ID: 1108532875

View in Genome Browser
Species Human (GRCh38)
Location 13:51343879-51343901
Sequence CTGGGAAAACAGCAGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 354}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108532875 Original CRISPR CTGGGAAAACAGCAGGTCCA GGG (reversed) Intronic
900308942 1:2024302-2024324 CGGGGTAGACAGCAGGGCCATGG - Intronic
900309369 1:2025908-2025930 CTGGGGAAACATCCGCTCCAAGG + Intronic
900679805 1:3910568-3910590 CTCGGCCACCAGCAGGTCCACGG - Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902787993 1:18745466-18745488 CTGGGAAGACCCCAGGGCCAGGG - Intronic
902839376 1:19065556-19065578 CTGGGGAAGCAGCTTGTCCAAGG + Intergenic
902919062 1:19655880-19655902 CAGGGAAAAGAACAGGTGCAAGG - Intronic
904384550 1:30132781-30132803 CCGGGGAAGCAGCAGGTCCTTGG - Intergenic
904654813 1:32036839-32036861 CTGAGAAATCATCTGGTCCACGG - Intronic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
906252493 1:44321452-44321474 CTTGGGGAACAGAAGGTCCAGGG - Intronic
906475008 1:46163678-46163700 CAGGGAAAGCACCAGGGCCATGG - Intronic
906520696 1:46465283-46465305 TTGGGGAAACAGCAGGCCCTAGG + Intergenic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
907254365 1:53167346-53167368 CTCAGACAACAGCAAGTCCATGG - Intergenic
907276132 1:53317471-53317493 CTGAGAGAACAGCAGCTCCTCGG - Intronic
908321818 1:62986039-62986061 CTGGGAACACTGCAGGACCCAGG + Intergenic
908756302 1:67471932-67471954 TAGGGAAGACAGCAGGTACAAGG + Intergenic
911110989 1:94185111-94185133 CTGGGCAAACTGCAGGTGGAAGG + Intronic
911124515 1:94328456-94328478 ATGGGAAAACAGAAGGTTCCCGG + Intergenic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912607921 1:111011520-111011542 CTGGGAAACCATCTGGTCCTGGG - Intergenic
912694720 1:111832599-111832621 CTAGGTAACCAGCAGGACCAGGG - Intronic
916519607 1:165551998-165552020 CTGGGCAACCAGCAGCTCCAAGG + Intronic
917127100 1:171696685-171696707 CAGGAGAAACAGCAAGTCCAAGG + Intergenic
917501621 1:175590996-175591018 CTGAGAGGACAGCAGTTCCAAGG + Intronic
917928096 1:179805720-179805742 GTGGTAAAACAGCAGCTCCTGGG - Intronic
918395211 1:184107417-184107439 CTGTGAAATCATCAGGTCCTGGG - Intergenic
919824211 1:201492341-201492363 CTGGGAGAACAGAAGGGCCAAGG - Intronic
920058189 1:203207902-203207924 CTGGGAAAACCACAGGTTTATGG + Intergenic
920227107 1:204446941-204446963 CTGTGAAAGCAGCAGCCCCAAGG + Intronic
920255725 1:204652829-204652851 CTGGGAAAAGAGCTAGCCCAGGG + Intronic
920558006 1:206918329-206918351 CAGAGAAAAGAACAGGTCCAAGG - Intronic
920920719 1:210295230-210295252 CTGGGAAAGCAGGAAGTCCCCGG + Intergenic
923197466 1:231682346-231682368 CTTGAAAAACAGCAAGTGCAGGG - Intronic
923821173 1:237443886-237443908 CTGTGAAACCAGCTGGTCCTAGG + Intronic
924928037 1:248702581-248702603 CTGGGAGAACAGAAGGGCTATGG - Intergenic
1063087327 10:2831647-2831669 CTGGGACACCAGCATCTCCAGGG - Intergenic
1065481216 10:26195675-26195697 CTGAGAAAAGGGCATGTCCAAGG - Intronic
1066011867 10:31201823-31201845 CTTGGACAACAGCAGTTTCAGGG - Intergenic
1066025048 10:31348170-31348192 CTGGGAAAAAAGCAGAAGCAGGG + Intronic
1066760265 10:38742141-38742163 CTAGAGAAACAGCAGGGCCAGGG - Intergenic
1067429687 10:46234764-46234786 CTGAGAAGGCAGCAGCTCCACGG + Intergenic
1067443964 10:46329161-46329183 CTGAGAAGGCAGCAGCTCCACGG - Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069702893 10:70439538-70439560 ATGAGAAAACTGAAGGTCCAAGG + Intronic
1071568239 10:86682465-86682487 CTGGGAGCACAGCAGGTAAAAGG + Intronic
1072532696 10:96334464-96334486 CTGGGAAAACAGGAGAAACAGGG - Intronic
1074460058 10:113628618-113628640 CTGGGAAAACAGCACTTCTTAGG - Intronic
1075300283 10:121316217-121316239 GTGGGAAAATATTAGGTCCAAGG + Intergenic
1075598476 10:123749512-123749534 CTGCGATAACAGCAGGTTTAGGG - Intronic
1075793834 10:125104929-125104951 CTGTGAAAACACCAGGCCCGAGG + Intronic
1078504149 11:11917654-11917676 GTGGGAAAAAAAGAGGTCCAAGG + Intronic
1080974858 11:37326581-37326603 CTGAGGGAACAGCAGGTGCAAGG - Intergenic
1081688258 11:45057663-45057685 CTGTGACAGCAGCACGTCCATGG + Intergenic
1082712529 11:56570202-56570224 CTGGGGAAACCACAGGCCCAGGG + Intergenic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083509964 11:63200035-63200057 CTGTGAAACCATCAGGTCCTGGG - Intronic
1084068721 11:66720277-66720299 CTGGGCAGCCAGCAGGTCAATGG + Intronic
1084215367 11:67644561-67644583 CAGGGAAGGCAGCAGGGCCAGGG + Intronic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1085442663 11:76578351-76578373 CTGGGAGAAGGGCAGGTCCCAGG - Intergenic
1089005905 11:115090613-115090635 CTGAGGACACAGCGGGTCCAGGG + Intergenic
1089702664 11:120254864-120254886 CTGGGGTAACAGCAGATCCCTGG + Intronic
1090453645 11:126828518-126828540 ATTGGTAAACAGCAGGACCAGGG + Intronic
1090755307 11:129785156-129785178 CTAGGAAACCAGCAGGGCAAAGG - Intergenic
1090833666 11:130438311-130438333 CTGGGAAAACAGCAGGGAAGAGG + Intergenic
1091186252 11:133650303-133650325 CTGGGGAAACACTATGTCCAAGG - Intergenic
1097021985 12:56027105-56027127 CTGGGACAACAGCAGGTATGGGG + Intronic
1097098981 12:56572908-56572930 CTGGGAAAACTGCAGGTATAGGG - Intronic
1097162245 12:57055443-57055465 CTGGGAAATCATCCAGTCCAAGG + Intergenic
1097185095 12:57192493-57192515 CTGGGAAAGCTGCAGGTCTGTGG - Intronic
1098484703 12:71007051-71007073 CAGGGAAAACAGCAGGCACCAGG + Intergenic
1099517599 12:83616848-83616870 CTTGAAAAACAGCAGATGCAAGG - Intergenic
1100105447 12:91165860-91165882 CTGGGAATATAGCAGGACCAAGG + Intronic
1100723485 12:97384093-97384115 GTGGGAAAACAGCTGGTCAGGGG + Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1101988488 12:109465785-109465807 ATGGGAAAACTGCAGTTCCTGGG - Intronic
1102788054 12:115620163-115620185 CTGGGAAAAGAGGAGAACCAAGG + Intergenic
1104633044 12:130420772-130420794 CTGGCAAGACTGCAGGCCCAGGG + Intronic
1105225806 13:18430470-18430492 CTGGGAAAACAGAATGGCCCTGG + Intergenic
1106788297 13:33129358-33129380 CTGGGCAGAGAGCAGGTCCCTGG - Exonic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1108594649 13:51938810-51938832 CTGGAAAAAAAGGAGTTCCAGGG - Intronic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1111485899 13:88897499-88897521 CTCGCAAAACTGCAGGGCCAGGG + Intergenic
1111984126 13:95048591-95048613 CTGGGAAAAATGGAGGTGCAAGG + Intronic
1112138894 13:96615868-96615890 CTGGGAAAGCAGTTGCTCCATGG + Intronic
1112668983 13:101613336-101613358 CTGGGAACACAGGAGGACCCTGG - Intronic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113566739 13:111323827-111323849 CAGGGATCACAGCAGGTTCAGGG - Intronic
1113896298 13:113766434-113766456 CTGGGACAGTGGCAGGTCCAAGG + Intronic
1114153053 14:20066614-20066636 CTGTGAAACCATCTGGTCCAGGG - Intergenic
1114328417 14:21612689-21612711 GTGGGAAAACAGCATGGCCATGG - Intergenic
1115427254 14:33274366-33274388 CTAGGAAAAGAGCATGTTCACGG - Intronic
1116117310 14:40671570-40671592 TTGAGAAAACAGCAGATGCAAGG + Intergenic
1117488317 14:56221337-56221359 CTGCCAACACTGCAGGTCCAGGG - Intronic
1118389862 14:65287169-65287191 CTGGGAAAGGAGGAGGCCCAGGG - Intergenic
1118746002 14:68773695-68773717 CTTGGAAAAGAGCAAGTCCAAGG - Intergenic
1119660944 14:76451164-76451186 CTGGGAAAACAGCATGGCACTGG + Intronic
1122925136 14:104895943-104895965 CTGAGAAAACAACAGTTCCTGGG - Exonic
1123632237 15:22269505-22269527 CTGAGAAAACAGCCTCTCCAAGG - Intergenic
1124453932 15:29822863-29822885 CTGGGCAAACAGCATGGTCACGG + Intronic
1124577383 15:30921858-30921880 CTGGGAACACAGCAGGTCACAGG - Intronic
1124881355 15:33645794-33645816 CTAGGAAATCAGCAGTTCCTAGG - Intronic
1125194841 15:37034263-37034285 ATGGGGAAACAGAAAGTCCAGGG + Intronic
1126301955 15:47207227-47207249 ATGGGAAAACTGCAAGTCAATGG - Intronic
1127475552 15:59329189-59329211 CTGGGAAGACAGCTCCTCCATGG + Intronic
1128119120 15:65133149-65133171 CTGGGAGTACAGCAGGACCCAGG + Exonic
1128248112 15:66146876-66146898 ATGGGCAAAGAGCAGGTACAAGG - Intronic
1128599106 15:68980486-68980508 CTGGGAGAGGAGCAGGTCTAAGG + Intronic
1129686343 15:77688180-77688202 CTCTGAAGACAGCAGGGCCAGGG + Intronic
1129965332 15:79729899-79729921 CTGGAAAAACAGAATGTCCTGGG + Intergenic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130575038 15:85084505-85084527 GTGGGAAAAAAGCAGGCCCAAGG - Intronic
1131070112 15:89460795-89460817 CTGGGAAAATAGAAGGTACCAGG - Intergenic
1132382317 15:101374756-101374778 ATAGGAAAACAGCAGGTCGGAGG + Intronic
1132632124 16:923221-923243 ATGGCAAAACAGCAGGGGCAAGG + Intronic
1133551471 16:6859505-6859527 TTGGGAAATTTGCAGGTCCATGG - Intronic
1134004321 16:10807761-10807783 CTGTGAGAACAGCAGATTCAGGG - Intronic
1134049641 16:11128457-11128479 CTGGGACAACAGCAAGTCAGAGG + Intronic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1136078285 16:27831927-27831949 CTTGGAAAGCAGCGAGTCCAGGG - Intronic
1136079572 16:27842853-27842875 CAGAGGGAACAGCAGGTCCAAGG - Intronic
1136683695 16:31982162-31982184 CCGGGAGAACAGCAGGGCCGAGG + Intergenic
1136784324 16:32925718-32925740 CCGGGAGAACAGCAGGGCCGAGG + Intergenic
1136885461 16:33928088-33928110 CTGGGAGAACAGCAGGGCCGAGG - Intergenic
1137584701 16:49657449-49657471 CTGGGAATTCAGCAGCTGCAGGG + Intronic
1138420763 16:56897718-56897740 CTGGGCTAACAGCATGTCCTTGG + Intronic
1138657421 16:58499415-58499437 CTGGGCAGATAGCAGGGCCAGGG - Intronic
1139619136 16:68122843-68122865 ATGGAAAAACTGCAGGGCCAAGG - Exonic
1140102349 16:71928526-71928548 CAGGGAAAACAGAATTTCCACGG - Exonic
1140465950 16:75182883-75182905 CTGGGATTACAGGAGGTGCAGGG - Intergenic
1141188977 16:81809651-81809673 CAGAGAAAACAGCAAGTCCCAGG - Intronic
1141774679 16:86115351-86115373 CTTGGAAAAGAAGAGGTCCAAGG + Intergenic
1203086981 16_KI270728v1_random:1189724-1189746 CCGGGAGAACAGCAGGGCCGAGG + Intergenic
1143684312 17:8501723-8501745 ATGAGAACACAGCAGGTCTATGG + Intronic
1144119490 17:12136874-12136896 CCTGGAATACAGCAAGTCCATGG - Intronic
1144261595 17:13527122-13527144 CGTGGGAAACAGCAGGTCCCAGG + Intronic
1144437319 17:15253538-15253560 CGTGGAAGACAGCAGGTCTAAGG + Intronic
1145302980 17:21653734-21653756 CTAGGTAGACAGCAGGTTCAAGG + Intergenic
1145347060 17:22048107-22048129 CTAGGTAGACAGCAGGTTCAAGG - Intergenic
1146652440 17:34614940-34614962 CTGGGAGATCAGCTGGGCCATGG - Intronic
1147144612 17:38477869-38477891 CCGGGAGAACAGCAGGGCCGAGG + Exonic
1147907284 17:43831643-43831665 CTGGGAGGTCAGCAGGGCCAGGG + Exonic
1148130342 17:45258362-45258384 CTGGGGGAACAGCAGGACCTGGG - Intronic
1149739068 17:59026193-59026215 CTGGGAAAACTGGATATCCATGG + Intronic
1150332915 17:64308802-64308824 CTGGGAAAGAAGCAAGGCCAAGG - Intergenic
1152286212 17:79414726-79414748 CTGGGAAGACAGCGTGCCCACGG + Intronic
1152420359 17:80189560-80189582 CTGGGAAAAGTGCAGATTCATGG - Intronic
1154527569 18:15309051-15309073 CTGGGAAAACAGAATGGCCCTGG - Intergenic
1158340139 18:56457335-56457357 GCAGGAAAACAGAAGGTCCAAGG + Intergenic
1159109698 18:64042615-64042637 CAGGCAAAACAGCACGTGCAGGG + Intergenic
1159203089 18:65214050-65214072 CTGGGAAAACAACAGCTATAAGG - Intergenic
1159827590 18:73233542-73233564 CTGTGAAATCAACAAGTCCAAGG - Intronic
1160854060 19:1208048-1208070 CTGGGAAAGGAGCAGGGCCTGGG - Intronic
1160920783 19:1519382-1519404 ATGGGAAAACATCAGGAGCAGGG + Intergenic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163509178 19:17725263-17725285 CATGGAAAACAGCAGGTCGCTGG - Intronic
1163697139 19:18769647-18769669 GTGGAAACACAGCAGGTCCTGGG + Intronic
1163710436 19:18843351-18843373 CTGAGGGAACAGCAGGTGCAAGG + Intronic
1164646009 19:29859055-29859077 CTGGGAAGATGGCAGGTCGAGGG + Intergenic
1167621421 19:50563118-50563140 CTGGGGAAACAGCAGTCCCCTGG + Intronic
1167621788 19:50564823-50564845 CTGGCAAGAAAGCAGGGCCAGGG + Intronic
925921175 2:8639010-8639032 GTGGGAGACCAGCAGCTCCAGGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
929437875 2:41941977-41941999 CTGGTGATTCAGCAGGTCCATGG - Intronic
930729000 2:54709622-54709644 CTGGGAAACAGGCAGGTCCCTGG + Intergenic
931966987 2:67545503-67545525 CTGGCAAGAGAGCAGGTGCATGG + Intergenic
932791592 2:74658240-74658262 CTGGGGAAACAACAAATCCAGGG + Intronic
935705799 2:105856136-105856158 CTGGGAAAACAAGAGGCACATGG - Intronic
936039609 2:109140277-109140299 CCGGCAAAAGAGAAGGTCCATGG - Intronic
936814864 2:116447579-116447601 CTGGGAAAACAGCAACACAAGGG - Intergenic
938096702 2:128468625-128468647 CTGGAAACACAGCAGCTGCAGGG - Intergenic
938374856 2:130798458-130798480 CTGGGTACACAGCAGGACAATGG + Intergenic
938526665 2:132140508-132140530 CTGGGAAAACAGAATGGCCCTGG - Intergenic
939054183 2:137343240-137343262 CTGTGAAGACATCAGGTCCTTGG + Intronic
940730992 2:157391302-157391324 CTGTGAATACATCAGGTCCTGGG + Intergenic
943676561 2:190721514-190721536 CTGAGAAAAAAGCAGGTGAAAGG - Intergenic
944035265 2:195287313-195287335 CTGGGAGAACTACAGCTCCATGG + Intergenic
944911122 2:204311359-204311381 CTGGGTGAGCAGCAGGTCTAGGG - Intergenic
945431771 2:209772525-209772547 CTGGAAAAACAACAGGTCACTGG - Intronic
945880789 2:215322827-215322849 CTGGCATAACAGCAGGCACATGG - Intronic
945924559 2:215790074-215790096 CTTAGAAAGCAGCAGGGCCATGG + Intergenic
946803694 2:223448916-223448938 ATGGAAAAATTGCAGGTCCAAGG + Intergenic
946832105 2:223737441-223737463 CTGGGAAAAGGGCAGGGCCCAGG - Intergenic
947911222 2:233802252-233802274 CTGGCAGAACACCAGCTCCATGG + Exonic
947962704 2:234253027-234253049 ATGGGAAAATAGCAGGTGCACGG - Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
1168812872 20:717660-717682 CTGAGGAAACAGCACGTGCAAGG - Intergenic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1171262697 20:23747842-23747864 CTGGGAGAACAGAAGGTCCCTGG - Exonic
1171480154 20:25448941-25448963 CAGGCAAAAGAGCATGTCCAGGG - Intronic
1171520501 20:25771426-25771448 CTAGGTAGACAGCAGGTTCAAGG + Intronic
1171556418 20:26085067-26085089 CTAGGTAGACAGCAGGTTCAAGG - Intergenic
1171953691 20:31443005-31443027 TGGGGAAAACAGCAAGTGCAAGG + Intronic
1172324623 20:34024884-34024906 CTGGGAGAACTGCAAGACCATGG + Intronic
1172894510 20:38291178-38291200 GTGGGAAAACAGCAAACCCAGGG - Intronic
1175226737 20:57449004-57449026 TAGGGAAAACAGCCTGTCCAAGG + Intergenic
1176085867 20:63295168-63295190 CTGGGAAGAGAGCAAGTTCAAGG + Exonic
1176286870 21:5023039-5023061 CTAGGAAATCAGCAGTGCCAGGG - Intronic
1176769861 21:13059493-13059515 CTGGGAAAACAGAATGGCCCTGG + Intergenic
1177861161 21:26455972-26455994 CAGAGAATACAGCAGGCCCATGG - Intergenic
1178436535 21:32564258-32564280 CTGGGAAACCAACTGGTCCAGGG + Intergenic
1178469198 21:32876557-32876579 CTGGAAAAACAGCACTTCAAGGG + Intergenic
1179426553 21:41284061-41284083 CAGGGAAATCAGGAGGTCCAGGG + Intergenic
1179870311 21:44240436-44240458 CTAGGAAATCAGCAGTGCCAGGG + Intronic
1180660627 22:17463854-17463876 CAGGGAAAAGAAGAGGTCCAAGG + Intronic
1181389438 22:22569326-22569348 CTGGGAAAACCTTCGGTCCAGGG - Intergenic
1181464058 22:23101391-23101413 CTGGCTACACAGCAGCTCCAAGG - Intronic
1181676089 22:24454196-24454218 CTGGGACCACAGCTGTTCCAGGG - Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182651654 22:31856343-31856365 CTGGGACAACAACAAGGCCATGG + Intronic
1183686755 22:39365466-39365488 CTGGGCACACAGCAGGCCCTGGG + Intronic
1184037012 22:41923077-41923099 CTGGGCACACAACAGGTCCTTGG + Intergenic
1184851500 22:47124031-47124053 CTGGGCACATGGCAGGTCCATGG + Intronic
1185402461 22:50626017-50626039 CAGGGTAGGCAGCAGGTCCAGGG + Exonic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
949141499 3:638899-638921 CTTGAAAAACATCAGTTCCATGG - Intergenic
949408725 3:3741338-3741360 CTTGGATAACAGCAGCTCCTAGG - Intronic
952101486 3:30018040-30018062 CTTGGAACACAGGTGGTCCAAGG - Intergenic
953363838 3:42324969-42324991 CAGGGATAAAAGCATGTCCATGG + Intergenic
953573126 3:44088679-44088701 CTAGGAAAACATCTGGACCAGGG + Intergenic
954659257 3:52218196-52218218 AGGGGATAACACCAGGTCCATGG + Intergenic
954705603 3:52479028-52479050 TTGGGAGAACAGAAGGTCCAAGG - Intronic
954864822 3:53719342-53719364 ATGGGAAAGCAGCAGGTCTTGGG - Intronic
955732449 3:62000863-62000885 CTGGGAAAGCAGATGATCCAGGG - Intronic
958788396 3:98623729-98623751 CTGGGGAGGCAGCAGCTCCAGGG - Intergenic
958813424 3:98889873-98889895 CTTGTAAAACTGCAGATCCAAGG - Intronic
959841459 3:110981759-110981781 CTAGGAAAACAGTAGGTTCAGGG - Intergenic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
961506642 3:127374741-127374763 CTGGGGACACAGCAGGTCCTGGG - Intergenic
963929194 3:150984523-150984545 CAGTGAAACCATCAGGTCCAGGG + Intergenic
964548930 3:157865479-157865501 CTGGAGAAGCAGCAGGGCCAGGG - Intergenic
967132777 3:186487892-186487914 CTGGGAAAAGAGGAGTCCCAGGG - Intergenic
967775500 3:193382046-193382068 GTGAGATAACAGCAGATCCAGGG + Intergenic
967930540 3:194687374-194687396 CTGGTAGAGCAGCAGGGCCATGG - Exonic
968262943 3:197339830-197339852 CTGGGAAAACAGCAGGACCTAGG - Intergenic
969055967 4:4402913-4402935 CTGGGAAGGAAGCAGATCCAGGG - Intronic
969119827 4:4899933-4899955 CTGGAAACAAAGCAGGTCAAGGG - Intergenic
969171977 4:5371455-5371477 CTAGGAGAAAAGCAGGTTCAGGG + Intronic
969462089 4:7334281-7334303 CTGGGGAAGGAGGAGGTCCAAGG - Intronic
969835109 4:9834095-9834117 CTAGAAAAACAGCAAGTGCAAGG - Intronic
970191482 4:13523079-13523101 CTGGGAACACGGCATGCCCAAGG - Intergenic
971178285 4:24302782-24302804 CTGGGAAACCAAGGGGTCCAAGG + Intergenic
971187493 4:24394302-24394324 CTGGGAAACCATGAGATCCAAGG + Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
972887166 4:43506992-43507014 CTGGGAAAATAGCAGAAACACGG + Intergenic
973918689 4:55662724-55662746 CTGGGTGAAGAGCAGGACCAGGG - Intergenic
973976018 4:56263294-56263316 GTTACAAAACAGCAGGTCCAAGG + Intronic
974525260 4:63042933-63042955 CTGTGAAAGCAGCAGGTCAGGGG - Intergenic
974599380 4:64057106-64057128 CTGTGAAACCATCTGGTCCAGGG + Intergenic
974925305 4:68291450-68291472 CAGGCAAAACAGCATGTGCAGGG + Intergenic
975523990 4:75329433-75329455 CAGAGAAAATAGCATGTCCAAGG - Intergenic
977297632 4:95228578-95228600 CTGGTGAAACAGCAGAGCCAGGG + Intronic
977570654 4:98626171-98626193 CTGGGAAACCAGCATGTACCTGG - Intronic
980985532 4:139691145-139691167 CTGGAAAAACAGGCTGTCCATGG - Intronic
981309645 4:143284354-143284376 CTGGGAACACAGCAACTCCCAGG + Intergenic
982243815 4:153328649-153328671 CTGGGGAAACAGCAGGATCCAGG + Exonic
982605930 4:157515761-157515783 CTGTGGAAACCGTAGGTCCAGGG + Intergenic
985367760 4:189250921-189250943 CTGTGAATACATCAGGTCCCAGG - Intergenic
986051895 5:4097967-4097989 CTGGGAAATCAGCAGGCACCAGG - Intergenic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
986630857 5:9771622-9771644 CAGTGAAACCATCAGGTCCAGGG + Intergenic
986730679 5:10632658-10632680 CTGGGAGAGCCTCAGGTCCAGGG + Intronic
987171732 5:15266541-15266563 CGGGGAAAACACCAAGTCCCTGG - Intergenic
987669978 5:20994149-20994171 CTGTGAATACATCTGGTCCAGGG - Intergenic
988348901 5:30075168-30075190 CTGGGAATTCATCTGGTCCAGGG - Intergenic
988540298 5:32102366-32102388 CTGGCAAAAGAGCAGGTCCCAGG - Intronic
990638064 5:57751100-57751122 CTAGGAGAACGGCAGGTCCCTGG - Intergenic
993539949 5:89136852-89136874 TAGAGAAAACAGCAAGTCCATGG - Intergenic
993661160 5:90636587-90636609 CAGGGAAGAATGCAGGTCCAAGG - Intronic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
995140106 5:108726704-108726726 CTGGGAGAACAGCAGATGAAAGG + Intergenic
995608839 5:113888154-113888176 ATGGGAAGAGATCAGGTCCAAGG + Intergenic
995933239 5:117477261-117477283 ATGGGAAAATAGCAAGTCAATGG - Intergenic
997100307 5:130960993-130961015 CTGTGAATACATCAGGTCCTGGG + Intergenic
998427240 5:142039319-142039341 CTGGGGAAACAGCAGTGCCAAGG - Intergenic
998498330 5:142610495-142610517 CTGGAAGAAGATCAGGTCCAGGG - Intronic
998721483 5:144956203-144956225 CTGGGAAAACTGCATATCCAAGG - Intergenic
999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG + Intronic
999741985 5:154562672-154562694 CTGGGAAAACAACAGCTGGAAGG - Intergenic
1000197193 5:158971286-158971308 CTCGGAAAATAGCCTGTCCAGGG + Intronic
1002296418 5:178233513-178233535 CTGGGACTGCAGCAGGTGCAGGG + Intergenic
1002603155 5:180366431-180366453 CTGGAAAAGCAGCAGCCCCAGGG + Intergenic
1003336089 6:5173985-5174007 CTGGGGTAAATGCAGGTCCAAGG + Intronic
1004022592 6:11788661-11788683 ATGGGTAAAAAGGAGGTCCAAGG - Intronic
1004128117 6:12893570-12893592 CTAGGGGTACAGCAGGTCCAAGG - Intronic
1005614901 6:27563297-27563319 CTGGAAATACAGCAGGTCTGTGG - Intergenic
1005619974 6:27611015-27611037 CTAGGAAAACATCAGACCCAAGG + Intergenic
1007190605 6:40013942-40013964 CAGGGAAGCCAGCAGGTCCTGGG + Intergenic
1007201217 6:40110932-40110954 CTGGTAGAAAAGCAGGTCTAGGG - Intergenic
1010040443 6:71376560-71376582 CTGATAAAATAGCAAGTCCAAGG + Intergenic
1012104418 6:95136749-95136771 CTGTGATAACAGAATGTCCAAGG - Intergenic
1012620256 6:101335672-101335694 CTGGGAAAACTGGATATCCATGG - Intergenic
1013087642 6:106870044-106870066 CTTGGAAATGAGCAGGTCTAGGG + Intergenic
1013482055 6:110561407-110561429 CTGGGAACACAGCATGAACAAGG + Intergenic
1014221976 6:118806926-118806948 CTGGGAAAGGAGCAAGTTCAGGG + Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1015374298 6:132492173-132492195 ATGGGGAAATAGCATGTCCATGG - Intronic
1018096784 6:160394522-160394544 CAGGGAAAACTGCAGGCCCAAGG - Intronic
1018554038 6:165032647-165032669 CTGGGGAAACATCAGGGGCAAGG - Intergenic
1020073307 7:5241470-5241492 CGGAGATAACAGCAGGTACAGGG + Intergenic
1021876396 7:25053685-25053707 CTGGGGAAATAGCAGATCAAAGG + Intergenic
1023307727 7:38848930-38848952 ATGGGAAATCAGTAGGTTCAAGG + Intronic
1023468482 7:40486121-40486143 CTGTGAAACCATCAGGTCCTGGG + Intronic
1024521831 7:50311905-50311927 ATGGGAACACAGCAGTTCCTGGG + Intronic
1025280991 7:57626390-57626412 CTAGGTAGACAGCAGGTTCAAGG + Intergenic
1025303738 7:57839117-57839139 CTAGGTAGACAGCAGGTTCAAGG - Intergenic
1025634685 7:63312376-63312398 CTGTGAAAACATCTGGTCCTGGG - Intergenic
1025648011 7:63435794-63435816 CTGTGAAAACATCTGGTCCTGGG + Intergenic
1027266544 7:76497977-76497999 TTAGGACCACAGCAGGTCCAGGG + Intronic
1027317925 7:76996095-76996117 TTAGGACCACAGCAGGTCCAGGG + Intergenic
1028256934 7:88610616-88610638 CCAGGAAACCAGCAGGTTCAAGG + Intergenic
1028767315 7:94574339-94574361 CTGTGAATCCATCAGGTCCAGGG + Intergenic
1029049592 7:97670564-97670586 CAGAGAAGACAGCAGGTGCAAGG - Intergenic
1029141918 7:98417397-98417419 GTGGGAAAACAGTAGGTCTGGGG + Intergenic
1030109399 7:106013633-106013655 CTGGGAAAGCAGCAGCCTCAGGG + Intronic
1030343378 7:108406011-108406033 CTGGGAACACAGCAGTCCCTTGG - Intronic
1032323618 7:130906125-130906147 CTGGGGAAAGAGCAGGCCCTAGG - Intergenic
1034874205 7:154710644-154710666 CAGAGAACACAGCAGGTCCTTGG - Intronic
1035132752 7:156670647-156670669 CTGGGAAATCTGCAGGTCCCAGG - Intronic
1036717465 8:11139564-11139586 CTCGGAAAACAGATGCTCCAGGG + Intronic
1036766048 8:11549932-11549954 CTAGGAAAACAGTGAGTCCAGGG + Intronic
1037123955 8:15322077-15322099 CTGTGAAGCCATCAGGTCCAGGG - Intergenic
1037432934 8:18832774-18832796 CAGGCAAAAGAGCAGGTGCAGGG + Intronic
1037521187 8:19681914-19681936 CAGGTAAAGCAGCAGGCCCAGGG - Intronic
1037538534 8:19850395-19850417 AGGGGAAAACAGCAGGGCCGTGG - Intronic
1037862541 8:22416068-22416090 CTGGGAAGCCTGCAGGTCCTAGG - Exonic
1040000233 8:42569561-42569583 CTCAGAAAGCAGCAGGTCTATGG + Intergenic
1041007679 8:53511045-53511067 TAGGGGAAGCAGCAGGTCCATGG + Intergenic
1041487435 8:58394527-58394549 CTGAGAAAAGACTAGGTCCAAGG - Intergenic
1041591489 8:59590544-59590566 TTGGGAAGACAGCAGATCCTGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043514710 8:80985295-80985317 CTGGGAATCCAGCAGATCCGAGG + Exonic
1043559397 8:81472996-81473018 CTGTGAAGACAGGAGGTCAAGGG + Intergenic
1043700366 8:83279813-83279835 CAGTAAAAACATCAGGTCCAGGG + Intergenic
1043737427 8:83766184-83766206 CTGTGAAATCATCAGGTCCTGGG - Intergenic
1044011050 8:86994627-86994649 CTGGGAAAAGAGTGGGTCAAGGG - Intronic
1044843323 8:96356596-96356618 CTGAGAAACCTGCAGATCCAAGG + Intergenic
1046271957 8:111908008-111908030 CTGGGTAAATAAAAGGTCCAAGG - Intergenic
1049027833 8:140008612-140008634 CTGGACAAACAGCAGGCACAGGG + Intronic
1049612884 8:143563584-143563606 GTGGGAATTAAGCAGGTCCAGGG + Intergenic
1050036819 9:1445098-1445120 CTAGGAAAACAGGAGGTTCTTGG - Intergenic
1050847491 9:10240387-10240409 CTAGAGAAACAGAAGGTCCAGGG + Intronic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051681048 9:19608583-19608605 CTGAGAAAACTGCGGTTCCAAGG - Intronic
1052433085 9:28392524-28392546 ATGGGAGAGCAGCAGGTGCACGG + Intronic
1054818405 9:69497661-69497683 CTGAAGAAAGAGCAGGTCCATGG - Intronic
1057606393 9:96500821-96500843 CTGGGAAAAGAGAAGGCCCCAGG + Exonic
1058916483 9:109571511-109571533 CTGTGAAACCATCTGGTCCAGGG - Intergenic
1061548634 9:131319597-131319619 CTGGCAAAACAGCATGTCCTGGG - Intergenic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1062026771 9:134344208-134344230 CTGGGAAAAAGGGAGGCCCAGGG - Intronic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1062245861 9:135565714-135565736 CTGGGGACACAGCAGCCCCAGGG - Intronic
1062250684 9:135592184-135592206 CTGGGGACACAGCAGTCCCAGGG - Intergenic
1062449306 9:136608902-136608924 CTGGGAAAACAGGAGCTGCGGGG + Intergenic
1186780115 X:12903764-12903786 CTGGGAAAACACCAAGTGCCTGG - Intergenic
1187654973 X:21461750-21461772 CTGGGAAAACTGGATATCCATGG - Intronic
1187979397 X:24739064-24739086 ATGGGAAAACAGCAGGGTGAGGG - Intronic
1188530722 X:31138014-31138036 CTGGGAAAACAGTACTTCCCTGG + Intronic
1190766908 X:53482720-53482742 CTAGGATATCAGCAGGACCATGG - Intergenic
1192508314 X:71704807-71704829 CAGGGAAGACAGCATGTGCAGGG - Intergenic
1192518382 X:71776746-71776768 CAGGGAAGACAGCATGTGCAGGG + Intergenic
1192527037 X:71855926-71855948 CAGGGAAGACAGCATGTGCACGG - Intergenic
1192551613 X:72059126-72059148 CTGGAAAACCAGCAGGTGCAGGG - Intergenic
1193788256 X:85787092-85787114 CTGGGAATCCATCTGGTCCAGGG - Intergenic
1194245265 X:91503311-91503333 CTGTGAATACATCTGGTCCAGGG - Intergenic
1195094567 X:101491955-101491977 CTGGGAAAATAGCGTGTCCTGGG + Exonic
1195303224 X:103552924-103552946 CTGGGAAAACTGCAAGTCACAGG - Intergenic
1197382368 X:125760697-125760719 CGGTGAAAACATCAGGTCCTGGG + Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200072153 X:153534523-153534545 CAGGGAGAACAGCAGGCCCGAGG - Intronic
1200150915 X:153951055-153951077 CCAGGAACACTGCAGGTCCATGG + Intronic
1200564237 Y:4744622-4744644 CTGTGAATACATCTGGTCCAGGG - Intergenic