ID: 1108534424

View in Genome Browser
Species Human (GRCh38)
Location 13:51359089-51359111
Sequence TTCTCAAGATTGTTTATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108534424_1108534428 -4 Left 1108534424 13:51359089-51359111 CCACCTATAAACAATCTTGAGAA 0: 1
1: 0
2: 1
3: 8
4: 167
Right 1108534428 13:51359108-51359130 AGAACAACTTTTGGGAAAATAGG 0: 1
1: 0
2: 1
3: 28
4: 363
1108534424_1108534429 -3 Left 1108534424 13:51359089-51359111 CCACCTATAAACAATCTTGAGAA 0: 1
1: 0
2: 1
3: 8
4: 167
Right 1108534429 13:51359109-51359131 GAACAACTTTTGGGAAAATAGGG 0: 1
1: 0
2: 0
3: 29
4: 322
1108534424_1108534430 14 Left 1108534424 13:51359089-51359111 CCACCTATAAACAATCTTGAGAA 0: 1
1: 0
2: 1
3: 8
4: 167
Right 1108534430 13:51359126-51359148 ATAGGGCGTATGTCCCTCAATGG 0: 1
1: 0
2: 0
3: 4
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108534424 Original CRISPR TTCTCAAGATTGTTTATAGG TGG (reversed) Intronic
905719286 1:40182829-40182851 TTTTCTATATTGGTTATAGGTGG - Intronic
907080722 1:51619041-51619063 TGTTCAAGATTGTCTTTAGGTGG + Intronic
907763969 1:57389823-57389845 TTATCAAGCTTGTTTCTATGGGG - Intronic
910994739 1:93092238-93092260 TTCTAAAGAATGTTAATAGTTGG - Intronic
915000410 1:152584518-152584540 TTTTCAAGATGGTATATTGGAGG + Intronic
919033293 1:192273422-192273444 TTCTTAAGATTTTTTAATGGAGG + Intergenic
924031566 1:239890485-239890507 TTCTCAATATTGTATGTATGAGG - Intronic
924849617 1:247812539-247812561 TTATGAAGATTCTATATAGGAGG - Intergenic
924917882 1:248592667-248592689 ATCTCAAGTGTGATTATAGGAGG + Intergenic
1063335020 10:5203750-5203772 TTCCCAAGATTGTGGATTGGAGG - Intronic
1063526014 10:6786503-6786525 TTCTGATGATTGTTTTTAGTGGG - Intergenic
1070542145 10:77423717-77423739 ATCTCCAGATGTTTTATAGGGGG + Intronic
1072225601 10:93365750-93365772 TTCTCAAAGATGTTTATATGGGG + Intronic
1072340380 10:94441975-94441997 TTCTGAAGATTCTCTCTAGGAGG - Exonic
1073714377 10:106085982-106086004 TTTTCATGATTCTTTATAAGAGG - Intergenic
1079430370 11:20383923-20383945 TTATAAGGATTGTTTATAAGAGG - Intergenic
1080118519 11:28647679-28647701 CTCTCCAGATTGTTTTAAGGTGG - Intergenic
1085431606 11:76455458-76455480 TTCCAAAGATTATCTATAGGAGG + Intronic
1087334694 11:96828961-96828983 TTCCCAAGATTATTTATAATAGG - Intergenic
1087557444 11:99739279-99739301 TTATCAAGATGGTTCATATGAGG + Intronic
1087808414 11:102581749-102581771 TTCTCAAGATTGTTGAAAGGTGG + Intronic
1090180248 11:124692001-124692023 TTTTCAAGATTGTTAATGGATGG + Intronic
1090520137 11:127470327-127470349 TTCTCTTGATTTTTTATAAGCGG + Intergenic
1090579702 11:128146396-128146418 TTCTCAAGATTGTTGAATTGTGG + Intergenic
1092324654 12:7517225-7517247 TTCTCATCCTGGTTTATAGGTGG + Intergenic
1092558574 12:9584205-9584227 TTCAGGAGATTGTTTGTAGGGGG + Intergenic
1093572707 12:20685919-20685941 TTCTCAAGAATGTTTAAATTTGG + Intergenic
1095467906 12:42506933-42506955 TTCTCTAAAATGTTTGTAGGAGG + Intronic
1097369195 12:58755836-58755858 TTGCCAAGAATGTTTAGAGGTGG - Intronic
1098413790 12:70210141-70210163 TTCTCAACATTAGCTATAGGAGG - Intergenic
1099488527 12:83257425-83257447 ATCTAGAGATTGTTTATGGGGGG + Intergenic
1099549801 12:84029234-84029256 TTCTTAAGCTTACTTATAGGGGG - Intergenic
1099870715 12:88345998-88346020 TTGACAAGATTGTTTACAGATGG + Intergenic
1100675386 12:96860840-96860862 CTCTCAAGATTGAATATAGACGG - Exonic
1103943557 12:124513797-124513819 TTCTCATGACTGTATCTAGGAGG + Intronic
1106631861 13:31482263-31482285 TTATCTTGATTGTTTATGGGGGG + Intergenic
1106928348 13:34636425-34636447 TTCTCAAGATACTTTGGAGGTGG - Intergenic
1108534424 13:51359089-51359111 TTCTCAAGATTGTTTATAGGTGG - Intronic
1110399045 13:75068259-75068281 TTCTCAGGATTGTTGACAGAGGG + Intergenic
1116417015 14:44690329-44690351 TTTTCAAGATTGTTTATTTTGGG - Intergenic
1116557484 14:46330407-46330429 TTCTCAAGATTGACCAGAGGAGG - Intergenic
1118798564 14:69167915-69167937 TTGTCAAAACTGTGTATAGGAGG + Intergenic
1120464255 14:84835980-84836002 TTCTCATGAATGTTCATGGGTGG + Intergenic
1125695706 15:41635523-41635545 TTTTTAAAATTTTTTATAGGAGG - Intronic
1126853487 15:52814166-52814188 TATTCAATATTGTTTTTAGGAGG - Intergenic
1127048766 15:55057450-55057472 ATCTCAAGAATCATTATAGGAGG + Intergenic
1128722775 15:69964066-69964088 TTCTTAAGATAATTTCTAGGAGG - Intergenic
1131639168 15:94271219-94271241 TTATCAAAATTGTTTAGATGGGG - Intronic
1134881028 16:17745556-17745578 TTCTCAAGCTTGGTTGTATGTGG + Intergenic
1139118642 16:63988021-63988043 TTCTCAAGGTTGTTCTTAAGAGG + Intergenic
1140649186 16:77067888-77067910 TTCTGAACAGTGTATATAGGTGG - Intergenic
1140713975 16:77705306-77705328 TTCTCGAGATTTTTTCCAGGAGG - Intergenic
1148513255 17:48191452-48191474 CTCTCAAGATACTCTATAGGTGG - Intronic
1149166027 17:53753434-53753456 TTCTCCTGCCTGTTTATAGGAGG + Intergenic
1150269772 17:63856324-63856346 TTCTCAAGAAAGATGATAGGTGG + Intergenic
1153475209 18:5491540-5491562 TTCTTTAGATTGTTGGTAGGTGG - Intronic
1156770666 18:40718815-40718837 TTCTCAGGCCTGTTTCTAGGAGG + Intergenic
1157236068 18:45966635-45966657 TTGTCTTGATTGTTTATAAGGGG - Intronic
1158540840 18:58352849-58352871 TTCACAACATTCTTTTTAGGGGG - Intronic
1162239073 19:9333696-9333718 TTCTCAGGCTTGTTTCTGGGTGG - Intronic
1163197677 19:15735072-15735094 TTCTGAAACCTGTTTATAGGGGG - Intergenic
1163223988 19:15942229-15942251 TTCTGAAACCTGTTTATAGGGGG - Intergenic
1163937560 19:20462846-20462868 TTCTCAAACCTGTTTTTAGGAGG + Intergenic
1164895534 19:31873932-31873954 TTCCAAAGATTATTTCTAGGGGG + Intergenic
1165223476 19:34337263-34337285 TTCTCAAGTTGGTTTATGAGGGG - Intronic
1165985597 19:39766168-39766190 TTCTCAAGATAGCGTATACGTGG - Intergenic
1168128536 19:54301297-54301319 TGTTCAAGATTGTTATTAGGTGG + Intergenic
925212436 2:2061476-2061498 TTCTCAAGGTTGTTGCAAGGGGG - Intronic
926862803 2:17326648-17326670 TCCTCAAGATTGTTTAGAAACGG + Intergenic
929196902 2:39194125-39194147 CTCACAAGATTGTTTTTAGTGGG - Intronic
930259679 2:49130711-49130733 TCCTAAAGATTGTTTAAAGGAGG - Intronic
930511776 2:52354804-52354826 TCCTCAAGATTGTATACAGCAGG - Intergenic
931270285 2:60695525-60695547 TTCTCAAAAGTGTTGATAGCTGG - Intergenic
937051091 2:118890945-118890967 GTTTCAATATTGTTTATAAGAGG + Intergenic
937716756 2:125040401-125040423 TCCTCAAGATGGCATATAGGAGG - Intergenic
940897760 2:159096998-159097020 TTCCCAAGCTTGTTTAGGGGTGG + Intronic
941499668 2:166256359-166256381 TTCTCAAGATTCTTTTTAAAAGG + Intronic
942489342 2:176474233-176474255 TTATTAACATTGTTTATAGTGGG - Intergenic
943206139 2:184898636-184898658 TTCTCTAGATTGAATATAAGTGG + Intronic
943783295 2:191848118-191848140 GTCTCAAAATTGTTCATAGAAGG - Intergenic
945589221 2:211708802-211708824 TTCTCAAGTTTTTTTATTGGAGG + Intronic
947253723 2:228137967-228137989 TTGTCAAGATTGGTTAGAAGAGG - Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1172748095 20:37228849-37228871 CTCCCAAGCTTATTTATAGGAGG - Intronic
1173847623 20:46198027-46198049 TTGTCATGATTGCTTATTGGTGG + Intronic
1178154989 21:29842121-29842143 TTATCAAGATTATTTATAATTGG - Intronic
1178455940 21:32751249-32751271 TCCTCAAGATTGTTGAAAGATGG - Intronic
949196219 3:1312100-1312122 TTCTCAAGAAAGATTATAGAGGG + Intronic
949648802 3:6130818-6130840 TTGGCAAGATTGATTATAGGTGG - Intergenic
952707141 3:36390979-36391001 ATCTCCAGATGGGTTATAGGAGG + Intronic
953109370 3:39918791-39918813 GTGTCAAGATAGGTTATAGGAGG + Intronic
956049468 3:65232151-65232173 TTCTCAAAATGATTTATAGCAGG + Intergenic
959504250 3:107140507-107140529 TTTCCAAGATTGTATAGAGGAGG - Intergenic
959677033 3:109047976-109047998 TTGTCAAGATGTTTCATAGGTGG - Intronic
962896299 3:139718052-139718074 TTCTCAAGACTGTTTTTATCTGG - Intergenic
965377046 3:167937811-167937833 TTCTCAAGATTGTGTGTGGGAGG + Intergenic
965632059 3:170743089-170743111 TTCTCCAGATTTTTTTCAGGAGG + Intronic
965810324 3:172585069-172585091 TTCTGATGATTGTTTATATGAGG + Intergenic
966236784 3:177710241-177710263 TTCTAATGATTTTTAATAGGTGG + Intergenic
966699846 3:182836323-182836345 TCCCCAAAATTCTTTATAGGTGG + Exonic
969840460 4:9877916-9877938 TTCTCAACACTGTTTGCAGGAGG + Intronic
970651173 4:18179617-18179639 AATTCAAGATTGTTTTTAGGTGG + Intergenic
970939866 4:21619268-21619290 TTCTCAAGATTTTTAAAATGTGG - Intronic
972880153 4:43412923-43412945 TTCTCAGCATTGTTTATTGAAGG - Intergenic
975701494 4:77071085-77071107 GTTTCAAGATTATTTTTAGGGGG + Intronic
977119628 4:93082222-93082244 TTGTCAAGTTTGTTGAAAGGAGG - Intronic
979829589 4:125282786-125282808 TTCTCAAAATTGAATATAAGGGG - Intergenic
980435772 4:132771551-132771573 TTCTCAATGTTGTTTAGAGATGG - Intergenic
983661753 4:170136112-170136134 TTTTCAAGATGGTGGATAGGAGG - Intergenic
984310737 4:178054410-178054432 TCTTGAAGATTGGTTATAGGCGG + Intergenic
990670318 5:58121982-58122004 TTTTCAAGAGTGTTTATCTGAGG - Intergenic
993650981 5:90521855-90521877 TTCTTAAGATTATTTCTAAGTGG + Intronic
993925933 5:93866327-93866349 TTCTTAAAATTGATTATGGGAGG + Intronic
994689851 5:103004183-103004205 TTCTCAAGATTGTGTGTCAGGGG + Intronic
994694898 5:103061899-103061921 TCTTCAAGAATGTTTATAGCAGG - Intergenic
999411362 5:151352803-151352825 ATCTCAAGTATCTTTATAGGAGG - Intergenic
1000106480 5:158064646-158064668 TTCTCAAGTTTTTTTTAAGGTGG - Intergenic
1000237421 5:159375656-159375678 TTTTCAAGATAGTGGATAGGAGG + Intergenic
1004472390 6:15940957-15940979 TACTCATGAGTCTTTATAGGAGG - Intergenic
1004912064 6:20295715-20295737 TTTTGAATATTGTTTATAGATGG - Intergenic
1005677590 6:28171208-28171230 GTCTCAGAATTGTTTAGAGGAGG - Intergenic
1006651255 6:35553689-35553711 TTCTCATGATTTTTGAGAGGAGG + Intergenic
1008280018 6:49585777-49585799 TTCTCAAGAATATTTCTTGGGGG + Intergenic
1009321347 6:62293388-62293410 TTCTCCAGATTGTTCATTGCAGG - Intergenic
1010079366 6:71841054-71841076 ATCACATGAATGTTTATAGGAGG - Intergenic
1012950713 6:105515046-105515068 TTCTCAATATTATTTATAATGGG - Intergenic
1013980669 6:116124338-116124360 TTCTGTAGATATTTTATAGGCGG + Intronic
1014245499 6:119063999-119064021 GTCTTGAGATTGTTTATGGGGGG - Intronic
1014621326 6:123670553-123670575 TTCTCAAGATTGTTGGCAAGAGG + Intergenic
1014796946 6:125736193-125736215 TTATCAAGACTGTTTCTATGAGG + Intergenic
1014824955 6:126039245-126039267 TTCTCAATATGGTTTATTAGTGG - Exonic
1015075804 6:129155822-129155844 TTTTCAAGATTGTCTATAGTAGG + Intronic
1016456589 6:144237150-144237172 TTATAAAGTTTGTTTCTAGGTGG + Intergenic
1018467162 6:164058520-164058542 ATCTCAAGATTGTTTAGTTGGGG + Intergenic
1021134625 7:16950193-16950215 TTCGCAAGATTGTTTAGCTGAGG + Intergenic
1021168736 7:17372397-17372419 ATCACAAGAGTCTTTATAGGAGG - Intergenic
1021945445 7:25721582-25721604 TTCACAAGAATGTCAATAGGTGG + Intergenic
1024550421 7:50558475-50558497 TTCTCAGGATTTTTTCTTGGAGG - Intronic
1024785660 7:52904162-52904184 TTCTGAGGATTCTTTATTGGTGG + Intergenic
1025218119 7:57077377-57077399 TTCTCAATCTAGTTTATGGGTGG - Intergenic
1025653226 7:63493076-63493098 TTCTCAATCTAGTTTATGGGTGG + Intergenic
1028637081 7:93001252-93001274 TTATCAAGATTGGTAATAGGAGG - Intergenic
1029336379 7:99903426-99903448 TTCTCCTGATTGTTTCTGGGAGG - Intronic
1030892888 7:115022669-115022691 TTATCAAGATTTTTGATAGGTGG - Intergenic
1031086640 7:117308680-117308702 TGCTCAAGATTGTTGAAGGGAGG + Intronic
1031687670 7:124751410-124751432 TTTTCCAAATTATTTATAGGAGG + Intronic
1032567312 7:132959871-132959893 TTCTCAAGATTTATGAAAGGGGG - Intronic
1032921838 7:136557857-136557879 TTTTCTAAATTGTTTAGAGGAGG + Intergenic
1032981494 7:137289184-137289206 TTCTCAAGATTGATAAAAGAAGG + Intronic
1033392984 7:140945937-140945959 TAATCAAGATTTTTTAAAGGTGG - Intergenic
1035095655 7:156352682-156352704 TTTGAAAGATTGTTTTTAGGTGG - Intergenic
1035754219 8:2019183-2019205 TTGTCAAGATTTCTTATAAGAGG + Intergenic
1038219070 8:25590378-25590400 TTCTCAGGAGTTTTTCTAGGAGG + Intergenic
1039201628 8:35100806-35100828 TTCTAAAGAATGTTTACAAGTGG - Intergenic
1039909349 8:41811865-41811887 TTCTCAAGATCTTTCAGAGGTGG + Intronic
1043394041 8:79819098-79819120 TTCTCAAGTCTGTTTGCAGGTGG + Intergenic
1043554338 8:81413332-81413354 TTTTCCAGATTGTTCATAGTTGG - Intergenic
1048154025 8:131924866-131924888 TTATTTATATTGTTTATAGGTGG + Intronic
1050230235 9:3516442-3516464 TTCTTAATATTGTTTATACTTGG - Intronic
1051222771 9:14867787-14867809 TTCTCAAGATTGTTTGCACTGGG + Intronic
1051393469 9:16592118-16592140 TTCTCAAGGTTTTTTTTGGGGGG - Intronic
1055951840 9:81736519-81736541 TTCTCCTGATTGTTTGTATGTGG + Intergenic
1056919669 9:90774901-90774923 TGCTCAAGCTTGTTTACTGGAGG - Intergenic
1059003282 9:110373556-110373578 GTATAAACATTGTTTATAGGAGG + Intronic
1060954703 9:127630121-127630143 TGCTCAGGATTGTTTTAAGGAGG + Intronic
1061198251 9:129120505-129120527 TTGTCAAGATTCTTCAGAGGAGG + Exonic
1062131287 9:134894861-134894883 TTCTCATTATTGTTTATAAAAGG + Intergenic
1187067109 X:15851593-15851615 TTCTCAAGATTGTTCTAAGTAGG - Intronic
1189396110 X:40624227-40624249 AACTCAAGATAGTTTATATGGGG + Intergenic
1189452834 X:41155237-41155259 ATCTAAATAATGTTTATAGGAGG - Intronic
1189543806 X:42020926-42020948 TACTCAAGAATGTTTAGAGCTGG - Intergenic
1189543915 X:42021900-42021922 TACTCAAGAATGTTTAGAGCTGG - Intergenic
1192892897 X:75408796-75408818 TTCTTAAGATTGTTTGTTGTTGG - Intronic
1193436125 X:81477037-81477059 TCTTCAAGATGGTTTATTGGGGG + Intergenic
1195470441 X:105223553-105223575 TTCTTAAAAGTGTTTATAAGCGG - Intronic
1195811562 X:108838117-108838139 TTCTTAAGTTTGCTTATAGTTGG + Intergenic
1198066285 X:133099635-133099657 GTTTCAAGATTGTGTAGAGGTGG - Intergenic