861008 CACAGCCAGGTGCAGAGCACTGG - Intronic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1160929006 19:1560926-1560948 CACAGCGAGGCTAGAGGGACAGG + Intronic
1161149607 19:2701160-2701182 AACAGTGAGTTGAAGGAGACGGG - Intronic
1161373568 19:3927422-3927444 CACAGACAGGAGACGGGGACAGG + Exonic
1162148620 19:8629409-8629431 GACAGGGAGGTGACAGGGACAGG + Intergenic
1162793992 19:13077353-13077375 CACAGCGGGGTGAGGGGAAAAGG - Intronic
1163204813 19:15794770-15794792 CACAGTGAGGTGAGAGGCACAGG - Exonic
1163206489 19:15807294-15807316 CACAGTGAGGTGAGAGGCACAGG + Exonic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
925288690 2:2732015-2732037 CACAGCAATGTGAAGGTGACCGG + Intergenic
925288697 2:2732073-2732095 CACAGCAACGTGAAGGTGACCGG + Intergenic
925288704 2:2732131-2732153 CACAGCAATGTGAAGGTGACCGG + Intergenic
925288710 2:2732189-2732211 CACAGCAACGTGAAAGTGACCGG + Intergenic
925376288 2:3388360-3388382 CACAGCGAGGGGAGGCGGGCTGG - Exonic
927115666 2:19899278-19899300 CACACATAGGTGAAGGGGAGTGG - Intronic
928398942 2:30964342-30964364 CACAGGGAGGTGGAGGTGGCTGG - Intronic
929913036 2:46108503-46108525 CTCAGAGAGGTCAAGGGGAATGG + Intronic
930855233 2:56008986-56009008 CACTGGAAAGTGAAGGGGACAGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
932453762 2:71832985-71833007 CACAGCGAGGTGACTGGCTCAGG - Intergenic
934032990 2:88065069-88065091 GAAAGCGAAGTGAAGGGGAGGGG - Intergenic
934474781 2:94586846-94586868 AACAGCCAGATGGAGGGGACGGG - Intergenic
934527692 2:95061845-95061867 CAGAGAGAGGTGCAAGGGACAGG + Intergenic
936720919 2:115252295-115252317 CACAGCAAGGTTGAAGGGACAGG - Intronic
937264127 2:120605492-120605514 CACAGGCAGGTGATGGGGATAGG - Intergenic
937417923 2:121731745-121731767 GTGAGCCAGGTGAAGGGGACAGG - Intronic
937926324 2:127170454-127170476 GTGAGCCAGGTGAAGGGGACAGG + Intergenic
940816321 2:158301743-158301765 AACAGGGAAGTGAAGGGGAGAGG + Intronic
945891515 2:215435933-215435955 CAGAGGGTGGGGAAGGGGACGGG + Exonic
946059864 2:216932765-216932787 CACAGCTAGGAGGAGGGGTCAGG - Intergenic
946212975 2:218162360-218162382 CACAGTGAGGTGTTGGGAACAGG - Intergenic
947639168 2:231696658-231696680 GACAGGGTGGTCAAGGGGACTGG + Intergenic
1169802222 20:9522036-9522058 CACAGGGAGGTGAAGCGAATTGG + Intronic
1169914786 20:10674100-10674122 CCCAGCAACGTGAAGGGGAGGGG - Exonic
1169981718 20:11392363-11392385 CACAGCGATGTGAAGGACAGAGG + Intergenic
1170812456 20:19685172-19685194 CACACCGTGGAGAATGGGACAGG + Exonic
1171284540 20:23926270-23926292 CACAGCCTAGTGAAGAGGACAGG + Intergenic
1171401545 20:24875678-24875700 CACAGCTAAGTAAAGGGGCCGGG + Intergenic
1174330299 20:49812551-49812573 CACAGCGAAGTCGAGGGCACTGG + Intergenic
1175170086 20:57074249-57074271 CACAGCAAGGTAAAGGGTCCTGG - Intergenic
1175870212 20:62205812-62205834 CAGAGCGGGGTGGAGGTGACAGG - Intergenic
1180062652 21:45393646-45393668 CACAGAGAGGTGTTGGGGAGAGG + Intergenic
1181032908 22:20156914-20156936 CACAGGGCAGTGACGGGGACGGG - Intergenic
1181689491 22:24550647-24550669 CACAGGGAAGTGAGGGGAACTGG - Intronic
1183192564 22:36331170-36331192 CCCAGAGAGGTCAAGGGGCCAGG - Intronic
1183503335 22:38194402-38194424 CAGAGGGAGGGGATGGGGACTGG + Intronic
1183959448 22:41402515-41402537 TACAGGGAGGTAGAGGGGACGGG + Intergenic
1184374377 22:44102540-44102562 CAGAGAGAGGTGAAGGGGCTGGG + Intronic
1184668241 22:45999730-45999752 CACTGCGTGGAGTAGGGGACAGG + Intergenic
950665367 3:14491996-14492018 CCCAGCGAAGTGGAGGGGAGGGG + Exonic
952007735 3:28861412-28861434 CCCAGGGAGGTGAAGTGGGCTGG + Intergenic
952339235 3:32431719-32431741 CACAGCCAGGTTAAGGAGCCAGG - Intronic
953069594 3:39506049-39506071 CACAGGGAGGGGTGGGGGACTGG - Intronic
954305441 3:49723110-49723132 CCCAGCTGGGGGAAGGGGACAGG + Exonic
954629780 3:52041540-52041562 CACAGCTAAGTGGAGGGGTCTGG - Intergenic
955193018 3:56779379-56779401 CAAAGCTAGGTGCAGGGCACAGG + Intronic
961827190 3:129605360-129605382 GACAGCGTGGTGCAGGGCACGGG - Exonic
962384204 3:134919893-134919915 CACAAATATGTGAAGGGGACGGG + Intronic
964475008 3:157090223-157090245 CACACCTAGGTAAAGGGGAGGGG - Intergenic
967613951 3:191542482-191542504 CCCAGGCACGTGAAGGGGACAGG + Intergenic
968129864 3:196186793-196186815 CTCAGCGAGGAGAAGGACACGGG - Intergenic
968481968 4:837214-837236 CCCAGCCACCTGAAGGGGACAGG + Intergenic
970597966 4:17617128-17617150 CTTAGCCAGGTGAAGGGGAGTGG + Intronic
972171130 4:36346744-36346766 CACAGGGAGGAAAAGGGGAATGG - Intergenic
972641843 4:40932637-40932659 CACAGGAGGGTGAAGGGGAGGGG + Intronic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
973870306 4:55159558-55159580 CACAGTTGGGTGAAGTGGACTGG - Intergenic
975574369 4:75848230-75848252 CACACAGAGCTGAAGGGGCCGGG - Intergenic
975986266 4:80203299-80203321 CACAGCGAGGTGAAGGAGGGCGG - Exonic
978617686 4:110612638-110612660 CACAGCGGGGTGAAGCTGTCGGG + Intergenic
979682786 4:123480113-123480135 CTCAGAGAGGTGAAGGGGTTTGG + Intergenic
982753770 4:159194183-159194205 CGCAGAGAGGTGACGGGGCCTGG + Intronic
985490074 5:174139-174161 CACAGCTAGGGGCAGGGGTCGGG + Intronic
986572592 5:9181069-9181091 CAAAGCTAAGTGAAGGTGACAGG + Intronic
987219875 5:15780099-15780121 CAAAGGGAGCTGAAGGGGAAGGG + Intronic
989724668 5:44574185-44574207 TAGGGAGAGGTGAAGGGGACTGG + Intergenic
990622687 5:57577899-57577921 CACATCGAGGTCAAGAGGCCAGG + Intergenic
1001568059 5:172713262-172713284 CCCAGCAAGGGGAAGGGGCCGGG + Intergenic
1001865942 5:175105484-175105506 CACAGAGAGGGGAAGTGGCCTGG - Intergenic
1002398561 5:178977021-178977043 CACAGCCAGATGGAGGTGACAGG + Intergenic
1002575766 5:180172839-180172861 CACAGGGAGGTGAGGAGCACAGG - Intronic
1003115139 6:3278629-3278651 CTCACCCAGGTGAATGGGACAGG + Intronic
1006171915 6:32097943-32097965 CACAGCCAGTGGAAGGGGGCAGG + Intronic
1007174294 6:39885623-39885645 CTCAGAGAGGTGAGGGGGACAGG - Intronic
1007424014 6:41735336-41735358 CAGAGCGAGGTGAGCGGGACCGG - Intronic
1007511861 6:42380185-42380207 AACAGTGAGGAGGAGGGGACAGG + Intronic
1012363282 6:98409213-98409235 CAAAGCGGGGTGGAAGGGACAGG + Intergenic
1013419417 6:109952489-109952511 CAGAGCGAGGTGAAGGGAAATGG + Intergenic
1018800389 6:167217751-167217773 CACAGGCTGGTGAAGGGGAGGGG - Intergenic
1019497581 7:1347650-1347672 CACAGCAGGGTGCAGGGCACAGG - Intergenic
1019532253 7:1509607-1509629 GACATCCAGGTGCAGGGGACTGG - Intergenic
1019944550 7:4316241-4316263 CACAGAGAGGTGAAGGGACATGG + Intergenic
1021263934 7:18495764-18495786 CACAGATAGGAGAAGGGCACCGG + Intronic
1021483349 7:21142693-21142715 CACAGTGAGGAGTAGGGGAGGGG + Intergenic
1023520688 7:41047287-41047309 GACAGCGTGGTGAAGGGGAGAGG + Intergenic
1027053205 7:75032512-75032534 CTCAGAGAGGAGAAGGGGAAGGG - Intronic
1029215541 7:98946385-98946407 AAGAGGGAGATGAAGGGGACTGG - Intronic
1029991038 7:104962730-104962752 GACAGAGAGGTGGTGGGGACAGG - Intergenic
1036180365 8:6579293-6579315 CAAATGGAGGAGAAGGGGACCGG - Intronic
1036702194 8:11020092-11020114 CACAGACAGGGAAAGGGGACTGG - Intronic
1038241213 8:25809265-25809287 CACAGTGAGGGGAAGGGGTTGGG + Intergenic
1040060252 8:43097637-43097659 CGCAGCGGGGTGGAGGGGAAGGG + Intronic
1040973622 8:53165022-53165044 CACAGCATGGTGAAGGGGAAGGG - Intergenic
1041788271 8:61660256-61660278 TACAGAGAGGTGAATGGGATGGG - Intronic
1043517359 8:81007047-81007069 CATAGAGAAGTGAAGGGGGCAGG - Intronic
1044251593 8:90009132-90009154 GTCAGTGAGGTAAAGGGGACTGG - Intronic
1047696966 8:127413433-127413455 TACAGCTAGGTGAAGGGGGCAGG - Intergenic
1048223773 8:132566086-132566108 CACAGCATGGTGAAGGGCAGGGG - Intergenic
1048395610 8:134011303-134011325 CACAGTCAGGTGCAGGGGGCGGG + Intergenic
1048538191 8:135317237-135317259 AACAGTGAGGTAAAAGGGACAGG - Intergenic
1049438851 8:142600024-142600046 CACAGTCAGGTGAAGGGGAAGGG + Intergenic
1049600273 8:143504305-143504327 CACAGCCAAGGGGAGGGGACGGG + Intronic
1049781214 8:144429792-144429814 CCCTGGGAGGTGAAGGGGAGGGG + Intronic
1052855270 9:33402913-33402935 AACAGCCAGGTGGAGGGGACGGG + Intergenic
1052873588 9:33533291-33533313 CACAGAGGAGTGAAAGGGACGGG + Intronic
1052947436 9:34179332-34179354 CCGAGCGAGGTGAAGGGCGCCGG + Intronic
1053131587 9:35618574-35618596 CACAGGGAGGACATGGGGACAGG - Intronic
1053502506 9:38611447-38611469 CACAGAGGAGTGAAAGGGACGGG - Intergenic
1053683279 9:40499255-40499277 AACAGCCAGATGGAGGGGACGGG + Intergenic
1054280435 9:63125673-63125695 AACAGCCAGATGGAGGGGACGGG - Intergenic
1054296383 9:63334753-63334775 AACAGCCAGATGGAGGGGACGGG + Intergenic
1054394400 9:64639258-64639280 AACAGCCAGATGGAGGGGACGGG + Intergenic
1054429049 9:65144457-65144479 AACAGCCAGATGGAGGGGACGGG + Intergenic
1054501334 9:65877078-65877100 AACAGCCAGATGGAGGGGACGGG - Intergenic
1056036998 9:82617341-82617363 GACAGAGAGGTGGAGGTGACAGG + Intergenic
1060149496 9:121279235-121279257 CTCAAGGAGTTGAAGGGGACAGG + Intronic
1060758631 9:126230361-126230383 CACAGCGAGGGCAGGGGGACAGG - Intergenic
1062294679 9:135818147-135818169 CAGGGCGAGGTGAGGGGAACAGG - Intronic
1190754087 X:53385732-53385754 GAAAGAGAGGTGAAGGGGACAGG + Intronic
1192452932 X:71254574-71254596 CACGGGGAGGGGGAGGGGACCGG - Intronic
1195007653 X:100701951-100701973 TACAGCGAGATGAAGAGGTCCGG - Exonic
1196463321 X:115950523-115950545 CACAGGGAAGAGAAGGAGACTGG + Intergenic
1198219448 X:134586229-134586251 CACAGCGAGGGGAGGAGGAGAGG + Intronic