ID: 1108536934

View in Genome Browser
Species Human (GRCh38)
Location 13:51392453-51392475
Sequence CTAGGTTTAGAGAGGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108536934 Original CRISPR CTAGGTTTAGAGAGGTAGGC AGG (reversed) Intronic
902813236 1:18901508-18901530 CTAGGTTTGGAGAGGTAGGTGGG - Intronic
903325317 1:22565757-22565779 CAAGGTCTAGAGAGAGAGGCAGG + Intronic
903839942 1:26231780-26231802 CTAAGTTTGGGGAGGAAGGCAGG + Intergenic
904177979 1:28644779-28644801 ATGAGTTTGGAGAGGTAGGCAGG + Intergenic
904762533 1:32816341-32816363 TTTGTTTAAGAGAGGTAGGCAGG - Intronic
904916624 1:33975113-33975135 CTAGGTGTAGGAAGGAAGGCTGG + Intronic
905780120 1:40701395-40701417 GTAGAGTTAGAAAGGTAGGCCGG - Intronic
906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG + Intronic
907320253 1:53597528-53597550 TTAGTATTAGAGAGTTAGGCTGG + Intronic
907858278 1:58325396-58325418 CCTGGTTTAGAGAGGTAAGGAGG - Intronic
911344909 1:96684724-96684746 CTAGATATACAAAGGTAGGCTGG + Intergenic
915030959 1:152880203-152880225 CTAGGTTTTGAGAGGGACGAGGG - Intronic
917465344 1:175271153-175271175 CTAGGATTAGACAGGTAGGGAGG - Intergenic
920073468 1:203320328-203320350 TTAGGTTTAGAGTGGGAGGATGG - Intergenic
923655219 1:235909975-235909997 GTAAGGTTAAAGAGGTAGGCAGG + Intergenic
1063376025 10:5554860-5554882 GTAGCTTTAGAGATGGAGGCAGG - Intergenic
1063394979 10:5678189-5678211 CTAGGGTAATAGAGGCAGGCGGG - Intergenic
1064226814 10:13493528-13493550 CGAGGTCTAGAGAAGTAGCCTGG - Intronic
1064374944 10:14786896-14786918 CTATGTACAGAGAGGTGGGCAGG + Intergenic
1067973052 10:50992886-50992908 AAAGATTAAGAGAGGTAGGCGGG - Intronic
1070400395 10:76048335-76048357 CTAGAATGAGAGAGGTAGGGAGG + Intronic
1075301800 10:121331366-121331388 GGAGGCTTGGAGAGGTAGGCAGG - Intergenic
1076431948 10:130410192-130410214 CTTGGATTAGAGAAGAAGGCAGG + Intergenic
1077463437 11:2722249-2722271 ACAGGTGGAGAGAGGTAGGCTGG + Intronic
1077592598 11:3504264-3504286 CTAGGTTTAGTGGGGGTGGCTGG + Intergenic
1078430063 11:11281626-11281648 CAAGGTCTAGAGAGGAAGGCAGG + Intronic
1080171684 11:29311134-29311156 ATGGGTTCAGAGAGGTAGACAGG + Intergenic
1083071536 11:59988958-59988980 GTAGGTTGAGAGAGGGAGGAGGG - Intergenic
1084425475 11:69081703-69081725 CTGGGTTGGGAGAGGAAGGCGGG + Intronic
1084865044 11:72048845-72048867 CAAGGGTTAGAGGGGGAGGCTGG + Intronic
1087666245 11:101052516-101052538 ATGTGTTTAGAGATGTAGGCTGG + Intronic
1089226075 11:116923421-116923443 CTAATTTTGGAGAGGTAGGTTGG - Intronic
1089898652 11:121958402-121958424 CAAGGTCTAGAGATGTAGGGGGG + Intergenic
1090585530 11:128207960-128207982 ATAGGTCTAGAGAGGCAGGTTGG - Intergenic
1091501125 12:1019056-1019078 GTAGTTTCAGAGAGATAGGCAGG + Intronic
1096527801 12:52222630-52222652 CTAGGTTTAGAGTTGTTGACTGG - Intergenic
1097071662 12:56359871-56359893 TTAGGGTTAGGGAGATAGGCTGG + Intronic
1097951155 12:65429464-65429486 ATGTGTTTGGAGAGGTAGGCAGG + Intronic
1097954746 12:65472126-65472148 TTAAGTTTAGTGAGGAAGGCAGG + Intronic
1100878647 12:98992113-98992135 ATAAGTTTAGAGAGGTGGGCAGG - Intronic
1103908355 12:124338954-124338976 GTAGGGTTAGGGAGGTAGGTGGG - Intronic
1105746994 13:23386709-23386731 CTAAGCTTAGTGAGGAAGGCAGG - Intronic
1107270417 13:38609624-38609646 TTAGGTTGTGAGAGGTAGGAGGG - Intergenic
1108536934 13:51392453-51392475 CTAGGTTTAGAGAGGTAGGCAGG - Intronic
1112057695 13:95705945-95705967 AAAGGTTTAGAGAGATAGGAAGG - Intronic
1112759453 13:102677490-102677512 ATAAGTCTGGAGAGGTAGGCAGG - Intronic
1114547851 14:23515362-23515384 CTAGGCCTAGAGAGGTAGACAGG + Intergenic
1114847237 14:26337858-26337880 CCAGGTTTGGAGATGGAGGCAGG + Intergenic
1115838319 14:37435175-37435197 ATAAGGTTAGAGAGGTAGCCAGG - Intronic
1117786076 14:59286919-59286941 CTGGTTTTAGAGAGTTAGGGAGG - Intronic
1118007103 14:61573268-61573290 CAAGATATAAAGAGGTAGGCAGG + Intronic
1118367820 14:65110643-65110665 CTGAGGTCAGAGAGGTAGGCAGG - Intergenic
1118824383 14:69367155-69367177 CTGAGTTTTGACAGGTAGGCAGG + Intergenic
1119593078 14:75908507-75908529 GTGGGTTTAGAGAGGCAGTCAGG + Intronic
1119606507 14:76022657-76022679 CTAGATCTAGAGAGGTTGGGGGG - Intronic
1119673173 14:76535054-76535076 CTAGGTACAGAGAGGTATGAAGG + Intergenic
1127543480 15:59966741-59966763 GTATGTTTAGAAAGGTACGCAGG + Intergenic
1127905696 15:63374180-63374202 CTAAGGTCAGAGAGATAGGCTGG - Intronic
1127908851 15:63398980-63399002 CTAGGTTGACAGAGATAGCCAGG + Intergenic
1127948606 15:63781727-63781749 TTAAGTTTAGTGAGGAAGGCAGG + Intronic
1128257047 15:66204558-66204580 GTAGGTTCAGGCAGGTAGGCGGG - Intronic
1128440709 15:67705939-67705961 ATAAATTTAGAGAGGTAGCCAGG + Intronic
1130726611 15:86445617-86445639 GTAGGTCTAGAGTGGAAGGCAGG - Intronic
1133141574 16:3748519-3748541 CTAGGTTTCCAGAGGTGGCCTGG + Intronic
1133533398 16:6676195-6676217 CTAGGATCAGATAGGTAGGCTGG + Intronic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1136342969 16:29656923-29656945 CGTGGATAAGAGAGGTAGGCAGG + Intergenic
1138687736 16:58740462-58740484 CTGGGTTGATAGAGGTAGGAAGG - Intergenic
1146707452 17:35011649-35011671 CTAGGTTCAGGGAGGAAGACAGG + Exonic
1146804522 17:35854772-35854794 CTTGATTTAGGGAGGCAGGCTGG + Intronic
1149270838 17:54975728-54975750 ATAAGGTTAGAGAAGTAGGCAGG - Intronic
1150188057 17:63206964-63206986 ATAGGGTAAGAGAGGTAGTCAGG - Intronic
1150479798 17:65500168-65500190 GTAGTTTTAGAGTGGTAGGGTGG + Intergenic
1154359705 18:13649354-13649376 GTTGGTTCAGAGAGGAAGGCAGG - Exonic
1158899292 18:61947893-61947915 TTTGGTTTAGAGAGTCAGGCAGG - Intergenic
1160771273 19:832207-832229 CCAGGTTCAGAGAGGTTGGGTGG + Intergenic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1162893563 19:13751006-13751028 TTAGGCTTGGAGAGGCAGGCAGG + Intronic
1164148559 19:22528928-22528950 CTAGGTTTAAAGGGGTGTGCTGG - Intronic
1164731714 19:30510522-30510544 ATAGCTTTAGGGAGGAAGGCAGG + Intronic
1167204770 19:48093609-48093631 AGAGGGCTAGAGAGGTAGGCAGG - Intronic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1168522513 19:57063678-57063700 CTAGGTTTGGAGGAGTAGGTTGG - Intergenic
930655980 2:54007567-54007589 TTAGGTTTACAAAGGTTGGCCGG + Intronic
930671823 2:54159649-54159671 CTGGGGTGAGAGAGGTAGGCAGG + Intronic
937044623 2:118844650-118844672 CTAGCTACAGAGAGGAAGGCTGG + Intronic
941003199 2:160222170-160222192 ATAGATTTAGAGAGAGAGGCTGG + Intronic
943713516 2:191124664-191124686 TTAGGTTTAGGGAGGGAGGTGGG - Intronic
943853131 2:192753996-192754018 CTAGGTTAAGAAATGTTGGCCGG - Intergenic
943895902 2:193359216-193359238 CTAGGGCTATAGAGGTAGGTAGG - Intergenic
1172681959 20:36723265-36723287 CAAGTTGGAGAGAGGTAGGCAGG + Intronic
1173819896 20:46013198-46013220 CTAGGGGTACAGAGGTATGCAGG + Intronic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1181129557 22:20722683-20722705 CTAGGTTTAAAAAGGTGAGCTGG + Intronic
949502640 3:4696275-4696297 CTAGGATTAGGGGGGTTGGCAGG - Intronic
951206813 3:19934166-19934188 CTAGGTGTTAAGAGGCAGGCAGG - Exonic
951370923 3:21846715-21846737 CTAGCTTTAGAGAGAGAGGATGG + Intronic
953883251 3:46702162-46702184 CTAGGTCCAGAGGGGCAGGCAGG + Intronic
953920062 3:46945395-46945417 CTAGGTGTGGAGATGTGGGCAGG - Intronic
960107029 3:113808914-113808936 CTAGGTTTAGTGAGGGACACTGG - Intronic
960650973 3:119949561-119949583 TTATGTTCAGAGAGGCAGGCAGG + Intronic
960877759 3:122314187-122314209 CTAAGTTTATAGAGGCAGGAGGG - Intergenic
962250638 3:133834000-133834022 TGAGGTTCAGAGAGGTAGTCTGG - Intronic
963484091 3:145914196-145914218 CTAGGTTTAAAGAAATAGGAAGG - Intergenic
965740306 3:171867131-171867153 CTTTGTCTAGAGTGGTAGGCAGG - Intronic
966804002 3:183791755-183791777 CTAGTGTTAGAGTGATAGGCTGG + Intronic
969826618 4:9763014-9763036 AGTTGTTTAGAGAGGTAGGCCGG - Intergenic
971352428 4:25865260-25865282 CCAGGATTCCAGAGGTAGGCAGG + Intronic
972847541 4:43007361-43007383 GTAGGGTTAGAGAGTTAGACAGG + Intronic
975061419 4:70007023-70007045 CTAGCTTTAGAAATGTAGCCTGG + Intergenic
976247737 4:83020601-83020623 CTAGGTTCACAGATCTAGGCTGG + Intergenic
976280113 4:83318924-83318946 CTTGGTTTAGAGCATTAGGCAGG - Intronic
977128265 4:93198649-93198671 CTGGAGTTAGAGAGGTAGGATGG + Intronic
979440000 4:120740449-120740471 GTGGGTTTAGAGAGGAAGGAGGG - Intronic
979992150 4:127388021-127388043 CTAACTTTAAAGAGGTAGACAGG + Intergenic
982021732 4:151211491-151211513 TTAAGTTTAGTGAGGAAGGCAGG + Intronic
982216562 4:153087430-153087452 GGAGGTTTGGAGAGGTAGGCAGG + Intergenic
987850681 5:23349911-23349933 CTAGGTATAGAGAAGTAAACTGG - Intergenic
988641306 5:33043213-33043235 CTAGGTTGAGAGAGGTGGAAGGG + Intergenic
993518952 5:88874930-88874952 CTAGTTTTAGAAAGGTGTGCTGG + Intronic
994912845 5:105935523-105935545 ATAGCTCTAGAGAGCTAGGCAGG - Intergenic
995025253 5:107413121-107413143 TTAGGTTTGGAGAGTTGGGCAGG - Intronic
995954631 5:117761511-117761533 CTAGATTTAGAGAGAAAGACAGG - Intergenic
996449527 5:123603826-123603848 GTAAGCTCAGAGAGGTAGGCAGG + Intronic
997240593 5:132303840-132303862 CCTGTTGTAGAGAGGTAGGCAGG - Intronic
998027530 5:138831561-138831583 TTAGGTTTACATAGGTAGGAAGG - Intronic
998675287 5:144401007-144401029 CAAAGTTTGGAAAGGTAGGCAGG + Intronic
999572151 5:152931329-152931351 CTAGGGGTAGAGAAGCAGGCAGG - Intergenic
999836809 5:155382596-155382618 GGAGGCTTAGAGAGGTAGGTTGG + Intergenic
1000180733 5:158808354-158808376 CTGGGTTTTGATAGGTAGACTGG - Intronic
1003583676 6:7366362-7366384 CTAGGCTTAGAGAGGCCTGCTGG + Intronic
1006369878 6:33637436-33637458 CCAGGTTCAGAGAGCTGGGCTGG - Intronic
1008651095 6:53563663-53563685 CTAGGATTACAGAGCTAGGAGGG - Intronic
1010070146 6:71734483-71734505 CTTGGTTTAGACAGGTACCCTGG - Intergenic
1010570095 6:77464659-77464681 CTAGGGTGGGAGTGGTAGGCAGG - Intergenic
1011172903 6:84526028-84526050 ATAAGATTAGTGAGGTAGGCAGG + Intergenic
1012930671 6:105313092-105313114 CTGGTTTTAGGGAGGTAGACTGG - Intronic
1013764843 6:113562652-113562674 GAAGGTTAAGAGAGGCAGGCCGG - Intergenic
1013828580 6:114245304-114245326 GAAGGTTTAGAGAGATAGGACGG + Intronic
1014559965 6:122877862-122877884 CTAGGTTAGGAGAGGCAGGTTGG - Intergenic
1017579178 6:155842229-155842251 CTAAGTTTAGAGAGATAAACTGG + Intergenic
1018069928 6:160155407-160155429 CTAGGTTTGGAGAGATAAGTAGG - Intronic
1018632487 6:165833360-165833382 CTAGGTGTAGTGAGGTGGGAAGG + Intronic
1018916752 6:168137159-168137181 CTAGGTGTATAGAGGGGGGCTGG - Intergenic
1020327096 7:6983248-6983270 CTAGGTTTAGTGGGGATGGCTGG + Intergenic
1020580422 7:9992193-9992215 CCAGATTTAGAGAAGGAGGCAGG + Intergenic
1023065497 7:36373553-36373575 GTAGGAAAAGAGAGGTAGGCAGG + Intronic
1027770642 7:82401956-82401978 GTAATTTTAGAGAGGTAGACAGG + Intronic
1030426012 7:109379286-109379308 TTAAGTTTAGTGAGGAAGGCAGG + Intergenic
1031118764 7:117696803-117696825 CTTGGTTTGGAGAGGAAGGGAGG + Intronic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1034198271 7:149264459-149264481 CAAGGTCAAGAGAGGTCGGCTGG + Intronic
1040554335 8:48466032-48466054 CTAGGTTTAGAAAGGGAAGACGG + Intergenic
1041702036 8:60801276-60801298 CTAGCTTTAGGGACCTAGGCTGG + Intronic
1041827306 8:62110219-62110241 CTAGCTTTAGAGAGGTAGTGTGG + Intergenic
1042422822 8:68612106-68612128 ATAGCTTTAGGGAGGTAGGACGG + Intronic
1043870478 8:85426285-85426307 CTATTTTAAGAGAAGTAGGCCGG + Intronic
1045280602 8:100746528-100746550 TCAGGTAAAGAGAGGTAGGCAGG + Intergenic
1045903432 8:107312929-107312951 CTAGCTCTAGAGAGATAGGTTGG + Intronic
1045939683 8:107725515-107725537 CTAGGTATAGAGAGGAATGTTGG - Intergenic
1048469732 8:134695852-134695874 CCTTGTTTAGAGAGGCAGGCAGG - Intronic
1048694006 8:137003611-137003633 CTAGATTTAGAGATGTAAGCAGG - Intergenic
1050542648 9:6683195-6683217 CTAGGTCTAGGCTGGTAGGCTGG - Intergenic
1050922408 9:11221051-11221073 TTAGATTTTGTGAGGTAGGCAGG + Intergenic
1052367141 9:27625057-27625079 CTGGGTTTAGAGACGAAGGAGGG + Intergenic
1052546342 9:29885699-29885721 GTGAGTTTAGACAGGTAGGCAGG + Intergenic
1055191387 9:73529059-73529081 CTATGTATAGATAGGTAGGTAGG + Intergenic
1057888128 9:98846526-98846548 CAAGGCTTAGAGAGGTGGGGTGG - Intronic
1057901673 9:98953706-98953728 CTGGGTTTGGAGAGCTTGGCTGG + Intronic
1058428937 9:104901002-104901024 TTAGGATTAGAGAGATAGGCAGG - Intronic
1060534447 9:124373019-124373041 CCAGCTTTGGAGAGGTAGGAAGG - Intronic
1186976239 X:14908361-14908383 GTAGGGTTAGAAAGGAAGGCTGG + Intronic
1192753171 X:74016307-74016329 GAAAGTTTAGAGAAGTAGGCCGG + Intergenic
1194743754 X:97606358-97606380 TTAGTTTTAGAGAGGTGGGGTGG + Intergenic
1197659017 X:129149703-129149725 CCAGGATTAGAGAGGTGGGATGG - Intergenic