ID: 1108531962

View in Genome Browser
Species Human (GRCh38)
Location 13:51335754-51335776
Sequence TGATCCTGGCTTCCAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108531962 Original CRISPR TGATCCTGGCTTCCAGCTTC TGG (reversed) Intronic
900592022 1:3464367-3464389 TGAACGTGGCTTCCAGCTCCAGG - Intronic
901140057 1:7022905-7022927 TCATCCTGGCTTCCGGCACCTGG - Intronic
901292314 1:8133495-8133517 TGATCCTGGCACCCAGTCTCAGG - Intergenic
901635556 1:10668611-10668633 TGCTCTTGGCCTCCAGCCTCTGG + Intronic
903891804 1:26574768-26574790 TCCTGCTGGCTTCCAGCTTCAGG + Intronic
904126642 1:28245029-28245051 TGATCCTGGCAGCCAGATTTTGG + Intronic
904227642 1:29037154-29037176 TGATCCTGGCTCACTGCTCCTGG + Intronic
906418541 1:45642465-45642487 TGATGCTGTTTGCCAGCTTCTGG + Exonic
906867696 1:49440606-49440628 GGATTCTAACTTCCAGCTTCAGG + Intronic
907089859 1:51713078-51713100 GGGCCCTGGCTTCCAACTTCTGG + Intronic
908255008 1:62295868-62295890 TGATCTTTGCTTGCAGCCTCTGG + Intronic
909701301 1:78526523-78526545 TCATCCTGCCGTCCAGGTTCAGG - Intronic
911074953 1:93864267-93864289 TGACTCAGGCTTCCAGGTTCCGG - Intergenic
915660138 1:157398842-157398864 GGTTCCTGGCTTCCAGCTATAGG + Intergenic
917102385 1:171459443-171459465 TAATCCCAGCTCCCAGCTTCTGG + Intergenic
920126201 1:203695513-203695535 TCACCCTGGCCTCCAGCTTAGGG - Intronic
920340774 1:205273925-205273947 AGATGCTGACTTCCAGCATCTGG + Intergenic
920743031 1:208599291-208599313 TTACCCTGGGTTCCAGATTCTGG + Intergenic
920782710 1:209010112-209010134 TGATGCTGCTTTCCAGCTCCTGG - Intergenic
922891079 1:229062363-229062385 TCCTCCTGGCTGCCAGCTGCTGG - Intergenic
924520869 1:244805056-244805078 TGACCCCGCCTTCCAACTTCTGG + Intergenic
1063898841 10:10711079-10711101 TGGTCCTGGCCTCTACCTTCTGG + Intergenic
1065141484 10:22722777-22722799 TTCTCCTTGCTTCCTGCTTCTGG - Intergenic
1065172691 10:23047855-23047877 TGGTGCTGACTTCCAGCCTCTGG + Intergenic
1065553094 10:26888642-26888664 TGATCCTGATTGCCAGGTTCTGG + Intergenic
1067077921 10:43198583-43198605 TGACCCTGTCTGCCAGCCTCTGG + Intronic
1069511470 10:69045924-69045946 GGAACCTTGCTTCCAGCTTGAGG + Intergenic
1069981076 10:72252971-72252993 TAATCCAGGATTCCAGCATCTGG - Intergenic
1071265089 10:83957815-83957837 TGATCCTGCCTTCCAGATGGGGG - Intergenic
1071813826 10:89210854-89210876 TGATCATGGCTTCCTGCATATGG + Intergenic
1072514554 10:96166461-96166483 TGATCCTTTCTTTAAGCTTCTGG - Intronic
1073654759 10:105401790-105401812 TGATCCTGTAATCCAACTTCTGG + Intergenic
1073859223 10:107718164-107718186 TGACCCTGGCATCCAGTTTGAGG + Intergenic
1075402834 10:122173308-122173330 ACATACTGGCTTCCAGCTGCTGG + Intronic
1079320680 11:19449150-19449172 TGAACCTGGCCTCCAGTTTGGGG + Intronic
1081548121 11:44086974-44086996 TGATGCTGGCTTTCATCTTGAGG - Intergenic
1081665066 11:44911869-44911891 TGATCCTGGCTGCCAGGCTGGGG + Intronic
1081683786 11:45027215-45027237 TGATCCAGGCCTCAAGCTTCAGG - Intergenic
1086587411 11:88471124-88471146 TGATCCTGGTTTCCAGCCATTGG + Intergenic
1088712633 11:112522280-112522302 TGATACTGGCTTCAGACTTCTGG + Intergenic
1091148342 11:133300884-133300906 TTCTCCTCTCTTCCAGCTTCTGG - Intronic
1094817205 12:34200014-34200036 TGATTCTGGCTTGTAGCTGCTGG - Intergenic
1098740888 12:74171769-74171791 TGATGCTGGCCTACCGCTTCCGG + Intergenic
1099685050 12:85874441-85874463 TACTCCTGGCTTTCAGCTCCTGG + Exonic
1100656439 12:96650829-96650851 CTATCCTGGCCTCCAGCTTCAGG + Intronic
1102585237 12:113918408-113918430 AGATCCTCACTTCCAGCTTGTGG + Exonic
1104655112 12:130568503-130568525 TGATCCTGACTTCTAATTTCGGG + Intronic
1104846318 12:131848925-131848947 TGATCCAGCATTCCCGCTTCTGG - Intronic
1105434679 13:20366206-20366228 AGAACCTGGCTTCCAGGTTTTGG - Intergenic
1107650490 13:42540221-42540243 TGACCGTGTCTTCCAGCTTGGGG - Intergenic
1107693549 13:42977588-42977610 TGATCATGTCTTCCATATTCAGG - Intronic
1108531962 13:51335754-51335776 TGATCCTGGCTTCCAGCTTCTGG - Intronic
1111930090 13:94503658-94503680 CCATCCTGTCTTCCAGCTTCTGG - Intergenic
1113672562 13:112184929-112184951 AGATCCTGGCTGTCACCTTCCGG - Intergenic
1115547092 14:34473901-34473923 TTATCTTGGCTCCCAGTTTCAGG + Intergenic
1120825783 14:88953885-88953907 TCATGCTGGCTTCCATCTTTTGG - Intergenic
1121021145 14:90580868-90580890 TCTTTCTGGCTCCCAGCTTCAGG + Intronic
1121859881 14:97307569-97307591 TGGGCCTGGCTTTGAGCTTCAGG + Intergenic
1122834193 14:104423171-104423193 TGACCCTGGTTTACAGCTTTCGG + Intergenic
1123627605 15:22238521-22238543 TGAGCCTGGCTTCTGGCTGCCGG + Intergenic
1124597449 15:31102628-31102650 TGAGCCCAGCCTCCAGCTTCAGG - Intronic
1126010637 15:44299066-44299088 GGCTCCTGGCTTCTGGCTTCTGG - Intronic
1128091117 15:64919580-64919602 TGGCTCTTGCTTCCAGCTTCTGG + Intronic
1129889301 15:79060514-79060536 AGATCCTGGCTCCCAGCTTAGGG - Intronic
1130063307 15:80584826-80584848 TGATCCCAGCCTCCTGCTTCTGG + Intronic
1130156625 15:81356361-81356383 TGGTTCTGGCTTCCAGCTGAGGG + Intronic
1130391829 15:83463329-83463351 TGACTCTGGCTTTGAGCTTCTGG + Intronic
1131333638 15:91526004-91526026 TCCTCCTGGCTTCCTGCTTACGG + Intergenic
1132432715 15:101773980-101774002 GGTTGCTGGCTTCCAGATTCTGG + Intergenic
1132613258 16:828179-828201 TGCACCTGGCTTCCAGCCTCTGG - Intergenic
1134353939 16:13463545-13463567 TGATCTTGGCTTGGTGCTTCTGG + Intergenic
1136379955 16:29888609-29888631 TGATTCGGGCTACCAGCTGCAGG - Exonic
1137802152 16:51271248-51271270 TGCTCCTGGCTGCAGGCTTCAGG + Intergenic
1140649021 16:77066447-77066469 GGATAATGGCTTCCAGCTCCAGG - Intergenic
1141031458 16:80592472-80592494 TGATCTTGGATGCCAACTTCTGG + Intergenic
1141941511 16:87279059-87279081 TGCTCCTTGCTCCCAGCTGCAGG - Intronic
1141976350 16:87518836-87518858 TGAGCCTGGCTTCTGGCTGCTGG - Intergenic
1142169272 16:88612078-88612100 TGATCCTTGCTGCCAACTGCTGG + Intronic
1143140764 17:4740668-4740690 TGATCTGGGCCTCCAGCTGCCGG - Exonic
1143336177 17:6173213-6173235 TGATCCTGGCTTCATATTTCAGG + Intergenic
1143530020 17:7497334-7497356 TGATTCTGACTTCCTGCCTCAGG + Exonic
1144649670 17:16999405-16999427 TGATCCAGGCATCCCACTTCCGG - Intergenic
1145735820 17:27231078-27231100 AGTTCCTCTCTTCCAGCTTCAGG + Intergenic
1148072011 17:44914048-44914070 TGTTCTCGGCTTCCAGCCTCAGG + Exonic
1148083123 17:44978350-44978372 TAGTCCTGGCTTCCAGCCTCTGG + Intergenic
1150561577 17:66300027-66300049 TGATCCCAGCCTCCAGCCTCTGG + Intergenic
1153001716 18:461707-461729 TCATCTTGTCTTCCAACTTCAGG + Intronic
1154274071 18:12944794-12944816 TGAGCCTGGCTTCCTGCTCGGGG + Intergenic
1155876237 18:31092232-31092254 TGATCCTGACTTCCAAATTTTGG - Exonic
1158696816 18:59710807-59710829 ACCTCCTGGCTTCCAGCTCCGGG + Intergenic
1160431677 18:78817132-78817154 TGCTCCGGGCTTCCTGCTGCGGG + Intergenic
1160503356 18:79413353-79413375 TGATCTCGGCTTCCAGTCTCAGG - Intronic
1161042319 19:2116724-2116746 TGATCCAGGCGTCCAGGTCCAGG + Exonic
1161297380 19:3526741-3526763 TGATCCTGCCTTTGAGCTCCCGG - Intronic
1162054475 19:8054334-8054356 CGATCCTGGCCTCCAGCCTTGGG + Intronic
1162363319 19:10232235-10232257 TGTGCCTGCCTTCCAGCGTCGGG + Intergenic
1162392542 19:10398210-10398232 TGATCCTGGCATCCTGGTCCTGG + Intronic
1162933437 19:13968646-13968668 TGGTCATGCCTTCCATCTTCTGG + Exonic
1163677247 19:18661248-18661270 TGATCCTGCCTTCTGGGTTCCGG + Intronic
1163786362 19:19276959-19276981 TGATGCTGGCCTACCGCTTCCGG - Exonic
1165871498 19:38976052-38976074 TGGTCCTGGCCTCCTGCTTGCGG + Intergenic
1166652761 19:44586836-44586858 TGATCCTGGACTGAAGCTTCAGG + Intergenic
925361121 2:3280982-3281004 TGTACCTGGCCTCCAGCTTGGGG + Intronic
925613119 2:5719997-5720019 TGCTCCTGGCTTGCAGCCTTTGG - Intergenic
925788373 2:7455168-7455190 TGTCCCAGGCTTCCAGCCTCAGG - Intergenic
927466678 2:23341908-23341930 GGATCCTGCCCTCCAGGTTCAGG + Intergenic
927749907 2:25658497-25658519 TCATCATTGCTTCCAGCTTTTGG - Intronic
928036718 2:27831007-27831029 TGATGCTGGCTTTCAGCTGGGGG - Intronic
928792172 2:34971092-34971114 TGATCATGGTTTCCTGCTTGAGG - Intergenic
932660137 2:73644451-73644473 TGCTGCTGACTCCCAGCTTCTGG - Intergenic
933915288 2:86985704-86985726 TGATACTGGCTTCCAGGCTCAGG + Exonic
933995024 2:87661846-87661868 TGATTCTGCCTTCCATCTTTGGG + Intergenic
934007704 2:87784197-87784219 TGATACTGGCTTCCAGGCTCAGG - Exonic
935109658 2:100080873-100080895 TGATCCTGATTGCCAGCTACTGG - Intronic
935236950 2:101147330-101147352 TGATCCTGCCGTCCCGCTACTGG - Intronic
935771340 2:106425116-106425138 TGATACTGGCTTACAGGCTCAGG - Exonic
935908734 2:107870833-107870855 TGATACTGGCTTCCAGGCTCAGG + Exonic
935995422 2:108766293-108766315 TGGTACTGGCTTCCAGGCTCAGG + Exonic
936125316 2:109784336-109784358 TGATCCTGATTGCCAGCTACTGG + Intergenic
936130518 2:109835947-109835969 TGATACTGGCTTCCAGGCTCAGG + Exonic
936214179 2:110535538-110535560 TGATACTGGCTTCCAGGCTCAGG - Exonic
936219377 2:110587132-110587154 TGATCCTGATTGCCAGCTACTGG - Intergenic
936298835 2:111289067-111289089 TGATTCTGTCTTCCATCTTTGGG - Intergenic
936423316 2:112390097-112390119 TGATACTGGCTTACAGGCTCAGG - Exonic
939900464 2:147844454-147844476 TGCGCCTGGCTTCCAGCTTCGGG + Intergenic
940109094 2:150130918-150130940 TGATCTTGGTTTCCACCTTAGGG - Intergenic
940346686 2:152636293-152636315 TAAACCTAGCTTCCAGCTTTTGG - Intronic
941405710 2:165084638-165084660 TGACCCTAGCATCCAGCCTCAGG - Intergenic
942004134 2:171680782-171680804 TGGTCCCAGCTTCCAGCTTCTGG - Intergenic
942059021 2:172210622-172210644 TGACCCTGACTTCCAGTTACAGG + Intergenic
945538316 2:211048994-211049016 TGATGCTGGCTTTCAGCTGGGGG - Intergenic
945840055 2:214876892-214876914 TCCTCCTGGCTTCCAGTCTCTGG + Intergenic
948526372 2:238573465-238573487 TGCTCCTGGCTTCCAGGTGCAGG + Intergenic
948543275 2:238704860-238704882 TGATCCCTTCTTCCAGCCTCTGG + Intergenic
1169972375 20:11282259-11282281 TGATCTTTGCTTCCTGCTCCAGG + Intergenic
1170403296 20:16010658-16010680 TGATTCTGGCTTCCAGTCTTTGG + Intronic
1170445161 20:16418876-16418898 TGCTTCTGGCTTCCAGCTGGAGG + Intronic
1170924536 20:20711644-20711666 TGATGCTGTCTGCCACCTTCTGG - Intronic
1172006955 20:31824304-31824326 TGACCTTGGCTGCCAGCTTGAGG - Exonic
1172601294 20:36185291-36185313 TGATCCTCTCCTCCAGCTCCCGG - Exonic
1173868321 20:46327053-46327075 TCATCCTGGGTTCCAGTTCCAGG + Intergenic
1174343010 20:49909676-49909698 TGTTCCAGGCTTCCTGCCTCAGG - Intronic
1174760361 20:53201267-53201289 TGAAACTGGTTTCCAACTTCTGG - Intronic
1175119904 20:56709500-56709522 TGATACTGACTTCAGGCTTCTGG - Intergenic
1175176278 20:57114417-57114439 TGCTCCTGGCCTGGAGCTTCTGG + Intergenic
1177909719 21:27016299-27016321 AGGTAATGGCTTCCAGCTTCAGG - Intergenic
1179539366 21:42074182-42074204 TGCTCCGGGCCTCCAGCTTCTGG + Intronic
1180613950 22:17115520-17115542 TGACCCTAGCTTGCTGCTTCTGG - Exonic
1180931948 22:19598262-19598284 TGTTCCTGGATGCCAGCATCTGG - Intergenic
1181385167 22:22539622-22539644 GGATAATGGCTTCCAGCTTATGG + Intergenic
1184468848 22:44684202-44684224 TCAGACTGGCTTCCAGCTCCTGG - Intronic
1184834077 22:47010530-47010552 TGCTCCTGGTTTCCTGGTTCAGG + Intronic
1184957370 22:47899480-47899502 TGATGCTTGCTTCCATTTTCTGG - Intergenic
1185047778 22:48537584-48537606 AGCTCCTTGCTGCCAGCTTCTGG - Intronic
950943557 3:16920213-16920235 TGATCATGGATTCCAGATTCTGG + Intronic
952321812 3:32284684-32284706 TCCTCCTGGCTTCCAGGTACTGG - Intronic
952573196 3:34742601-34742623 TGATCCTAGATACCAGCTTGTGG + Intergenic
953785834 3:45910458-45910480 TGCTCATGGCTACCATCTTCCGG - Intronic
954263888 3:49458981-49459003 TCTTCCTGTCTTCCAGCTGCTGG - Intergenic
956467716 3:69535847-69535869 TGGTCTTGGCTACCACCTTCTGG + Intronic
957086015 3:75677711-75677733 TGATTCTGGCTTTTAGCTGCTGG + Intergenic
957602890 3:82360881-82360903 TAAGCCTGTCTTCTAGCTTCTGG + Intergenic
959484276 3:106908941-106908963 GCATCCTGGCCCCCAGCTTCAGG - Intergenic
960001295 3:112734851-112734873 TGAGCCAAGCTTCCAGCTCCAGG + Intergenic
960623372 3:119657421-119657443 AGCTCCTGTCTTCCAGCTTTAGG - Intronic
960965941 3:123104765-123104787 TAATCCTGGCTCACAGCTACTGG - Intronic
960973300 3:123154354-123154376 TGTTCCTGGCTTTGAGGTTCTGG + Intronic
960993630 3:123327342-123327364 TGATGCTGATTTCCAGCTTGTGG + Intronic
962433905 3:135347064-135347086 TGTTCCTGCCTTCCTGCCTCAGG + Intergenic
963978249 3:151507115-151507137 TGATTCTGGCTTGCAGCTGCTGG - Intergenic
964084834 3:152803774-152803796 GGATTCTGGCTTTCAGCTTCTGG + Intergenic
967218523 3:187229853-187229875 AGATCCTGGCCATCAGCTTCCGG + Intronic
969842363 4:9891914-9891936 GGCTCCTGCCTGCCAGCTTCAGG + Intronic
972213561 4:36868270-36868292 TGATCCTGGCTCCCTTCTGCCGG + Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
975146982 4:70979219-70979241 TGACCCTGTGATCCAGCTTCAGG + Exonic
979061065 4:116060739-116060761 TGATCCTGACTTCTTGCCTCAGG + Intergenic
979352806 4:119665421-119665443 TGTGCCTGCATTCCAGCTTCAGG + Intergenic
982301892 4:153887733-153887755 TGATCATGTCTTCAGGCTTCTGG - Intergenic
982362132 4:154530362-154530384 TAATGCTGGCTTCCATTTTCAGG + Intergenic
985443997 4:190009821-190009843 TGATTCTGGCTTGTAGCTGCTGG - Intergenic
986685272 5:10270869-10270891 GGATTCTGGTTTTCAGCTTCAGG - Intergenic
987092141 5:14517506-14517528 TGATACTGGATTTCTGCTTCTGG - Intronic
987397539 5:17438779-17438801 TCATTCTAGCTGCCAGCTTCTGG - Intergenic
987446100 5:18021492-18021514 TGATCTTGGCCTCCACCTCCTGG - Intergenic
990513444 5:56510418-56510440 TCAGCCTGGTTTCCAGCTCCTGG - Intergenic
991043952 5:62203715-62203737 TGATCTTGGCCTCCAACTCCTGG + Intergenic
991267488 5:64739027-64739049 TAATCCAGGCTTCCAGGATCAGG - Intronic
999384546 5:151145067-151145089 TGATCCTGGGTTCCCGCAGCCGG - Intronic
1001168272 5:169391624-169391646 GGATTCTGGGCTCCAGCTTCAGG - Intergenic
1001923256 5:175617233-175617255 TGCTCCTGGTTTCCAGCTGCAGG - Intergenic
1002070947 5:176678703-176678725 TGACCCTGGCCTCTGGCTTCAGG + Intergenic
1002389870 5:178901473-178901495 TCTTCCTAGCTTCTAGCTTCTGG + Intronic
1002445362 5:179287174-179287196 TGATCCTGGCATTGACCTTCCGG - Intronic
1007769264 6:44180113-44180135 AGATGCTGACTTCCTGCTTCGGG + Exonic
1009991223 6:70845354-70845376 TAATTCTGTCTTCCAGTTTCTGG - Intronic
1010749399 6:79601055-79601077 TGATCCTGGTTTGCAGATTCAGG - Intergenic
1012239551 6:96856545-96856567 TGATCCAGGAATCCCGCTTCTGG - Intergenic
1013680381 6:112518921-112518943 TGATTCTGGCTTGTAGCTGCTGG + Intergenic
1018833306 6:167462969-167462991 AAAACCTGGGTTCCAGCTTCTGG - Intergenic
1019429615 7:992651-992673 TGAGGCCGGCTTCCAGCCTCTGG - Intergenic
1020090033 7:5333613-5333635 GGATCCTGGGTCCCAGCTCCCGG + Intronic
1020259093 7:6520676-6520698 AGATCCTGCCGTCCAGCATCCGG - Exonic
1021903966 7:25314921-25314943 TGATCGTGGCTGCCAGCAGCAGG - Intergenic
1023036256 7:36134127-36134149 TTATCCTGGCTCTCAGCTTTGGG - Intergenic
1024015570 7:45311575-45311597 TGAGCCTGTCTTCAGGCTTCTGG + Intergenic
1028224101 7:88229740-88229762 TGCTCCTATCTTCCAGGTTCTGG + Intergenic
1029136936 7:98379891-98379913 TCATTCTCGCTTCCAGCTCCAGG - Intronic
1029443215 7:100599697-100599719 TCATCCTGCCTGCCAGCCTCGGG - Intronic
1029508426 7:100977287-100977309 TGACCTTGACTTCAAGCTTCTGG - Intronic
1031083980 7:117284011-117284033 TCATCCTCCCTTCCAGCTGCAGG - Intronic
1031513138 7:122673090-122673112 TCTTGCTGGCTTCCGGCTTCAGG + Intronic
1032616462 7:133477563-133477585 TCTTGCTTGCTTCCAGCTTCTGG + Intronic
1032876665 7:136045482-136045504 TTATCCTGGCTTCCAAAGTCCGG - Intergenic
1033225642 7:139560044-139560066 TCATCCTGGCTTCCATTTCCAGG - Intergenic
1033256630 7:139807043-139807065 TCATCCTGGATTCCTGCCTCTGG + Intronic
1033524929 7:142202161-142202183 TGATCCTTCCTTCCAGGATCTGG - Intronic
1033974460 7:147082875-147082897 TGAGCCTGGCTCCCATCTTGGGG + Intronic
1034408438 7:150922260-150922282 TGATCCTGGATTGCAGCTAGTGG + Intergenic
1034427390 7:151021275-151021297 TGGTCCTGGCTGCCGGCTTCTGG - Exonic
1035470494 7:159106120-159106142 AGGTCCTGGCTTCCAGGCTCAGG - Intronic
1036038637 8:5048559-5048581 TGCCTGTGGCTTCCAGCTTCCGG - Intergenic
1036390824 8:8323087-8323109 TGACCCTGGCTTCCAGGATGAGG + Intronic
1036694817 8:10967585-10967607 AGAGCCTGGCCTCCAGCTCCAGG - Intronic
1038765255 8:30422188-30422210 CGATCTTGGCTTCCACCTCCTGG + Intronic
1038979526 8:32742515-32742537 TGATCATGGCTTTCAGGCTCTGG - Intronic
1039380810 8:37083292-37083314 GGATCCCTTCTTCCAGCTTCTGG + Intergenic
1040058734 8:43086143-43086165 CGATCCTGGCTGCCAGCTCCAGG + Intergenic
1041310175 8:56508928-56508950 AGAACCTGGATTCCTGCTTCTGG - Intergenic
1042159046 8:65873726-65873748 TGATTCTGGCTTGTAGCTGCTGG - Intergenic
1044520521 8:93194198-93194220 TCATCCTGGCTTCGCTCTTCAGG - Intergenic
1044793159 8:95868595-95868617 TGTACCTGGTTTCCAGCATCAGG - Intergenic
1045066935 8:98456546-98456568 TGATCATGGCTTCCTGCTTTTGG - Intronic
1046210851 8:111073660-111073682 TGAACATGGCTTCCACTTTCAGG + Intergenic
1046751851 8:117934610-117934632 GGCTCCTGCCTTTCAGCTTCTGG + Intronic
1048929099 8:139296814-139296836 TGATACTCTCTTCTAGCTTCTGG - Intergenic
1049588384 8:143442214-143442236 TGAGCCTGGCTTCCACCTGGGGG - Intronic
1049789012 8:144464576-144464598 TGCTGCTGGCTTCCTGCTCCAGG - Exonic
1049799163 8:144509836-144509858 TGCTCCTGGCTGCCACCTACTGG + Exonic
1050125699 9:2354373-2354395 GGACCCTGGCTTCCGGCCTCAGG + Intergenic
1052438123 9:28456968-28456990 TGATTCTTGCTTCCAAGTTCTGG - Intronic
1052775311 9:32727181-32727203 TGAGCCTGTCCTCCTGCTTCAGG - Intergenic
1055020063 9:71659991-71660013 TGATGCAGACTTCCAGTTTCTGG + Intergenic
1056080436 9:83087474-83087496 TGAAGGTGGCTTCCAGCTTTAGG + Intergenic
1057845071 9:98516689-98516711 TGATCCTGGCTCCTAGCTCCTGG + Intronic
1059735147 9:117093021-117093043 TATACCTGGCTTCCAGCTTCAGG - Intronic
1059974632 9:119702366-119702388 TGAGCCTGGCACCCAGCATCTGG + Intergenic
1060396231 9:123318886-123318908 TGATGCTGGCTCCCAGATCCTGG + Intergenic
1060482978 9:124028730-124028752 TGGTCCTGGATTCCAGTCTCAGG + Intronic
1186229294 X:7436197-7436219 TGAACCTGGCTTTCATTTTCAGG + Intergenic
1186480928 X:9895594-9895616 TGATGCTGGCTGCCAGCCTCTGG - Exonic
1186879718 X:13853004-13853026 TGATCCAGGATTCCCACTTCTGG - Intronic
1187802876 X:23083850-23083872 TGATCCTGCAATCCAACTTCTGG + Intergenic
1188529290 X:31121051-31121073 TCCTCCTGGCTTCCGGCTCCGGG + Exonic
1190343573 X:49317171-49317193 TGTTCCTGGCTATCAGCTTCAGG - Exonic
1190344664 X:49326698-49326720 TGTTCCTGGCTATCAGCTTCAGG - Exonic
1190345757 X:49336255-49336277 TGTTCCTGGCTATCAGCTTCAGG - Exonic
1190346861 X:49345805-49345827 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190348110 X:49536832-49536854 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190349211 X:49546388-49546410 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190350315 X:49555944-49555966 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190351417 X:49565503-49565525 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190352517 X:49575056-49575078 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190353618 X:49584604-49584626 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190354720 X:49594126-49594148 TGTTCCTGGCTATGAGCTTCAGG - Exonic
1190355825 X:49603676-49603698 TGTTCCTGGCTATCAGCTTCAGG - Exonic
1190365474 X:49689513-49689535 TGTTCCTGGCTATCCGCTTCAGG + Exonic
1190365606 X:49691344-49691366 AGTTCCTGGCTATCAGCTTCAGG + Exonic
1190757744 X:53415389-53415411 TTATCCTGGGTTCTAGCTTCTGG - Intronic
1192096241 X:68214142-68214164 TGATACAGGATTCCAGTTTCTGG + Intronic
1192225478 X:69224361-69224383 TGGTCCTGGCATCCAGCATAAGG + Intergenic
1193344639 X:80390768-80390790 TGATCTTGTCTTCCACCTTGTGG - Intronic
1196057478 X:111371433-111371455 TGGACCTGGCTTCAAGCTTTTGG - Intronic
1197467249 X:126820288-126820310 TAATCCTGGCATTCAGATTCTGG - Intronic
1198505080 X:137293543-137293565 TGATCCAGCAATCCAGCTTCTGG - Intergenic
1199745574 X:150770142-150770164 TGAGCCTGCCTCCCAGTTTCAGG - Intronic
1199842613 X:151665492-151665514 TCATCCTGGTCTCCATCTTCTGG - Intronic
1199970570 X:152857319-152857341 TGATGATGGCTGCCAGATTCCGG - Intronic
1200003945 X:153075389-153075411 TGACCTTGGCTTCCAGCCTGAGG - Intergenic
1200303278 X:155000026-155000048 TGATTCTGAATTACAGCTTCTGG - Intronic
1200839458 Y:7765706-7765728 TCATCCTGGCTCCCTGCTTATGG + Intergenic