ID: 1108527301

View in Genome Browser
Species Human (GRCh38)
Location 13:51296804-51296826
Sequence GCTTCCTGTCACTCACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108527298_1108527301 25 Left 1108527298 13:51296756-51296778 CCTTCCTGGTTTGGGGTGAGAGG No data
Right 1108527301 13:51296804-51296826 GCTTCCTGTCACTCACAATCAGG No data
1108527300_1108527301 21 Left 1108527300 13:51296760-51296782 CCTGGTTTGGGGTGAGAGGAAGA No data
Right 1108527301 13:51296804-51296826 GCTTCCTGTCACTCACAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108527301 Original CRISPR GCTTCCTGTCACTCACAATC AGG Intergenic
No off target data available for this crispr