ID: 1108527586

View in Genome Browser
Species Human (GRCh38)
Location 13:51299273-51299295
Sequence CACCCAAGGCAGCCCTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108527581_1108527586 20 Left 1108527581 13:51299230-51299252 CCTTGGAGGTGTGGAATCTGACT No data
Right 1108527586 13:51299273-51299295 CACCCAAGGCAGCCCTTATGAGG No data
1108527580_1108527586 26 Left 1108527580 13:51299224-51299246 CCTGGTCCTTGGAGGTGTGGAAT No data
Right 1108527586 13:51299273-51299295 CACCCAAGGCAGCCCTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108527586 Original CRISPR CACCCAAGGCAGCCCTTATG AGG Intergenic
No off target data available for this crispr