ID: 1108538655

View in Genome Browser
Species Human (GRCh38)
Location 13:51414123-51414145
Sequence TACAACTGGATTTCAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 0, 2: 2, 3: 70, 4: 934}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108538655_1108538659 29 Left 1108538655 13:51414123-51414145 CCACAGGCTGAAATCCAGTTGTA 0: 1
1: 0
2: 2
3: 70
4: 934
Right 1108538659 13:51414175-51414197 TCAGATAAAAGCAAAGATAGAGG 0: 1
1: 0
2: 2
3: 30
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108538655 Original CRISPR TACAACTGGATTTCAGCCTG TGG (reversed) Intronic
900108143 1:994408-994430 TGCCACTGCATTCCAGCCTGGGG - Intergenic
900277191 1:1838484-1838506 TACCACTGCACTCCAGCCTGTGG - Intronic
900332156 1:2140924-2140946 TACCACTGCACTCCAGCCTGGGG + Intronic
901122135 1:6904595-6904617 TGCTACTGCATTCCAGCCTGGGG - Intronic
901467802 1:9433981-9434003 TACCACTGCACTCCAGCCTGGGG - Intergenic
901585063 1:10283163-10283185 TGCCACTGCATTCCAGCCTGGGG + Intronic
901752672 1:11421024-11421046 TACCACTGCACTCCAGCCTGGGG - Intergenic
901987696 1:13089298-13089320 TACCACTGCACTCCAGCCTGGGG - Intergenic
901994116 1:13137469-13137491 TACCACTGCACTCCAGCCTGGGG + Intergenic
902035282 1:13453442-13453464 TGCCACTGGACTCCAGCCTGGGG + Intergenic
902140269 1:14347925-14347947 TGCCACTGCATTCCAGCCTGGGG - Intergenic
902248039 1:15134660-15134682 TACCACTGCACTCCAGCCTGGGG - Intergenic
903275718 1:22220175-22220197 CACCACTGCATTCCAGCCTGGGG - Intergenic
903411529 1:23147397-23147419 CACCACTGCACTTCAGCCTGGGG + Intronic
903537863 1:24079239-24079261 TACCACTGCACTCCAGCCTGGGG - Intronic
903549644 1:24149073-24149095 TGCCACTGCACTTCAGCCTGGGG + Intergenic
903915877 1:26763828-26763850 TGCCACTGCAATTCAGCCTGGGG - Intronic
904066597 1:27757015-27757037 TACCACTGCACTCCAGCCTGTGG + Intronic
904078257 1:27856115-27856137 CACCACTGCACTTCAGCCTGGGG - Intergenic
904141629 1:28357930-28357952 TGCCACTGCATTCCAGCCTGGGG + Intergenic
904221001 1:28968921-28968943 CACCACTGGACTCCAGCCTGGGG + Intronic
904458926 1:30663949-30663971 AACAATTTGTTTTCAGCCTGTGG - Intergenic
904621722 1:31779441-31779463 TGCCACTGCACTTCAGCCTGGGG - Intergenic
904656281 1:32050552-32050574 TACCACTGCACTCCAGCCTGGGG - Intronic
904678031 1:32210454-32210476 CACAACTGCACTCCAGCCTGGGG + Intronic
904734541 1:32620724-32620746 CACCACTGCATTCCAGCCTGGGG + Intronic
905144442 1:35876822-35876844 CACCACTGCATTCCAGCCTGGGG - Intronic
905621864 1:39455304-39455326 GACACCTTGATTTCTGCCTGGGG - Intronic
905691165 1:39944086-39944108 CACAACTGCACTCCAGCCTGGGG - Intergenic
905760499 1:40552885-40552907 TGCCACTGCATTCCAGCCTGGGG + Intergenic
905836312 1:41125255-41125277 CGCCACTGAATTTCAGCCTGGGG - Intronic
905906449 1:41621554-41621576 TACCACTGCACTGCAGCCTGAGG - Intronic
906398527 1:45487954-45487976 TACCACTGCACTCCAGCCTGGGG - Intronic
906497506 1:46315550-46315572 TACCACTGCACTCCAGCCTGGGG + Intronic
906648865 1:47496149-47496171 CACCACTGGACTCCAGCCTGGGG - Intergenic
907018346 1:51039963-51039985 CACCACTGCATTACAGCCTGGGG + Intergenic
907919872 1:58902552-58902574 TGCCACTGCATTCCAGCCTGGGG - Intergenic
908018950 1:59879768-59879790 TACAAGTGAATGGCAGCCTGGGG + Intergenic
908176024 1:61555883-61555905 TATATCTGCATTTGAGCCTGTGG + Intergenic
908394161 1:63709856-63709878 CACCACTGCATTCCAGCCTGGGG + Intergenic
908754676 1:67458101-67458123 TACCACTGCACTCCAGCCTGGGG + Intergenic
908810120 1:67973776-67973798 TACCACTGCTCTTCAGCCTGGGG - Intergenic
909072912 1:71017804-71017826 CACCACTGCATTCCAGCCTGGGG - Intronic
909425798 1:75523352-75523374 CACAACTGCACTCCAGCCTGGGG - Intronic
910435474 1:87201496-87201518 TACAATAGGATTCCAGCCTCAGG + Intergenic
910615175 1:89189719-89189741 GACACCTTGTTTTCAGCCTGTGG + Intronic
911106015 1:94132317-94132339 TATAACTGGCTTTCAACCTTTGG + Intergenic
911717041 1:101144830-101144852 TACAACTGGGATTCAGACTCTGG + Intergenic
913117363 1:115709882-115709904 CACCACTGCATTTCAGCCTGGGG - Intronic
913696799 1:121334501-121334523 TGCAACAGGACTCCAGCCTGGGG - Intronic
914007702 1:143747319-143747341 TGCCACTGCATTCCAGCCTGGGG + Intergenic
914140761 1:144945547-144945569 TGCAACAGGACTCCAGCCTGGGG + Intronic
914258100 1:145976869-145976891 TACCACTGCACTCCAGCCTGAGG + Intronic
914768745 1:150664038-150664060 TGCCACTGCATTTCAGCCTGGGG - Intronic
914860325 1:151380559-151380581 CACCACTGCATTGCAGCCTGGGG + Intergenic
915317509 1:155037483-155037505 TGCCACTGCATTCCAGCCTGGGG - Intronic
915426395 1:155830626-155830648 TACCACTGCACTTCAGCCTAGGG - Intronic
915898676 1:159830522-159830544 TGCCACTGCATTTCATCCTGTGG - Intronic
916719670 1:167474792-167474814 TACCACTGCACTCCAGCCTGGGG - Intronic
917190647 1:172415040-172415062 TGCCACTGCATTCCAGCCTGAGG + Intronic
917394036 1:174572425-174572447 TACCACTGCACTCCAGCCTGGGG - Intronic
918108821 1:181437902-181437924 AACAGCTGGATTTCAGCCTCAGG - Intronic
918116522 1:181502738-181502760 TACCACTGCACTCCAGCCTGGGG - Intronic
919256602 1:195133224-195133246 CACACCTTGATTTTAGCCTGCGG - Intergenic
919346162 1:196382138-196382160 CACCACTGCATTCCAGCCTGGGG - Intronic
919596000 1:199563011-199563033 TGCCACTGCATTCCAGCCTGGGG + Intergenic
919746566 1:201012683-201012705 CACCACTGGATTCCACCCTGGGG - Intronic
919865498 1:201779554-201779576 TGCCACTGCATTCCAGCCTGGGG + Intronic
920168214 1:204051401-204051423 TACCACTGCACTCCAGCCTGGGG - Intergenic
920214577 1:204352941-204352963 TGCCACTGCATTCCAGCCTGGGG + Intronic
920318035 1:205093415-205093437 CACCACTGCAATTCAGCCTGGGG + Intronic
920484129 1:206352855-206352877 TGCAACAGGACTCCAGCCTGGGG - Intronic
920796181 1:209139405-209139427 TGCCACTGCACTTCAGCCTGGGG + Intergenic
921140398 1:212299852-212299874 TACCACTGTACTCCAGCCTGGGG - Intronic
921199751 1:212793252-212793274 TGCTATTGCATTTCAGCCTGAGG - Intronic
921721888 1:218481892-218481914 CACCACTGCACTTCAGCCTGGGG - Intergenic
922238500 1:223739223-223739245 CACCACTGCATTCCAGCCTGGGG - Intronic
922447955 1:225713428-225713450 CACCACTGCATTCCAGCCTGGGG - Intergenic
922893436 1:229079921-229079943 TACACATGGAGTTGAGCCTGAGG - Intergenic
923208021 1:231777261-231777283 TACCACTGTACTCCAGCCTGTGG - Intronic
923390917 1:233514223-233514245 CACCACTGCATTCCAGCCTGGGG - Intergenic
923417300 1:233775894-233775916 TACCATTGCATTTCAGCCTTGGG + Intergenic
924109592 1:240684742-240684764 TGCAACTGCACTCCAGCCTGGGG + Intergenic
924192958 1:241574603-241574625 TTCAAGTGGATTTCATCCTAGGG - Intronic
924559975 1:245150058-245150080 TACCACTGCACTCCAGCCTGGGG + Intergenic
924607230 1:245545141-245545163 TACCACTGTACTCCAGCCTGGGG - Intronic
924702797 1:246471238-246471260 TACAGCCGCACTTCAGCCTGGGG - Intronic
924705537 1:246498828-246498850 TGCCACTGGACTCCAGCCTGGGG - Intronic
924751635 1:246897935-246897957 TGCCACTGCATTCCAGCCTGAGG + Intronic
1063213289 10:3900812-3900834 CACCACTGCATTCCAGCCTGGGG + Intergenic
1063412493 10:5847390-5847412 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1063481326 10:6379185-6379207 CACAACTGCATTCCATCCTGGGG + Intergenic
1063677644 10:8155500-8155522 CACCACTGCATTCCAGCCTGGGG + Intergenic
1063683342 10:8211742-8211764 TACCACTGCACTCCAGCCTGGGG + Intergenic
1063816193 10:9776068-9776090 TACCACTGCACTCCAGCCTGGGG + Intergenic
1064197073 10:13252717-13252739 TACCACTGCACTCCAGCCTGGGG - Intergenic
1064375944 10:14796147-14796169 CACCACTGCATTCCAGCCTGAGG - Intergenic
1064382320 10:14856816-14856838 TACCACTGCACTCCAGCCTGGGG + Intronic
1065494089 10:26311430-26311452 TACCACTGTACTCCAGCCTGGGG + Intergenic
1065772122 10:29087304-29087326 CACTACTGCATTCCAGCCTGGGG + Intergenic
1065898619 10:30185773-30185795 TACCACTGCACTCCAGCCTGTGG - Intergenic
1065946715 10:30611455-30611477 TACGACTGCACTCCAGCCTGGGG + Intergenic
1066131534 10:32399250-32399272 CACCACTGCATTCCAGCCTGGGG - Intergenic
1066258176 10:33702412-33702434 CACCACTGCATTACAGCCTGGGG + Intergenic
1066392318 10:34987491-34987513 TATAACTGCACTCCAGCCTGGGG - Intergenic
1066421158 10:35266117-35266139 TACCACTGCACTCCAGCCTGGGG - Intronic
1066682247 10:37945526-37945548 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1067198623 10:44145970-44145992 TACCACTGCCCTTCAGCCTGGGG + Intergenic
1067280433 10:44867268-44867290 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1067395665 10:45914633-45914655 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1067863986 10:49883757-49883779 TGCCACTGCATTCCAGCCTGGGG + Intronic
1068677810 10:59785756-59785778 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1068853544 10:61772466-61772488 CACCACTGCATTCCAGCCTGGGG + Intergenic
1068929799 10:62577698-62577720 TAGAGCTGGATTTCAGACTGTGG - Intronic
1069029562 10:63580968-63580990 TGCAACTGCACTCCAGCCTGGGG + Intronic
1069201619 10:65624751-65624773 TGCCACTGTATTCCAGCCTGGGG + Intergenic
1069443136 10:68447473-68447495 TGCCACTGGACTCCAGCCTGGGG + Intronic
1069530956 10:69219061-69219083 CACGACTGCATTCCAGCCTGGGG + Intergenic
1070061338 10:72986201-72986223 TACCACTGCACTCCAGCCTGGGG - Intergenic
1070229118 10:74544818-74544840 TACCACTGCACTCCAGCCTGGGG + Intronic
1070613181 10:77948579-77948601 TGCCACTGCATTCCAGCCTGCGG - Intergenic
1070758787 10:79010182-79010204 CACCACTGCATTCCAGCCTGGGG + Intergenic
1070868674 10:79728082-79728104 TATCACTGGAATTCAGGCTGAGG - Intergenic
1071184809 10:83029821-83029843 TAGAACTAAATTCCAGCCTGTGG - Intergenic
1071608746 10:87016656-87016678 TGCTACTGCACTTCAGCCTGGGG + Intergenic
1071635587 10:87250297-87250319 TATCACTGGAATTCAGGCTGAGG - Intergenic
1071659652 10:87487677-87487699 TATCACTGGAATTCAGGCTGAGG + Intergenic
1072107232 10:92285975-92285997 TACCACTGCACTCCAGCCTGGGG - Intronic
1072314823 10:94191597-94191619 TGCCACTGCATTCCAGCCTGGGG + Intronic
1072427783 10:95344443-95344465 TGCCACTGCATTCCAGCCTGGGG - Intronic
1072453317 10:95556409-95556431 TACCACTGCACTCCAGCCTGGGG - Intronic
1072457774 10:95591883-95591905 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1072499949 10:96004630-96004652 TAGAACTGAATTTTAGCCTTAGG - Intronic
1072930128 10:99655272-99655294 CACCACTGCATTCCAGCCTGGGG + Intergenic
1073279202 10:102339826-102339848 TACCACTGCACTCCAGCCTGGGG - Intronic
1074069735 10:110054652-110054674 TGCCACTGCATTGCAGCCTGGGG - Intronic
1074387008 10:113024659-113024681 CACCACTGCATTCCAGCCTGGGG - Intronic
1074588450 10:114789829-114789851 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1075035848 10:119066465-119066487 TGCCACTGGACTCCAGCCTGGGG + Intronic
1075093727 10:119457726-119457748 TGCCACTGCACTTCAGCCTGGGG - Intronic
1075131863 10:119747263-119747285 TACCACTGCACTCCAGCCTGGGG - Intronic
1075531111 10:123230526-123230548 TCCAACTTAATTTCAGCCTAAGG + Intergenic
1075759972 10:124848374-124848396 TGCCACTGCACTTCAGCCTGGGG + Intergenic
1075953240 10:126500036-126500058 AAGAACTGGATTTCAGGCTGAGG + Intronic
1076015896 10:127027542-127027564 CACCACTGCACTTCAGCCTGGGG + Intronic
1076232379 10:128832318-128832340 CACCACTGAATTCCAGCCTGGGG + Intergenic
1077022768 11:426528-426550 TACCACTGTACTCCAGCCTGGGG + Intronic
1077079464 11:718289-718311 CACCACTGCATTCCAGCCTGGGG + Intronic
1078192436 11:9102483-9102505 CACCACTGCATTCCAGCCTGGGG + Intronic
1079024026 11:16931711-16931733 TACAACTGCACTCCAGCCTGGGG + Intronic
1079566528 11:21889837-21889859 CACCACTGCATTCCAGCCTGGGG - Intergenic
1080251533 11:30239088-30239110 CACAACTGCACTTCAGCCTCAGG + Intergenic
1080393864 11:31872177-31872199 TACAACTGCATTTCATCTTCAGG + Intronic
1080469919 11:32535327-32535349 GACCACTGCACTTCAGCCTGGGG - Intergenic
1080805763 11:35651882-35651904 CACCACTGCACTTCAGCCTGGGG - Intergenic
1082008763 11:47436553-47436575 TACTACTGCACTTCAGCCTGGGG - Intergenic
1082035986 11:47645685-47645707 TACCACTGCACTCCAGCCTGGGG + Intergenic
1082110436 11:48268038-48268060 TACCACTGCATTCCAGCCTGGGG - Intergenic
1082920940 11:58493083-58493105 TACCACTGCACTTCAGCCTGGGG + Intergenic
1082953632 11:58845556-58845578 CACCACTGCACTTCAGCCTGGGG + Intronic
1083123503 11:60539087-60539109 AACAACTTGATTTCAGTCTTGGG + Intronic
1083133600 11:60650364-60650386 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1083139215 11:60707869-60707891 AACCACTGCATTCCAGCCTGGGG - Intronic
1083451199 11:62746575-62746597 CACCACTGCATTCCAGCCTGGGG - Intergenic
1083575628 11:63788946-63788968 CCCAACTGCACTTCAGCCTGGGG + Intergenic
1083846535 11:65337643-65337665 TACCACTGCACTTCAGCCTGGGG - Intronic
1083971831 11:66082264-66082286 TACCACTGCACTCCAGCCTGTGG - Intronic
1084034725 11:66502347-66502369 TGCCACTGCATTCCAGCCTGGGG - Intronic
1084125527 11:67096569-67096591 TACCACTGCACTCCAGCCTGGGG + Intergenic
1084314237 11:68335116-68335138 TACCACTGCATTCCAGCCTGGGG - Intronic
1084367953 11:68715690-68715712 TACAACTTGATTCCTGCCGGTGG - Intronic
1084382305 11:68820638-68820660 CACCACTGCACTTCAGCCTGGGG + Intronic
1085087890 11:73684208-73684230 TACCACTGCACTCCAGCCTGGGG - Intronic
1085146025 11:74198501-74198523 CACCACTGCATTCCAGCCTGGGG - Intronic
1085357082 11:75848153-75848175 TACCACTGTACTCCAGCCTGGGG + Intronic
1085357387 11:75850988-75851010 GTGAACTGGCTTTCAGCCTGCGG + Intronic
1085553047 11:77393334-77393356 TACCACTGCACTCCAGCCTGGGG - Intronic
1085569277 11:77545086-77545108 CACCACTGTATTCCAGCCTGAGG + Intronic
1085778680 11:79389195-79389217 TACCACTGCACTCCAGCCTGGGG - Intronic
1085882409 11:80483601-80483623 CACCACTGCATTCCAGCCTGGGG + Intergenic
1086449835 11:86905012-86905034 TACCACTGTACTTCAGTCTGGGG + Intronic
1086551083 11:88052485-88052507 TAGAACTGGATTTCAACCCTAGG + Intergenic
1088047941 11:105476395-105476417 TAAAACTTGATTTCCTCCTGGGG + Intergenic
1088233811 11:107701029-107701051 TACCACTGCACTCCAGCCTGGGG + Intergenic
1088269753 11:108021854-108021876 TGCCACTGCATTCCAGCCTGAGG - Intronic
1088478630 11:110269998-110270020 CACCACTGCATTCCAGCCTGGGG + Intronic
1089060260 11:115620592-115620614 TACCACTGCACTCCAGCCTGGGG - Intergenic
1089511309 11:118998904-118998926 GACATCTGGGTTTCTGCCTGGGG - Intronic
1089563589 11:119358356-119358378 CACCACTGCACTTCAGCCTGGGG - Intronic
1090424841 11:126600304-126600326 TACATCTTGATTGCAGCCTTGGG + Intronic
1091443799 12:531606-531628 TACCACTGCATTCCAGCCTGGGG + Intronic
1091715965 12:2776374-2776396 TCCAGCTGGATGTCAGCCAGGGG - Intergenic
1091730848 12:2879039-2879061 TGCCACTGGACTTCAGCCTGGGG - Intronic
1092176425 12:6411279-6411301 CACCACTGCACTTCAGCCTGGGG - Intergenic
1092183123 12:6459810-6459832 TACCACTGCACTCCAGCCTGGGG - Intronic
1092887594 12:12938545-12938567 TACAACTGAACTCCAGCCTGGGG + Intergenic
1093801584 12:23379832-23379854 CACCACTGCATTCCAGCCTGGGG + Intergenic
1094626998 12:32133821-32133843 TACCACTGCACTCCAGCCTGGGG - Intronic
1095561901 12:43575310-43575332 CACCACTGTACTTCAGCCTGGGG + Intergenic
1096066558 12:48745234-48745256 TACCACTGCACTCCAGCCTGGGG + Intergenic
1096142150 12:49251163-49251185 TACCACTGCACTCCAGCCTGGGG + Intronic
1096143326 12:49260770-49260792 TGCAACTGCACTCCAGCCTGGGG - Intronic
1096213510 12:49785049-49785071 TACCACTGCACTCCAGCCTGAGG - Intergenic
1096379643 12:51145338-51145360 CACCACTGGACTCCAGCCTGGGG + Intronic
1096516661 12:52159841-52159863 TACCACTGCATTTCAGCCTAGGG - Intergenic
1096733801 12:53636345-53636367 TGCCACTGCACTTCAGCCTGGGG + Intronic
1097979240 12:65720106-65720128 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1098339403 12:69436538-69436560 TACCACTGCACTCCAGCCTGGGG - Intergenic
1098401609 12:70082354-70082376 TGCAACTGCACTCCAGCCTGGGG + Intergenic
1098445355 12:70560853-70560875 TTCAACTGGAGTCCAGCCTCTGG - Exonic
1099306451 12:80962423-80962445 TACCACTGCACTCCAGCCTGGGG - Intronic
1099713286 12:86257227-86257249 TCCCACTGGATTTAAGCCTGGGG - Intronic
1100367938 12:93938535-93938557 TACAACTGGATATCAGATTTGGG + Intergenic
1100578017 12:95910820-95910842 TGCTACTGCACTTCAGCCTGGGG + Intronic
1100634123 12:96418605-96418627 CACCACTGTATTCCAGCCTGGGG - Intergenic
1100790504 12:98125028-98125050 AACATCTTGATTTCAGCCTTGGG + Intergenic
1100805364 12:98277659-98277681 GACAACTTGACTTCAGCCTTAGG - Intergenic
1100915731 12:99419708-99419730 TACCACTGGACTCTAGCCTGGGG - Intronic
1101030369 12:100652130-100652152 TAAAAGTGCATTTCAGTCTGAGG + Intergenic
1101497102 12:105265107-105265129 CACCACTGCACTTCAGCCTGGGG + Intronic
1101959061 12:109234448-109234470 TGCCATTGTATTTCAGCCTGGGG + Intronic
1102104880 12:110312806-110312828 CACAACTGCATTCCACCCTGAGG + Intronic
1102170017 12:110835270-110835292 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1102242912 12:111336487-111336509 TACGACTGCACTCCAGCCTGGGG - Intronic
1102277091 12:111590928-111590950 CACCACTGTACTTCAGCCTGGGG - Intronic
1102386167 12:112512351-112512373 CACCACTGCATTCCAGCCTGGGG - Intergenic
1102438471 12:112943753-112943775 TACCACTGCACTCCAGCCTGGGG - Intronic
1102588310 12:113938882-113938904 GACACCTTGATTTCAGACTGTGG + Intronic
1102617513 12:114167421-114167443 AACACCTTGATTTCAGCCTTGGG + Intergenic
1102670016 12:114610284-114610306 CACAACTGTACTCCAGCCTGGGG - Intergenic
1102886040 12:116522720-116522742 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1103075161 12:117975990-117976012 TGCCACTGCACTTCAGCCTGGGG + Intergenic
1103448186 12:121008600-121008622 GGCAGCTGCATTTCAGCCTGTGG - Intronic
1103530731 12:121599664-121599686 TACCACTGCACTCCAGCCTGGGG + Intergenic
1103731330 12:123029542-123029564 CACCACTGCACTTCAGCCTGGGG + Intronic
1104026697 12:125032730-125032752 CACCACTGCATTCCAGCCTGGGG + Intergenic
1105687192 13:22795785-22795807 TACCACTGCACTCCAGCCTGGGG - Intergenic
1107142794 13:37021044-37021066 TACAACTGGGATTCAAGCTGAGG + Intronic
1107202398 13:37737512-37737534 TACCAGTGCATTCCAGCCTGCGG - Intronic
1108153597 13:47562410-47562432 TAGCACTGCATTCCAGCCTGGGG + Intergenic
1108538655 13:51414123-51414145 TACAACTGGATTTCAGCCTGTGG - Intronic
1108828925 13:54452769-54452791 TACATGTGGTTTTTAGCCTGTGG - Intergenic
1109242076 13:59901869-59901891 TGCCACTGCACTTCAGCCTGGGG - Intronic
1109309244 13:60672500-60672522 AACACCTGGTTTTCTGCCTGAGG + Intergenic
1109504642 13:63284564-63284586 AACAACTGGATTTCATCCCAAGG - Intergenic
1109505003 13:63288154-63288176 TGCCACTGCATTTCATCCTGGGG + Intergenic
1109797970 13:67341491-67341513 TACCATCGGATATCAGCCTGGGG + Intergenic
1110000995 13:70200040-70200062 TGCTACTGCATTCCAGCCTGGGG + Intergenic
1110235500 13:73213712-73213734 CACCACTGCATTCCAGCCTGGGG + Intergenic
1110278431 13:73664232-73664254 GACACCTTCATTTCAGCCTGGGG - Intergenic
1110296172 13:73868430-73868452 TGCCACTGGACTCCAGCCTGGGG - Intronic
1110636633 13:77774606-77774628 TACCACTGCACTCCAGCCTGGGG - Intergenic
1110885015 13:80621852-80621874 TGCCACTGCACTTCAGCCTGGGG + Intergenic
1111071039 13:83167981-83168003 TGCCACTGCACTTCAGCCTGGGG + Intergenic
1111685746 13:91498927-91498949 TACCACTGCACTCCAGCCTGGGG + Intronic
1111730426 13:92069566-92069588 TTCAACTGGATATTAGCCTGGGG - Intronic
1111851071 13:93575247-93575269 TACCACTGCACTCCAGCCTGGGG + Intronic
1111870495 13:93825900-93825922 TACTGCTGCACTTCAGCCTGGGG - Intronic
1112346180 13:98591722-98591744 CACCACTGCACTTCAGCCTGGGG + Intergenic
1114006406 14:18318724-18318746 CACCACTGCATTTCAGTCTGGGG - Intergenic
1115552911 14:34520541-34520563 CACCACTGCATTCCAGCCTGGGG - Intronic
1115817456 14:37178383-37178405 TGCAACTGCACTCCAGCCTGGGG - Intergenic
1116144406 14:41045386-41045408 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1116846928 14:49873516-49873538 TACCACTGCACTCCAGCCTGGGG - Intergenic
1117057999 14:51932580-51932602 TACCACTGCACTCCAGCCTGGGG + Intronic
1117276142 14:54195668-54195690 CACCACTGCACTTCAGCCTGGGG + Intergenic
1117705341 14:58461474-58461496 TGCCACTGCATTCCAGCCTGGGG - Intronic
1118635328 14:67743447-67743469 CACCACTGCATTCCAGCCTGAGG + Intronic
1118647615 14:67854921-67854943 TGCCACTGCACTTCAGCCTGGGG + Intronic
1119715138 14:76853792-76853814 TACCACTGCACTCCAGCCTGGGG - Intronic
1121048451 14:90804596-90804618 TGCAGCTGGCTTGCAGCCTGTGG - Intronic
1121103749 14:91267491-91267513 TACTACTGTACTCCAGCCTGAGG + Intergenic
1122134204 14:99623453-99623475 TACCACTGCACTCCAGCCTGGGG - Intergenic
1122565328 14:102650322-102650344 TGCCACTGCACTTCAGCCTGAGG + Intronic
1122883039 14:104698686-104698708 TCCAACTGCTTTTCAGCATGAGG - Intronic
1122963312 14:105109723-105109745 CACCACTGCATTCCAGCCTGGGG + Intergenic
1202901854 14_GL000194v1_random:48868-48890 TGCCACTGCATTTCAGCCTGAGG + Intergenic
1123497351 15:20841404-20841426 TACCACTGAACTCCAGCCTGGGG + Intronic
1123554586 15:21415043-21415065 TACCACTGAACTCCAGCCTGGGG + Intronic
1123568509 15:21577636-21577658 CACCACTGCATTCCAGCCTGGGG - Intergenic
1123590830 15:21852357-21852379 TACCACTGAACTCCAGCCTGGGG + Intergenic
1123604618 15:22012958-22012980 CACCACTGCATTCCAGCCTGGGG - Intergenic
1124400891 15:29346341-29346363 CCCAGCTGGATTTCAGCCTGAGG - Intronic
1124435174 15:29642652-29642674 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1124843716 15:33269223-33269245 TACCACTGTACTCCAGCCTGGGG - Intergenic
1125957791 15:43802526-43802548 TACTACTGTACTCCAGCCTGGGG + Intronic
1126769279 15:52039052-52039074 TGCCACTGCACTTCAGCCTGAGG - Intronic
1126817883 15:52471738-52471760 CACCACTGCATGTCAGCCTGGGG - Intronic
1126859853 15:52872981-52873003 TACCACAGGAGCTCAGCCTGGGG - Intergenic
1127080093 15:55369068-55369090 TACCACTGCACTCCAGCCTGGGG + Intronic
1127087845 15:55441111-55441133 TGCAACTGCACTCCAGCCTGGGG - Intronic
1127090518 15:55462233-55462255 CACCACTGCATTCCAGCCTGGGG - Intronic
1127448322 15:59089144-59089166 TACAAGTAAATTTTAGCCTGTGG + Intronic
1128069824 15:64788250-64788272 TACTACTGCACTCCAGCCTGGGG - Intergenic
1128951091 15:71882844-71882866 CACCACTGCACTTCAGCCTGGGG - Intronic
1128967291 15:72072028-72072050 TACCACTGCACTCCAGCCTGGGG + Intronic
1128967856 15:72078448-72078470 TACCACTGCACTCCAGCCTGTGG + Intronic
1128973444 15:72129798-72129820 CACCACTGCATTCCAGCCTGGGG + Intronic
1130704637 15:86221154-86221176 TACAACTACACTCCAGCCTGGGG + Intronic
1130864188 15:87918052-87918074 TGCAAGTGGCTTTGAGCCTGTGG + Intronic
1131096733 15:89660154-89660176 TACCACTGCACTCCAGCCTGTGG + Intergenic
1131840297 15:96429645-96429667 CACCACTGCATCTCAGCCTGGGG + Intergenic
1131900294 15:97080429-97080451 GACAACTGTCTTTAAGCCTGTGG - Intergenic
1132021564 15:98366845-98366867 CACAACTGCACTCCAGCCTGGGG + Intergenic
1132168380 15:99620885-99620907 CACCACTGCACTTCAGCCTGGGG - Intronic
1132427534 15:101731150-101731172 TGCAACTGGTTAACAGCCTGTGG - Intergenic
1202962930 15_KI270727v1_random:142237-142259 TACCACTGAACTCCAGCCTGGGG + Intergenic
1202976865 15_KI270727v1_random:304724-304746 CACCACTGCATTCCAGCCTGGGG - Intergenic
1133082520 16:3334177-3334199 CACCACTGCACTTCAGCCTGGGG - Intergenic
1133096675 16:3451874-3451896 CACGACTGCATTCCAGCCTGGGG + Intronic
1133341494 16:5039391-5039413 CACCACTGCACTTCAGCCTGGGG + Intronic
1133793479 16:9027691-9027713 TACCACTGCACTCCAGCCTGGGG - Intergenic
1134277772 16:12791991-12792013 TGCCACTGCATTTCAGCCTGGGG - Intronic
1134375726 16:13671163-13671185 AACACCTAGATTTCAGCCTGAGG + Intergenic
1134528908 16:14966952-14966974 TGCCACTGCATTCCAGCCTGAGG + Intergenic
1134546192 16:15110592-15110614 TACAAATGGACTTCAGCCCTTGG + Intronic
1134721664 16:16387606-16387628 TACAAATGGACTTCAGCCCTTGG - Intronic
1134823898 16:17269224-17269246 TACCACTGTACTCCAGCCTGGGG - Intronic
1134945762 16:18324269-18324291 TACAAATGGACTTCAGCCCTTGG + Intronic
1135267657 16:21041327-21041349 TGCCACTGCATTCCAGCCTGGGG + Intronic
1135269835 16:21059731-21059753 TACCACTGCATTTCAGCCCTGGG + Intronic
1135564079 16:23498383-23498405 TGCAACTGCACTCCAGCCTGGGG + Intronic
1135817283 16:25646495-25646517 TTCAACTGCATTACATCCTGAGG - Intergenic
1136134264 16:28245252-28245274 CACCACTGTACTTCAGCCTGGGG - Intergenic
1136164982 16:28447793-28447815 TACCACTGCACTCCAGCCTGGGG - Intergenic
1136197985 16:28667187-28667209 TACCACTGCACTCCAGCCTGGGG + Intergenic
1136214330 16:28781364-28781386 TACCACTGCACTCCAGCCTGGGG + Intergenic
1136259052 16:29061209-29061231 TACCACTGCACTCCAGCCTGGGG + Intergenic
1136522719 16:30807406-30807428 CACCACTGCATTCCAGCCTGGGG - Intergenic
1137280079 16:46969003-46969025 TACCACTGCACTCCAGCCTGGGG + Intronic
1137820119 16:51436255-51436277 CACCACTGCACTTCAGCCTGGGG + Intergenic
1137837208 16:51604278-51604300 CACCACTGCATTTCAGCCTGGGG - Intergenic
1137944330 16:52719258-52719280 CACTACTGCATTCCAGCCTGGGG - Intergenic
1138465056 16:57183725-57183747 TCAAAATGGATTTCATCCTGAGG + Intronic
1138567948 16:57847140-57847162 CACCACTGCATTCCAGCCTGAGG + Intronic
1138672347 16:58625640-58625662 TACCACTGCACTCCAGCCTGAGG + Intronic
1139454931 16:67066516-67066538 TGCCACTGCATTCCAGCCTGGGG + Intronic
1139920857 16:70459494-70459516 TACCACTGCACTCCAGCCTGGGG + Intronic
1140116619 16:72047404-72047426 CACCACTGCACTTCAGCCTGGGG - Intronic
1140177168 16:72674446-72674468 TACCACTGCATTCCAGCCTGGGG - Intergenic
1140231340 16:73119724-73119746 CACTACTGCATTCCAGCCTGGGG - Intergenic
1140286568 16:73608030-73608052 TGCCACTGCACTTCAGCCTGGGG + Intergenic
1140553371 16:75892441-75892463 TACCACTGCATTCCAGCCTCTGG - Intergenic
1140742379 16:77952813-77952835 TACCACTGCATTCTAGCCTGGGG + Intronic
1140961518 16:79917635-79917657 TGCCACTGCATTCCAGCCTGTGG - Intergenic
1141673604 16:85505929-85505951 CACCACTGCATTCCAGCCTGGGG + Intergenic
1141710556 16:85696513-85696535 TGCCACTGCATTCCAGCCTGGGG - Intronic
1141729609 16:85812858-85812880 CACCACTGCATTCCAGCCTGGGG - Intergenic
1142156818 16:88536211-88536233 TGCCACTGAACTTCAGCCTGGGG - Exonic
1142756903 17:2021898-2021920 TACAACTGCCCTCCAGCCTGGGG - Intronic
1142765648 17:2062824-2062846 GAGAACTGGCTTTCAGCCTGGGG + Intronic
1142765817 17:2063694-2063716 GAGAACTGGCTTTCAGCCTGGGG + Intronic
1142821544 17:2472070-2472092 TACCATTGCATTCCAGCCTGGGG + Intronic
1142923427 17:3211374-3211396 TACCACTGCACTCCAGCCTGGGG - Intergenic
1143343792 17:6234488-6234510 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1143393739 17:6575918-6575940 TCCAACTGGACTTCTGCCTGTGG - Intergenic
1143581866 17:7832465-7832487 TACCACTGCACTCCAGCCTGGGG + Intronic
1143629753 17:8131831-8131853 CACCACTGCACTTCAGCCTGGGG - Intergenic
1143713496 17:8750345-8750367 AGCCACTGCATTTCAGCCTGGGG + Intergenic
1143840035 17:9724636-9724658 CACCACTGGACTGCAGCCTGGGG + Intronic
1143885930 17:10064867-10064889 TACCACTGTACTTCAGCCTGGGG - Intronic
1144473901 17:15567650-15567672 TACCACTGTACTCCAGCCTGGGG + Intronic
1144526310 17:15993406-15993428 TGCCACTGCACTTCAGCCTGGGG - Intronic
1144800879 17:17926127-17926149 TACCACTGTATTCTAGCCTGGGG + Intronic
1144814279 17:18022642-18022664 TGCCACTGCACTTCAGCCTGGGG - Intronic
1145360249 17:22206175-22206197 CACCACTGCATTCCAGCCTGGGG - Intergenic
1145376648 17:22355565-22355587 CACAACTGCACTCCAGCCTGGGG + Intergenic
1145877493 17:28330762-28330784 TGCCACTGCATTCCAGCCTGGGG + Intronic
1146017320 17:29244482-29244504 TACCACTGCACTCCAGCCTGGGG - Intergenic
1146121800 17:30202048-30202070 TACCACTGCACTCCAGCCTGGGG + Intronic
1146178998 17:30685292-30685314 TGCCACTGCATTTCAGCCTGAGG - Intergenic
1146610857 17:34303746-34303768 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1147056782 17:37840940-37840962 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1147221896 17:38939249-38939271 TACCACTGCACTCCAGCCTGGGG + Intronic
1147233165 17:39034530-39034552 CACCACTGCATTCCAGCCTGGGG - Intergenic
1147252057 17:39158569-39158591 CACAACTGTACTCCAGCCTGGGG + Intronic
1147622894 17:41879758-41879780 CACCACTGCATTCCAGCCTGGGG - Intronic
1147870830 17:43586311-43586333 TGCCACTGCATTCCAGCCTGAGG - Intergenic
1148033260 17:44637924-44637946 TGCTACTGCACTTCAGCCTGGGG - Intergenic
1148217514 17:45841107-45841129 TACCACTGCACTCCAGCCTGAGG + Intergenic
1148663512 17:49356385-49356407 CACCACTGCACTTCAGCCTGGGG + Intronic
1149573227 17:57691014-57691036 AACAACTGGATTTCAATATGTGG - Intergenic
1149837188 17:59923550-59923572 CACCACTGCATTCCAGCCTGGGG - Intronic
1150353153 17:64461287-64461309 TACCACTGCACTCCAGCCTGGGG - Intronic
1150423723 17:65059808-65059830 CACCACTGCACTTCAGCCTGGGG + Intergenic
1150649077 17:66998262-66998284 CACCACTGCACTTCAGCCTGGGG - Intronic
1150671652 17:67205282-67205304 TACCACTGCACTCCAGCCTGGGG + Intronic
1150728888 17:67674460-67674482 CACCACTGCACTTCAGCCTGGGG + Intronic
1151272141 17:73005035-73005057 CACCACTGCATTCCAGCCTGGGG - Intronic
1151307802 17:73274625-73274647 TACCACTGTACTCCAGCCTGGGG - Intergenic
1151359469 17:73579934-73579956 CACCACTGCATTCCAGCCTGGGG + Intronic
1151500085 17:74482750-74482772 TGCCACTGCATTCCAGCCTGGGG - Intronic
1151598814 17:75093983-75094005 TCCAGCTGGATTCCAGCCAGGGG - Intronic
1152113260 17:78369032-78369054 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1152219427 17:79054134-79054156 CACCACTGCATTCCAGCCTGGGG + Intergenic
1153567277 18:6431026-6431048 TACCACTGCACTCCAGCCTGGGG - Intergenic
1154198987 18:12286644-12286666 TACCACTGCACTCCAGCCTGGGG - Intergenic
1154455374 18:14517817-14517839 TACCACTGAACTCCAGCCTGGGG + Intronic
1154946438 18:21166319-21166341 TACCACTGTACTCCAGCCTGGGG + Intergenic
1154951189 18:21211556-21211578 TACCACTGCATTCCAGCCTGGGG + Intergenic
1155202830 18:23532473-23532495 TACCACTGCACTGCAGCCTGAGG - Intronic
1155571581 18:27200631-27200653 AACACCTTGATTTCAGCATGTGG - Intergenic
1156335332 18:36166370-36166392 TACCACTGCACTCCAGCCTGGGG - Intronic
1156769159 18:40698461-40698483 TACATGTGGTGTTCAGCCTGTGG + Intergenic
1157016224 18:43718104-43718126 TACCACTGAACTCCAGCCTGGGG + Intergenic
1157175163 18:45445151-45445173 TGCCACTGCACTTCAGCCTGGGG - Intronic
1157257511 18:46152188-46152210 GACACCTTGATTTCAGCCTGGGG + Intergenic
1157317419 18:46603935-46603957 TCCCACTGGGTTGCAGCCTGGGG - Intronic
1158062161 18:53357807-53357829 TTCAGCTGCATTTCAGACTGCGG + Intronic
1158114939 18:53984650-53984672 TACCACTGTATTCCAGCCTGGGG + Intergenic
1158798660 18:60879034-60879056 TACCACTGTATTCCAGCCTGGGG - Intergenic
1158801724 18:60919105-60919127 TGCCACTGTATTCCAGCCTGGGG - Intergenic
1159783446 18:72686585-72686607 CACCACTGCACTTCAGCCTGGGG - Intergenic
1159872314 18:73772433-73772455 CACCACTGCACTTCAGCCTGGGG - Intergenic
1159920920 18:74226799-74226821 GACACCTGGATTTCAGACTTCGG - Intergenic
1160027648 18:75231574-75231596 TACCACTGCACTCCAGCCTGGGG - Intronic
1160056772 18:75489882-75489904 AACACCAAGATTTCAGCCTGGGG + Intergenic
1160213195 18:76901714-76901736 CACCACTGGACTCCAGCCTGGGG + Intronic
1160850700 19:1190390-1190412 TGCCACTGCACTTCAGCCTGGGG + Intronic
1161045747 19:2133544-2133566 CACCACTGCATTCCAGCCTGGGG - Intronic
1161119419 19:2517217-2517239 CACCACTGCATTCCAGCCTGGGG - Intronic
1161406331 19:4093353-4093375 CACCACTGCATTCCAGCCTGGGG + Intronic
1161478778 19:4500326-4500348 TACCACTGCACTCCAGCCTGGGG - Intronic
1162048225 19:8015671-8015693 TACCACTGTACTCCAGCCTGGGG - Intronic
1162205139 19:9050170-9050192 TACCACTGCACTCCAGCCTGGGG - Intergenic
1162287792 19:9752571-9752593 TTCCACTGCATTCCAGCCTGGGG + Intronic
1162307283 19:9882853-9882875 TGCCACTGCATTCCAGCCTGGGG + Intronic
1162345990 19:10118521-10118543 TGCCACTGCACTTCAGCCTGGGG + Intronic
1162409658 19:10497850-10497872 CACCACTGTATTCCAGCCTGGGG + Intronic
1162492313 19:11000483-11000505 TACCACTGCATTCCAGCCTGGGG + Intronic
1162680894 19:12340290-12340312 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1162697238 19:12485712-12485734 CACCACTGCATTCCAGCCTGAGG - Intronic
1162762183 19:12895299-12895321 TACCACTGCACTTCAGCCTGGGG - Intronic
1162778262 19:12993265-12993287 TACCACTGCACTCCAGCCTGGGG - Intergenic
1162979625 19:14230282-14230304 TGCCACTGCATTTCAGCCTGAGG + Intergenic
1163304427 19:16468976-16468998 TACCACTGCACTCCAGCCTGGGG + Intronic
1163522598 19:17800331-17800353 CACCACTGCACTTCAGCCTGGGG + Intronic
1163778421 19:19231936-19231958 TGCAACTGCACTCCAGCCTGGGG + Intronic
1164190539 19:22912835-22912857 CACAACTGCACTCCAGCCTGGGG + Intergenic
1164310040 19:24037649-24037671 CACCACTGCACTTCAGCCTGGGG - Intronic
1164679986 19:30127722-30127744 TGCCACTGTATTCCAGCCTGGGG + Intergenic
1165399614 19:35589683-35589705 TACTACTGCACTTCAGCCTGGGG + Intergenic
1165505252 19:36223402-36223424 CACCACTGCATTCCAGCCTGGGG - Intronic
1165524163 19:36338594-36338616 TACCACTGCACTCCAGCCTGGGG + Exonic
1165923418 19:39312758-39312780 TACCACTGCACTCCAGCCTGGGG + Intronic
1165978881 19:39702814-39702836 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1166133442 19:40761001-40761023 CACGACTGCATTCCAGCCTGGGG - Intronic
1166142731 19:40813635-40813657 TACCACTGCACTCCAGCCTGGGG - Intronic
1166184825 19:41133166-41133188 TACCACTGCACTCCAGCCTGGGG + Intergenic
1166583132 19:43920640-43920662 TACCACTGCACTCCAGCCTGGGG - Intronic
1166607205 19:44154672-44154694 TATCACTGCACTTCAGCCTGAGG - Intronic
1166673649 19:44726147-44726169 CACCACTGCATTCCAGCCTGGGG - Intergenic
1166715295 19:44963165-44963187 TGCCACTGCATTCCAGCCTGGGG + Intronic
1166868614 19:45856781-45856803 TACCACTGCATTCCAGCCTGCGG + Intronic
1167345142 19:48940812-48940834 TGCCACTGCATTCCAGCCTGGGG + Intronic
1167882044 19:52467571-52467593 AACCACTGCATTCCAGCCTGTGG + Intronic
1167940037 19:52939381-52939403 TACCACTGCACTGCAGCCTGGGG - Intronic
1167988272 19:53336466-53336488 TACCACTGCACTGCAGCCTGGGG + Intronic
1168044728 19:53786391-53786413 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1168503952 19:56916977-56916999 TACCACTGCACTCCAGCCTGAGG - Intergenic
1168523305 19:57069591-57069613 CACCACTGCAGTTCAGCCTGGGG - Intergenic
1168552181 19:57305559-57305581 CACAACTGCACTCCAGCCTGGGG - Intergenic
925227233 2:2194119-2194141 CACCACTGCACTTCAGCCTGGGG - Intronic
925854904 2:8119904-8119926 GACAATGGGATTTCAGTCTGTGG - Intergenic
925973046 2:9121015-9121037 CACAAATGGATTTGAGACTGGGG - Intergenic
925992554 2:9265092-9265114 CACCACTGCACTTCAGCCTGGGG + Intronic
926713200 2:15900026-15900048 CACCACTGCATTCCAGCCTGGGG + Intergenic
926821030 2:16851878-16851900 CACAACTGCACTCCAGCCTGCGG - Intergenic
926995420 2:18730061-18730083 TGCCACTGCATTCCAGCCTGGGG + Intergenic
927180380 2:20442220-20442242 TACCACTGCACTCCAGCCTGGGG - Intergenic
927198535 2:20564523-20564545 TACCACTGCACTCCAGCCTGGGG - Intronic
927763580 2:25783085-25783107 TACCACTGCACTCCAGCCTGGGG + Intronic
928064235 2:28147513-28147535 TGCCACTGCATTCCAGCCTGGGG - Intronic
928338787 2:30423198-30423220 TACCACTGCACTCCAGCCTGGGG + Intergenic
928523096 2:32110158-32110180 CACCACTGCATTCCAGCCTGGGG - Intronic
928525383 2:32134735-32134757 CACAACTGCACTTCGGCCTGGGG - Intronic
928663313 2:33525833-33525855 TACCACTGCACTCCAGCCTGGGG + Intronic
928881752 2:36104544-36104566 TGCCACTGCATTCCAGCCTGGGG + Intergenic
928974081 2:37065353-37065375 TGCCACTGCATTCCAGCCTGGGG - Intronic
929196713 2:39192400-39192422 TGCCACTGCATTTTAGCCTGGGG - Intronic
929601081 2:43205128-43205150 TACCACTGCACTCCAGCCTGGGG - Intergenic
930065586 2:47325065-47325087 CACCACTGAACTTCAGCCTGGGG + Intergenic
930224313 2:48776875-48776897 TGCCACTGCACTTCAGCCTGAGG + Intergenic
930822122 2:55657285-55657307 CACCACTGCACTTCAGCCTGTGG + Intronic
931100437 2:58993926-58993948 CACAACTGCACTGCAGCCTGGGG - Intergenic
931207486 2:60161900-60161922 TGCAACTGCACTCCAGCCTGGGG + Intergenic
931244263 2:60479496-60479518 AGCAAAAGGATTTCAGCCTGAGG - Intronic
931271628 2:60708689-60708711 TACCACTGCACTCCAGCCTGGGG + Intergenic
931282084 2:60803500-60803522 CACAACTGCACTCCAGCCTGGGG + Intergenic
931410492 2:62025486-62025508 TGCCACTGCATTCCAGCCTGGGG + Intronic
931428172 2:62189751-62189773 TACCACTGTACTCCAGCCTGGGG + Intergenic
931823683 2:65977530-65977552 TTCAAGTGCATTTCCGCCTGAGG - Intergenic
931852332 2:66264173-66264195 GAAAAATGGATTTCAGCCTCAGG - Intergenic
932155951 2:69417608-69417630 CACTACTGTATTCCAGCCTGGGG + Intronic
932701405 2:73994678-73994700 TACCACTGCACTCCAGCCTGGGG - Intronic
932855136 2:75225597-75225619 TAACACTGCATTCCAGCCTGGGG + Intergenic
933153353 2:78941507-78941529 TAAAGCTGAATTTCACCCTGTGG + Intergenic
933336202 2:80962957-80962979 TACCACTGTATTCCAGCCTAGGG + Intergenic
933448683 2:82416577-82416599 TGCCACTGCATTCCAGCCTGGGG + Intergenic
933848112 2:86342217-86342239 TGCCACTGCATTCCAGCCTGGGG - Intergenic
934504839 2:94881576-94881598 TGCCACTGCACTTCAGCCTGAGG - Intergenic
935064910 2:99638986-99639008 TAAAACTGAATTTCACCCGGAGG + Intronic
935371573 2:102352316-102352338 TACAACTGACATTCTGCCTGAGG - Intronic
935740527 2:106143619-106143641 GACACCTTGATTTCTGCCTGGGG - Intronic
935819094 2:106876004-106876026 TTCCAGTGCATTTCAGCCTGGGG - Intronic
936372055 2:111910309-111910331 TGCCACTGCATTCCAGCCTGGGG - Intronic
936475832 2:112838985-112839007 TACCACTGCACTCCAGCCTGGGG - Intergenic
936847312 2:116852937-116852959 TACTACTGCACTCCAGCCTGAGG - Intergenic
937194991 2:120145902-120145924 TACCACTGCACTCCAGCCTGGGG + Intronic
937557270 2:123174003-123174025 TGCCACTGGACTTCTGCCTGGGG - Intergenic
937704511 2:124904010-124904032 TGCAACTGCACTCCAGCCTGGGG + Intronic
937999491 2:127720604-127720626 TACCACTGCATTCCAGCTTGGGG - Intronic
938294383 2:130168380-130168402 TACCACTGCACTCCAGCCTGGGG + Intronic
938530159 2:132176747-132176769 CACCACTGCATTTCAGTCTGGGG + Intronic
938552163 2:132392352-132392374 CACCACTGCATTCCAGCCTGGGG + Intergenic
938630292 2:133159369-133159391 CAAAACTTGATTTCAGCCTTGGG + Intronic
938890991 2:135705592-135705614 CACCACTGCATTCCAGCCTGAGG + Intronic
939020843 2:136956719-136956741 TGCAACTGCACTCCAGCCTGGGG - Intronic
939585021 2:143993663-143993685 AACACCTTGATTTCAGCCTGGGG + Intronic
939673301 2:145041023-145041045 TACCACTGCACTCCAGCCTGGGG - Intergenic
940188207 2:151010182-151010204 TACCACTGCACTCCAGCCTGGGG - Intronic
941118192 2:161496297-161496319 TGCTACTGCATTCCAGCCTGGGG - Intronic
941498033 2:166231591-166231613 TGCAACTGCACTCCAGCCTGGGG - Intronic
941805223 2:169705606-169705628 CACCACTGCACTTCAGCCTGGGG + Intronic
941825971 2:169897538-169897560 TACCACTGCACTCCAGCCTGGGG - Intronic
941961389 2:171257099-171257121 CACCACTGCATTCCAGCCTGGGG + Intergenic
942031851 2:171970809-171970831 AACAACTGCATTGCAGCCAGGGG - Intronic
942258217 2:174128693-174128715 CACCACTGCATTCCAGCCTGGGG + Intronic
942285793 2:174414803-174414825 TGCCACTGCATTCCAGCCTGGGG - Intronic
942738900 2:179150181-179150203 TGCCACTGCATTTCAGCCTGGGG + Intronic
942913852 2:181278400-181278422 AACCTCTGCATTTCAGCCTGGGG + Intergenic
944682869 2:202092702-202092724 TACCACTGGATCTCCTCCTGAGG + Intronic
944728030 2:202491463-202491485 TGCCACTGTACTTCAGCCTGGGG - Intronic
944770494 2:202909834-202909856 TGCAACTGCACTCCAGCCTGGGG - Intronic
945722770 2:213439080-213439102 AACACCTTGATTTCAGCCTGGGG + Intronic
946232785 2:218302979-218303001 CACAACTGCACTCCAGCCTGGGG - Intronic
946655059 2:221937508-221937530 TGCCACTGCATTTCAGCGTGGGG - Intergenic
946934822 2:224709128-224709150 TACCACTGCACTCCAGCCTGGGG - Intergenic
946938534 2:224746940-224746962 CACCACTGCATTCCAGCCTGGGG - Intergenic
947164727 2:227250269-227250291 TACCACTGCACTCCAGCCTGAGG + Intronic
947665685 2:231904143-231904165 GAGAACAGGATGTCAGCCTGGGG + Intergenic
947759133 2:232590654-232590676 TACCACTGTACTGCAGCCTGGGG - Intergenic
948019090 2:234715590-234715612 CACCACTGCATTCCAGCCTGGGG + Intergenic
948102886 2:235389402-235389424 TGCCACTGCATTCCAGCCTGGGG + Intergenic
948974000 2:241451794-241451816 TACCACTGCACTCCAGCCTGGGG - Intronic
1168850290 20:972104-972126 TGCCACTGCACTTCAGCCTGGGG - Intronic
1169044347 20:2524267-2524289 TACCACTGCACTCCAGCCTGGGG + Intronic
1169460718 20:5792459-5792481 TGCCACTGTACTTCAGCCTGAGG - Intronic
1169460989 20:5795195-5795217 CACCACTGTACTTCAGCCTGAGG + Intronic
1169555981 20:6750375-6750397 TGCCACTGCATTCCAGCCTGAGG + Intergenic
1169693732 20:8363280-8363302 GACATCTTGATTTCAGCCTTAGG - Intronic
1170380877 20:15758579-15758601 TGCCACTGCACTTCAGCCTGAGG - Intronic
1170671318 20:18436400-18436422 TACCACTGCACTCCAGCCTGGGG + Intronic
1171528127 20:25831925-25831947 TACCACTGCACTCCAGCCTGGGG - Intronic
1171548699 20:26023953-26023975 TACCACTGCACTCCAGCCTGGGG + Intergenic
1171969296 20:31553656-31553678 TATAACTGGATTTCATCCATAGG - Intronic
1172041289 20:32048076-32048098 TACCACTGTACTCCAGCCTGGGG - Intergenic
1172543992 20:35745126-35745148 TGCCACTGCACTTCAGCCTGTGG - Intergenic
1172690647 20:36787267-36787289 TACCACTGCACTCCAGCCTGGGG - Intronic
1172708503 20:36901382-36901404 TGCCACTGCACTTCAGCCTGGGG + Intronic
1172731458 20:37092377-37092399 TACCACTGCACTCCAGCCTGGGG - Intronic
1172953125 20:38734914-38734936 CACCACTGCATTCCAGCCTGGGG + Intergenic
1173428796 20:42967549-42967571 GACACCTTGATTTCAGACTGTGG + Intronic
1173571231 20:44077625-44077647 CACCACTGCATTCCAGCCTGGGG + Intergenic
1173612876 20:44383591-44383613 TACCACTGCACTCCAGCCTGGGG - Intronic
1174144814 20:48444822-48444844 TACCACTGCACTCCAGCCTGGGG + Intergenic
1174301134 20:49583340-49583362 CACCACTGCATTCCAGCCTGGGG + Intergenic
1174559328 20:51418702-51418724 TACCACTGCACTCCAGCCTGGGG - Intronic
1174769548 20:53285666-53285688 TGCCACTGCATTTCAGCCTGGGG + Intronic
1174971320 20:55278927-55278949 GACTCCTTGATTTCAGCCTGTGG + Intergenic
1175100030 20:56572678-56572700 TACCACTGCATTCCAGCCTGAGG + Intergenic
1175146499 20:56900591-56900613 CACCACTGCACTTCAGCCTGGGG - Intergenic
1175271668 20:57738425-57738447 AATACCTTGATTTCAGCCTGGGG - Intergenic
1175525400 20:59630222-59630244 TACCACTGCACTCCAGCCTGGGG - Intronic
1175687080 20:61039425-61039447 TGCCATTGCATTTCAGCCTGGGG - Intergenic
1175851466 20:62096317-62096339 TGCCACTGCATTGCAGCCTGGGG + Intergenic
1176196740 20:63840268-63840290 TGCAACTGCACTCCAGCCTGGGG + Intergenic
1176407930 21:6431687-6431709 TGCCACTGTACTTCAGCCTGGGG - Intergenic
1176621222 21:9063635-9063657 TGCCACTGCATTTCAGCCTGAGG + Intergenic
1176818795 21:13635499-13635521 TACCACTGAACTCCAGCCTGGGG - Intronic
1177350729 21:19938083-19938105 TTCAACTGGGTTTCAGGCTTGGG + Intergenic
1177474860 21:21607066-21607088 CACCACTGCATTCCAGCCTGGGG - Intergenic
1177626918 21:23673903-23673925 CGCCACTGCATTTCAGCCTGGGG - Intergenic
1177797897 21:25798381-25798403 TGTCACTGCATTTCAGCCTGGGG - Intergenic
1178270857 21:31188614-31188636 CACCACTGCATTCCAGCCTGGGG - Intronic
1178382987 21:32126904-32126926 CACCACTGCATTCCAGCCTGGGG + Intergenic
1178987971 21:37325076-37325098 CACCACTGCATTCCAGCCTGGGG - Intergenic
1179050611 21:37885759-37885781 AACACCTTGATTTCAGCCTTGGG + Intronic
1179062544 21:37992456-37992478 AACAACTGGCTTTGAGCCTCTGG + Intronic
1179224439 21:39441262-39441284 CACAACTACATTCCAGCCTGAGG + Intronic
1179475921 21:41644381-41644403 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1179663681 21:42894171-42894193 TACCACTGCACTCCAGCCTGGGG + Intronic
1180430913 22:15249534-15249556 CACCACTGCATTTCAGTCTGGGG - Intergenic
1180721963 22:17916013-17916035 CACCACTGCATTCCAGCCTGGGG + Intronic
1181113637 22:20617211-20617233 TGCCACTGTACTTCAGCCTGGGG + Intergenic
1181141510 22:20808718-20808740 TACCACTGCATTCCAGCCTGGGG - Intronic
1182135804 22:27901840-27901862 CACCACTGTACTTCAGCCTGGGG + Intronic
1182213588 22:28697609-28697631 TGCCACTGCACTTCAGCCTGGGG - Intronic
1182270925 22:29152785-29152807 CAAAACTGGGATTCAGCCTGGGG + Intronic
1183089914 22:35515014-35515036 TTCTACTGCATTCCAGCCTGGGG + Intergenic
1183824538 22:40374841-40374863 TACCACTGCACTCCAGCCTGGGG + Intronic
1183900336 22:41001029-41001051 TGCCACTGGACTCCAGCCTGGGG - Intergenic
1184474313 22:44712311-44712333 CAGAGCTGGATCTCAGCCTGTGG + Intronic
1184526261 22:45025141-45025163 CACCACTGCATTCCAGCCTGGGG + Intergenic
949287147 3:2420475-2420497 TGCCACTGGACTCCAGCCTGGGG - Intronic
950320731 3:12050385-12050407 TACCACTGCACTCCAGCCTGGGG - Intronic
951179714 3:19644843-19644865 TGCACCTGGATTTCTGCCTCAGG + Intergenic
951377697 3:21941537-21941559 TGCCACTGCATTCCAGCCTGCGG - Intronic
951472422 3:23070734-23070756 TACCACTGCACTCCAGCCTGGGG - Intergenic
951535521 3:23737106-23737128 TGCCACTGCATTGCAGCCTGGGG - Intergenic
952246098 3:31594469-31594491 CACCACTGCATTCCAGCCTGTGG - Intronic
952564023 3:34633884-34633906 TACCACTGCATTCTAGCCTGGGG + Intergenic
952676950 3:36044026-36044048 TACATCTGCACTCCAGCCTGGGG - Intergenic
953617624 3:44505524-44505546 CACCACTGCATTCCAGCCTGGGG + Intronic
953869483 3:46613958-46613980 TACCACTGCACTCCAGCCTGGGG - Intronic
953988004 3:47460592-47460614 TGCCACTGCACTTCAGCCTGGGG - Intronic
954010068 3:47628612-47628634 TGCCACTGCATTCCAGCCTGGGG - Intronic
954026211 3:47785307-47785329 TACCACTGCACTCCAGCCTGGGG + Intergenic
954070039 3:48136276-48136298 CACCACTGCATTCCAGCCTGGGG - Intergenic
954184670 3:48907712-48907734 TGCTACTGCATTCCAGCCTGGGG - Intergenic
954504509 3:51056288-51056310 TGCCACTGCATTCCAGCCTGGGG - Intronic
954837316 3:53481110-53481132 CACCACTGCATTCCAGCCTGAGG + Intergenic
955144135 3:56299469-56299491 TGCCACTGCACTTCAGCCTGGGG - Intronic
955273510 3:57525802-57525824 TGCCACTGTATTCCAGCCTGGGG - Intronic
955654705 3:61232343-61232365 TGCCACTGCACTTCAGCCTGAGG + Intronic
955703650 3:61706533-61706555 TGCCATTGCATTTCAGCCTGGGG - Intronic
955810774 3:62786169-62786191 TGCCACTGCATTCCAGCCTGGGG + Intronic
955914649 3:63894564-63894586 TGCAACTGTACTCCAGCCTGGGG - Intronic
956794181 3:72703128-72703150 TAAAACTGACTTTTAGCCTGGGG + Intergenic
956814460 3:72895129-72895151 TGCAACTGTATTTCTGCCAGTGG + Intronic
957294018 3:78312641-78312663 TACCACTGCATTCCAGCCTGGGG + Intergenic
959502583 3:107123781-107123803 TGCTACTGCATTCCAGCCTGGGG + Intergenic
959967408 3:112372748-112372770 TACAACTTAATTTAATCCTGAGG + Intergenic
959992582 3:112645320-112645342 TACCACTGCACTCCAGCCTGGGG - Intronic
960031497 3:113059027-113059049 CACCACTGCATTCCAGCCTGGGG + Intergenic
961784984 3:129342231-129342253 CACCACTGCACTTCAGCCTGGGG - Intergenic
962617206 3:137138487-137138509 CACCACTGCATTCCAGCCTGGGG + Intergenic
963557608 3:146812757-146812779 TACCACTGCACTTCAGCCTGGGG - Intergenic
963813872 3:149808530-149808552 TACCACTGCACTCCAGCCTGGGG - Intronic
963815463 3:149825664-149825686 GAAAACTGAATTTCAGCCTCAGG + Intronic
964194478 3:154046669-154046691 TACCACTGCACTCCAGCCTGGGG + Intergenic
964555952 3:157939041-157939063 CACTACTGGACTCCAGCCTGGGG - Intergenic
964647664 3:158975276-158975298 TCCAAATGGATTCCAACCTGGGG - Intronic
964702309 3:159582210-159582232 TACCACTGCACTTCAGCCTGGGG - Intronic
965036786 3:163450210-163450232 TAACACTGCACTTCAGCCTGGGG + Intergenic
965071025 3:163915300-163915322 TGCCACTGCACTTCAGCCTGGGG + Intergenic
965469271 3:169070597-169070619 TGCCACTGCACTTCAGCCTGGGG + Intergenic
965511520 3:169573053-169573075 TTCAGCTGTATTTCAGCTTGTGG - Intronic
965516841 3:169630492-169630514 TACCACTGTATTTCAGCCTGGGG - Intronic
965522020 3:169677788-169677810 TTCAAGTGGATTTCAGCTTCCGG + Intergenic
965542875 3:169888189-169888211 CACCACTGCACTTCAGCCTGGGG - Intergenic
965695996 3:171408757-171408779 TACCACTGGGGTTCAGCCAGAGG - Intronic
966222666 3:177566115-177566137 TAAACCTGGATTTCTGCCTCAGG + Intergenic
966532174 3:180993262-180993284 TGCCACTGCACTTCAGCCTGGGG - Intergenic
966954908 3:184865944-184865966 TGCCACTGGACTCCAGCCTGGGG + Intronic
967111262 3:186296065-186296087 TACCACTGCACTCCAGCCTGGGG + Intronic
968191254 3:196669221-196669243 TGCAACTGCACTCCAGCCTGGGG - Intronic
968252334 3:197231656-197231678 CACCACTGTATTCCAGCCTGGGG + Intronic
968708316 4:2094319-2094341 TGCCACTGCATTCCAGCCTGGGG + Intronic
968734147 4:2286511-2286533 AGCACCTGGATTTCAGCCTGGGG + Intronic
968779210 4:2566644-2566666 CACCACTGCATTCCAGCCTGGGG + Intronic
969156041 4:5210835-5210857 CACCACTGCATTCCAGCCTGGGG - Intronic
969553589 4:7890310-7890332 AACAACTGGATGTCAGTATGGGG + Intronic
969620411 4:8276052-8276074 TAGACCTGGCTTTCAGCTTGGGG - Intronic
969693010 4:8716549-8716571 TACCACTGCACTCCAGCCTGGGG + Intergenic
970695495 4:18672188-18672210 TACCACTGCACTCCAGCCTGGGG - Intergenic
970807493 4:20053635-20053657 CACCACTGCATTCCAGCCTGGGG - Intergenic
970884324 4:20969981-20970003 CACAACTGCACTCCAGCCTGGGG - Intronic
971241369 4:24891955-24891977 TGCCACTGCATTCCAGCCTGGGG + Intronic
971328173 4:25661427-25661449 TGCCACTGTATTCCAGCCTGGGG - Intronic
971589262 4:28446013-28446035 TGCCACTGCACTTCAGCCTGGGG + Intergenic
972015725 4:34242430-34242452 TACATCTTGATTGCAGCCTTAGG + Intergenic
972428000 4:38953078-38953100 TACCACTGAATTCCAGCCTGGGG + Intergenic
972492588 4:39601903-39601925 CACCACTGCATTTCAGCCTGGGG + Intronic
972522490 4:39872607-39872629 TGCCACTGCATTCCAGCCTGAGG + Intronic
972956659 4:44400685-44400707 TGCCACTGGACTCCAGCCTGGGG + Intronic
973685997 4:53370624-53370646 TGCCACTGCATTCCAGCCTGGGG - Intergenic
973999885 4:56501387-56501409 TGCCACTGCATTCCAGCCTGAGG + Intronic
974048331 4:56916057-56916079 TGCAACTGCACTCCAGCCTGGGG + Intronic
974064041 4:57061013-57061035 AGCCACTGGATTGCAGCCTGGGG + Intronic
974310109 4:60194908-60194930 TTCATCTAGATTTCAGCCTAAGG + Intergenic
974731491 4:65872280-65872302 TGCCACTGCATTGCAGCCTGGGG + Intergenic
975262485 4:72320020-72320042 TACAACTGGACTTTTGCCTAGGG + Intronic
975423451 4:74196902-74196924 TACCACTGCACTCCAGCCTGGGG + Intronic
975568020 4:75780687-75780709 TACCACTGCATTCCAGCCTGGGG - Intronic
975671964 4:76788900-76788922 CACCACTGCATTCCAGCCTGGGG + Intergenic
975811865 4:78178006-78178028 AACACCTTGATTTCAGACTGTGG - Intronic
976683561 4:87785482-87785504 TGCCATTGCATTTCAGCCTGGGG + Intergenic
977316652 4:95457895-95457917 AACAACTTAATTTTAGCCTGAGG + Intronic
977660999 4:99586024-99586046 CACAACTTAATTTGAGCCTGTGG - Intronic
977784355 4:101015645-101015667 TACCACTGCACTCCAGCCTGGGG - Intergenic
977806992 4:101311736-101311758 TGCCACTGCACTTCAGCCTGGGG + Intronic
978106313 4:104905783-104905805 TACAATGCTATTTCAGCCTGAGG + Intergenic
978245733 4:106570333-106570355 TAAAATTAGATCTCAGCCTGAGG - Intergenic
978426524 4:108588444-108588466 CACCACTGCATTCCAGCCTGGGG + Intergenic
978461280 4:108956215-108956237 TGTAACTGGATTTCAGCAAGTGG + Intronic
978807609 4:112816967-112816989 TGCCACTGCACTTCAGCCTGGGG + Intergenic
979541979 4:121894603-121894625 TACAACTGCACTCCAGCCTAGGG - Intronic
979586345 4:122422908-122422930 CACCACTGCACTTCAGCCTGGGG + Intronic
980125516 4:128770448-128770470 CACCACTGTATTCCAGCCTGGGG + Intergenic
980522090 4:133948399-133948421 TACCACCAGATATCAGCCTGGGG + Intergenic
980932612 4:139196058-139196080 TACCACTGTACTCCAGCCTGGGG - Intergenic
981094840 4:140768435-140768457 TATCACTGCATTCCAGCCTGGGG - Intergenic
981405478 4:144362392-144362414 CACCACTGTATTCCAGCCTGGGG + Intergenic
981426208 4:144606378-144606400 TTCAACTGGATTCCAACCTGGGG - Intergenic
981556014 4:145995340-145995362 TACCACTGTATTCCAGCCTAGGG - Intergenic
981703967 4:147640112-147640134 TACTACTGCACTCCAGCCTGGGG - Intronic
982384510 4:154786126-154786148 TGCCACTGCATTCCAGCCTGGGG - Intronic
982870409 4:160573211-160573233 TACCACTGAATTTAAGCCTTAGG - Intergenic
983410255 4:167387193-167387215 TACCACTATACTTCAGCCTGGGG + Intergenic
983754444 4:171317479-171317501 AGCACCTGGATTTCAGCATGGGG - Intergenic
983880832 4:172930721-172930743 CACCACTGCACTTCAGCCTGGGG - Intronic
983913099 4:173261775-173261797 TGCCACTGTACTTCAGCCTGGGG + Intronic
984452759 4:179924356-179924378 TGCCACTGCACTTCAGCCTGGGG + Intergenic
985182457 4:187280044-187280066 TTCACCTGGATGTCACCCTGTGG + Intergenic
985283673 4:188312430-188312452 CACAACTGCACTCCAGCCTGGGG - Intergenic
986499205 5:8380708-8380730 CACCACTGCACTTCAGCCTGAGG - Intergenic
986788699 5:11139815-11139837 AACACCTTGATTTCAGCCTGTGG - Intronic
986893381 5:12336051-12336073 CATAACTCGATTTTAGCCTGAGG - Intergenic
987294453 5:16537654-16537676 TACCACTGCACTCCAGCCTGGGG + Intronic
987391707 5:17382287-17382309 CACACCTTGATTGCAGCCTGCGG + Intergenic
988315675 5:29623687-29623709 TACCACTGCACTCCAGCCTGGGG - Intergenic
988359090 5:30212328-30212350 TACAAATGGTGTTGAGCCTGTGG + Intergenic
988379425 5:30481125-30481147 TCCATCTGGTTTTGAGCCTGTGG - Intergenic
988451695 5:31350429-31350451 CACCACTGCACTTCAGCCTGAGG + Intergenic
989030056 5:37109696-37109718 CACCACTGCATTCCAGCCTGGGG - Intronic
989445009 5:41517382-41517404 TAGAACTGCAGTTCAGCCTCTGG + Intergenic
989479559 5:41914413-41914435 CACCACTGCATTCCAGCCTGGGG + Intronic
991352546 5:65733759-65733781 TGCCACTGCACTTCAGCCTGAGG - Intronic
991689688 5:69214126-69214148 TACCACTGCACTTCAGCCTGGGG - Intergenic
992656142 5:78911530-78911552 CACAACTGCACTCCAGCCTGGGG + Intronic
993159869 5:84276258-84276280 TAAAACTGGATTGCAGCAAGAGG - Intronic
993276590 5:85867758-85867780 CACCACTGCACTTCAGCCTGGGG - Intergenic
994037979 5:95224547-95224569 TGCCACTGCATTCCAGCCTGGGG - Intronic
994243382 5:97450075-97450097 CACCACTGCATTCCAGCCTGGGG - Intergenic
994369675 5:98954176-98954198 TACCACTGCACTCCAGCCTGGGG - Intergenic
994542903 5:101122262-101122284 TAGAACTGGGTTTCAGGCAGAGG - Intergenic
994689986 5:103005974-103005996 TGCCACTGCATTCCAGCCTGAGG - Intronic
995494272 5:112725023-112725045 TGCCACTGCACTTCAGCCTGGGG - Intronic
995579242 5:113577409-113577431 CACCACTGTACTTCAGCCTGAGG - Intronic
996699557 5:126436608-126436630 TGCCACTGCACTTCAGCCTGAGG + Intronic
998118547 5:139558044-139558066 TACCACTGCACTCCAGCCTGAGG + Intronic
998297398 5:140984977-140984999 TGCCACTGGACTCCAGCCTGGGG - Intronic
998306537 5:141083208-141083230 CACCACTGCACTTCAGCCTGGGG - Intergenic
998335169 5:141365205-141365227 TCCAACTTGATTCCAACCTGGGG + Exonic
998339068 5:141400165-141400187 TAAAACTGCAGCTCAGCCTGGGG - Exonic
998340176 5:141410252-141410274 TAAAACTGCAGTTCAGCCTGGGG - Exonic
998455707 5:142271206-142271228 CACCACTGCACTTCAGCCTGAGG + Intergenic
998739449 5:145182109-145182131 CACCACTGCATTCCAGCCTGGGG + Intergenic
998966017 5:147540895-147540917 TGCCACTGTATTTCAGCCTAAGG - Intergenic
1000623237 5:163508657-163508679 CACAACTGCACTCCAGCCTGGGG - Intronic
1000677483 5:164139428-164139450 TAGGACTGGCTATCAGCCTGCGG + Intergenic
1000887004 5:166758882-166758904 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1001555742 5:172635991-172636013 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1001620122 5:173076712-173076734 CACCACTGCATTCCAGCCTGGGG + Intronic
1001977504 5:176012159-176012181 AACAACTGGATTTCCACATGCGG + Intronic
1002112174 5:176924274-176924296 TACCACTGCACTCCAGCCTGGGG + Intronic
1002129204 5:177069570-177069592 CACCACTGCATTCCAGCCTGGGG - Intronic
1002239919 5:177831610-177831632 AACAACTGGATTTCCACATGCGG - Intergenic
1002349807 5:178576278-178576300 TGCCACTGGACTCCAGCCTGGGG - Intronic
1002629992 5:180566699-180566721 TGCCACTGCATTCCAGCCTGGGG - Intronic
1002991555 6:2243899-2243921 TACCACTGTACTCCAGCCTGGGG - Intronic
1004230784 6:13831198-13831220 CACAACTGCACTCCAGCCTGGGG - Intergenic
1005081191 6:21958270-21958292 CACCACTGCATTCCAGCCTGGGG - Intergenic
1005085788 6:22005392-22005414 TACCACTGCACTCCAGCCTGGGG - Intergenic
1005964207 6:30715376-30715398 TACCACTGCATGCCAGCCTGGGG - Intronic
1006081604 6:31571100-31571122 CACCACTGTATTCCAGCCTGGGG - Intergenic
1006538732 6:34721986-34722008 TACCACTGCACTCCAGCCTGGGG - Intergenic
1006589607 6:35144590-35144612 TACCACTGCACTCCAGCCTGGGG - Intronic
1006721185 6:36152676-36152698 TACCACTGTACTCCAGCCTGGGG - Intergenic
1006757492 6:36429222-36429244 CACCACTGCATTCCAGCCTGGGG + Intronic
1006766723 6:36513059-36513081 TACCACTGCACTTTAGCCTGGGG - Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007586726 6:42995170-42995192 TACCACTGTACTCCAGCCTGGGG - Intronic
1007586811 6:42995755-42995777 TACCACTGTACTCCAGCCTGGGG - Intronic
1007688524 6:43682255-43682277 TGCCACTGCATTCCAGCCTGAGG + Intronic
1008208232 6:48688292-48688314 TTCCACTGCATTCCAGCCTGGGG + Intergenic
1008220677 6:48850834-48850856 TGCCACTGTATTCCAGCCTGAGG - Intergenic
1008236350 6:49056557-49056579 TAAAATTGGATTTCAGACTTTGG + Intergenic
1008645691 6:53511988-53512010 TGCCACTGCATTCCAGCCTGGGG - Intronic
1009636356 6:66269648-66269670 TACCACTGCACTCCAGCCTGGGG + Intergenic
1010026005 6:71217961-71217983 TAAAACAGGTTTTCTGCCTGGGG + Intergenic
1010779222 6:79924791-79924813 TACCACTGCACTTCAGTCTGGGG + Intronic
1010861180 6:80914229-80914251 CACCACTGCATTCCAGCCTGGGG - Intergenic
1010920965 6:81680115-81680137 TATCACTGCATTCCAGCCTGGGG + Intronic
1011087818 6:83561982-83562004 CACCACTGTACTTCAGCCTGTGG + Intronic
1011212811 6:84972340-84972362 TGCCACTGCACTTCAGCCTGTGG - Intergenic
1011383401 6:86767148-86767170 TCCAACTAGCCTTCAGCCTGGGG - Intergenic
1011424384 6:87210736-87210758 TGCCACTGCATTCCAGCCTGGGG + Intronic
1011818684 6:91224452-91224474 TACCACTGTACTTCAGCCTGGGG - Intergenic
1011895502 6:92219377-92219399 TACCACTGCACTCCAGCCTGGGG + Intergenic
1012470242 6:99564381-99564403 TACCACTGCACTCCAGCCTGGGG + Intronic
1012535063 6:100285771-100285793 TGCAACTTGATTTCATACTGTGG - Intergenic
1012960564 6:105617315-105617337 TACCACTGCACTCCAGCCTGGGG - Intergenic
1013168548 6:107615978-107616000 TACCACTGCACTCCAGCCTGGGG + Intronic
1015073149 6:129122347-129122369 TGCAACTGGATTTCGTTCTGGGG + Intronic
1015420570 6:133003234-133003256 TAAAACAGAATTTCTGCCTGTGG - Intergenic
1015601818 6:134917802-134917824 TTCCACTGCATTTCAGCCTGGGG - Exonic
1016318688 6:142818625-142818647 CACAACTGCATTCTAGCCTGGGG + Intronic
1017212347 6:151870891-151870913 TGCCACTGCACTTCAGCCTGGGG - Intronic
1017449369 6:154540005-154540027 TACCACTGCACTCCAGCCTGGGG + Intergenic
1017713976 6:157195220-157195242 GACACCTTGATTTTAGCCTGTGG - Intronic
1017723595 6:157261563-157261585 TACCACTGCACTCCAGCCTGGGG + Intergenic
1018132544 6:160746609-160746631 TAGAACTGGAATTCAGACTATGG - Intronic
1018254221 6:161902599-161902621 TACCACTGCACTCCAGCCTGGGG - Intronic
1018293105 6:162313527-162313549 CACCATTGGATTCCAGCCTGGGG - Intronic
1019530606 7:1501241-1501263 TGCCACTGCATTCCAGCCTGGGG + Intronic
1020164380 7:5796553-5796575 TACCACTGCACTCCAGCCTGGGG - Intergenic
1020220522 7:6233085-6233107 GACAACTGGAATGCAGCCTGGGG - Intronic
1021454497 7:20814671-20814693 CACCACTGCATTCCAGCCTGGGG + Intergenic
1021657018 7:22882651-22882673 GACAGCTGGATTGCACCCTGTGG - Intergenic
1021727169 7:23559474-23559496 TACCACTGCACTCCAGCCTGGGG - Intergenic
1021932782 7:25598128-25598150 GACATCTGGATTTCTGCCTGAGG + Intergenic
1022005172 7:26260846-26260868 TACCACTGCACTCCAGCCTGGGG - Intergenic
1022189621 7:28004692-28004714 TGCCACTGCATTCCAGCCTGAGG - Intronic
1022713503 7:32875311-32875333 TACCACTGCACTCCAGCCTGGGG - Intronic
1023318574 7:38968288-38968310 TGCAACTGCACTCCAGCCTGGGG + Intergenic
1023506309 7:40903071-40903093 CACCACTGCATTTCAGCCTGGGG - Intergenic
1024919091 7:54538252-54538274 TACATCTGGCTTTCATTCTGTGG - Intergenic
1025212689 7:57029695-57029717 CACAACTGCACTCCAGCCTGGGG - Intergenic
1025659264 7:63547129-63547151 CACAACTGCACTCCAGCCTGGGG + Intergenic
1025894526 7:65687413-65687435 CACCACTGCATTCCAGCCTGGGG - Intergenic
1025993916 7:66516145-66516167 CACCCCTGCATTTCAGCCTGGGG + Intergenic
1026046871 7:66911905-66911927 TACCACTGCACTCCAGCCTGGGG - Intergenic
1026293598 7:69030607-69030629 CACTACTGCACTTCAGCCTGGGG + Intergenic
1026304864 7:69131976-69131998 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1026424556 7:70277167-70277189 GACAACTGGATTTCAGACCTAGG + Intronic
1026536480 7:71242634-71242656 TACATCTGCATTCCAGCCTGTGG - Intronic
1026547735 7:71338479-71338501 CACCACTGCATTCCAGCCTGAGG + Intronic
1026607156 7:71825989-71826011 TACCACTGCACTCCAGCCTGGGG + Intronic
1026985123 7:74550152-74550174 CACTCCTGCATTTCAGCCTGGGG + Intronic
1026993053 7:74598572-74598594 CACTACTGTACTTCAGCCTGGGG + Intronic
1026993971 7:74604074-74604096 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1027373096 7:77527954-77527976 TACTACTGTACTCCAGCCTGGGG + Intergenic
1027397847 7:77774693-77774715 TGCCACTGCACTTCAGCCTGGGG + Intronic
1027851337 7:83455931-83455953 AACACCTTGATTTCAGCCTTGGG + Intronic
1028214111 7:88110782-88110804 TACCACTGCACTTCAGCCTGTGG - Intronic
1028675548 7:93456580-93456602 TATAAATTCATTTCAGCCTGAGG + Intronic
1029096805 7:98091722-98091744 CACCACTGCATTCCAGCCTGAGG - Intergenic
1029229850 7:99057644-99057666 CACAACTGCACTCCAGCCTGGGG - Intronic
1029570406 7:101364609-101364631 CACCACTGCATTCCAGCCTGGGG - Intronic
1029670212 7:102024960-102024982 GACACCTTGATTCCAGCCTGGGG - Intronic
1029840445 7:103357282-103357304 TGCCACTGCACTTCAGCCTGGGG + Intronic
1030386332 7:108871917-108871939 TGCAACTGCACTCCAGCCTGAGG - Intergenic
1031608236 7:123794631-123794653 TACATGTGGTTTTGAGCCTGTGG + Intergenic
1031818769 7:126472910-126472932 TATAAATGGTGTTCAGCCTGTGG + Intronic
1033054378 7:138035988-138036010 TACTACTGCACTCCAGCCTGTGG + Intronic
1033074301 7:138234216-138234238 TGCCACTGTATTCCAGCCTGAGG + Intergenic
1033124559 7:138696462-138696484 TACCATTGCATTCCAGCCTGGGG - Intronic
1033271145 7:139934228-139934250 CACAACTGCACTCCAGCCTGGGG - Intronic
1033894233 7:146052405-146052427 TACCACTAGACATCAGCCTGGGG + Intergenic
1033952952 7:146808173-146808195 TACAACTGTGTTTCTGCCTTAGG + Intronic
1034819178 7:154201167-154201189 CACCACTGCATTCCAGCCTGGGG - Intronic
1034894881 7:154870019-154870041 TACCACTGCATTCTAGCCTGGGG - Intronic
1035590450 8:808946-808968 TACTACTGCACTTCAGCCTGGGG - Intergenic
1035906466 8:3515841-3515863 GAAAACTGGACTTCAGCGTGGGG + Intronic
1036027776 8:4929027-4929049 CACCACTGCATTCCAGCCTGGGG + Intronic
1036067236 8:5395605-5395627 TACCACTGCACTCCAGCCTGGGG - Intergenic
1036089625 8:5651226-5651248 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1036162392 8:6401894-6401916 CACCACTGCATTCCAGCCTGGGG - Intergenic
1036307858 8:7615022-7615044 TACAACTGGCTCTCAGCAGGGGG + Intergenic
1036521708 8:9497995-9498017 TGCAGCTTGATTTCTGCCTGTGG - Intergenic
1037002328 8:13734978-13735000 TGCCACTGCATTCCAGCCTGAGG - Intergenic
1037030749 8:14101933-14101955 TACCACTGCACTCCAGCCTGGGG - Intronic
1037274382 8:17161816-17161838 CACCACTGCACTTCAGCCTGGGG + Intronic
1038012250 8:23484464-23484486 CACCACTGCATTCCAGCCTGGGG - Intergenic
1038040500 8:23720235-23720257 TGCCACTGCACTTCAGCCTGGGG + Intergenic
1038183321 8:25249038-25249060 TGCCACTGCATTCCAGCCTGGGG - Intronic
1038286878 8:26213104-26213126 GATAATTGGACTTCAGCCTGAGG - Intergenic
1038497636 8:28015052-28015074 CTTAACTGCATTTCAGCCTGTGG - Intergenic
1038641521 8:29332763-29332785 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1038746947 8:30262988-30263010 TACCACTGCACTCCAGCCTGGGG - Intergenic
1038747396 8:30266500-30266522 TGCCACTGGGTTCCAGCCTGGGG + Intergenic
1038942917 8:32325421-32325443 TGCCACTGCACTTCAGCCTGGGG - Intronic
1039158089 8:34585385-34585407 CACCACTGCATTCCAGCCTGGGG + Intergenic
1039201364 8:35096852-35096874 TACCACTGCACTCCAGCCTGGGG + Intergenic
1039327132 8:36498010-36498032 TACCACTGCACTCCAGCCTGGGG - Intergenic
1039486602 8:37915063-37915085 TGCTACTGCATTCCAGCCTGGGG + Intergenic
1039492022 8:37955018-37955040 GACATCTTGATTGCAGCCTGGGG - Intergenic
1039553872 8:38462944-38462966 CACCACTGCATTCCAGCCTGGGG - Intronic
1039818188 8:41113250-41113272 TACCATTGCACTTCAGCCTGGGG + Intergenic
1039868446 8:41526228-41526250 CACCATTGGACTTCAGCCTGAGG + Intergenic
1040439667 8:47427962-47427984 TGCCACTGCATTCCAGCCTGGGG - Intronic
1040445981 8:47494028-47494050 TGCCACTGCATTCCAGCCTGGGG - Intronic
1040506188 8:48050900-48050922 TACCACTGCACTACAGCCTGGGG - Intronic
1040905535 8:52465804-52465826 TACCACTGCACTCCAGCCTGAGG + Intergenic
1041447338 8:57966796-57966818 TACCACTGCACTCCAGCCTGGGG + Intergenic
1041800686 8:61794223-61794245 TGCCACTGCATTCCAGCCTGAGG + Intergenic
1042233407 8:66582674-66582696 CAGCACTGTATTTCAGCCTGGGG + Intronic
1042424184 8:68627220-68627242 TACAACTGGAAATCAGAGTGAGG - Intronic
1042722189 8:71838427-71838449 TACATGTGGATTTCTGACTGTGG + Intronic
1042900150 8:73717058-73717080 TACCACTGCACTCCAGCCTGGGG + Intronic
1044482065 8:92702346-92702368 TGCCACTGGACTCCAGCCTGGGG + Intergenic
1044877593 8:96685060-96685082 TGCCACTGCATTCCAGCCTGGGG + Intronic
1045058139 8:98386914-98386936 TACCACTGCACTGCAGCCTGGGG + Intergenic
1045080920 8:98624979-98625001 TTCAACTGGACTTCATCCTCAGG - Intronic
1045155793 8:99469209-99469231 CACCACTGCACTTCAGCCTGGGG - Intronic
1045213308 8:100121479-100121501 TACACCTGAAATTCAGCTTGGGG + Intronic
1045214470 8:100132930-100132952 TGCCACTGCACTTCAGCCTGAGG + Intergenic
1045278368 8:100727193-100727215 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1045291819 8:100840231-100840253 CACCACTGCATTCCAGCCTGGGG - Intergenic
1045465321 8:102464365-102464387 CACCACTGGACTCCAGCCTGGGG - Intergenic
1045496528 8:102714204-102714226 GACATCTTGATTTCAGCCTTAGG - Intergenic
1045620153 8:103967900-103967922 TGCCACTGCATTGCAGCCTGGGG - Intronic
1045897635 8:107237964-107237986 CACCACTGCATTCCAGCCTGGGG + Intergenic
1046265788 8:111828051-111828073 AACAACTTGATTACAGCCTTAGG - Intergenic
1046920618 8:119724188-119724210 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1046998885 8:120553954-120553976 TGCCACTGGACTCCAGCCTGGGG + Intronic
1047057469 8:121182215-121182237 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1047156124 8:122320643-122320665 TGCCACTGTACTTCAGCCTGGGG - Intergenic
1048893144 8:138965616-138965638 TACCACTGGACTTCACCCTCTGG + Intergenic
1048984295 8:139725499-139725521 TACCACTGCACTCCAGCCTGGGG - Intergenic
1049193410 8:141301691-141301713 CACCACTGGACTCCAGCCTGGGG + Intronic
1049853404 8:144846738-144846760 CACCACTGCACTTCAGCCTGAGG - Intronic
1050084686 9:1952130-1952152 CACTACAGGATTTCAGCCTCAGG - Intergenic
1050327310 9:4509873-4509895 TACCACTGCACTCCAGCCTGGGG - Intronic
1050429764 9:5550733-5550755 TGCCACTGCATTCCAGCCTGGGG - Intronic
1050488225 9:6158385-6158407 TACCACTGCACTCCAGCCTGAGG - Intergenic
1050749391 9:8919348-8919370 TGCCACTGGATTCCAGCCTGTGG + Intronic
1050885153 9:10755097-10755119 TACAACAGGATTTGAACCGGGGG - Intergenic
1051107649 9:13597964-13597986 CACCACTGCATTCCAGCCTGGGG + Intergenic
1051440823 9:17080851-17080873 TACCACTGCACTCCAGCCTGGGG - Intergenic
1051507405 9:17841775-17841797 TGCCACTACATTTCAGCCTGGGG + Intergenic
1051763110 9:20490589-20490611 AACACCTAGATTTCAGCCTCAGG + Intronic
1052419082 9:28218751-28218773 TATAACTGGATTTCTGCCCTGGG + Intronic
1052514988 9:29469329-29469351 CACCACTGCACTTCAGCCTGGGG - Intergenic
1053143251 9:35694725-35694747 CACCACTGCATTCCAGCCTGGGG + Intergenic
1053178710 9:35949194-35949216 CTGAACTGCATTTCAGCCTGTGG + Intergenic
1053215685 9:36268624-36268646 TGCCACTGCATCTCAGCCTGGGG + Intronic
1053494452 9:38540075-38540097 CACCACTGCATTCCAGCCTGGGG + Intergenic
1054771359 9:69087277-69087299 TGCCACTGTATTCCAGCCTGGGG - Intronic
1055196513 9:73600828-73600850 AACACCTTGATTTCAGCCTTGGG - Intergenic
1055541987 9:77319152-77319174 TACCACTGCACTCCAGCCTGGGG + Intronic
1055956438 9:81778090-81778112 TGCCACTGGACTCCAGCCTGGGG - Intergenic
1056265884 9:84896435-84896457 TAGAACTGGGTTACAGCCTTAGG - Intronic
1056960267 9:91117129-91117151 CACCACTGCATTTCGGCCTGGGG - Intergenic
1057144839 9:92751190-92751212 TACCACTGCATTCCAACCTGGGG - Intronic
1057296181 9:93843601-93843623 TACCACTGCACTGCAGCCTGGGG + Intergenic
1057594214 9:96401182-96401204 CGCCACTGGACTTCAGCCTGGGG + Intronic
1057617664 9:96606289-96606311 CACAACTGCACTCCAGCCTGGGG + Intronic
1057669051 9:97072452-97072474 GACACCTGGATTACAGCCTCAGG + Intergenic
1057826193 9:98373897-98373919 TACCACTGTACTCCAGCCTGAGG - Intronic
1058024758 9:100129449-100129471 TACCACTGTATTTCAGCCTGGGG + Intronic
1058157125 9:101528410-101528432 TAAAACTGGATTTCAGCTGAGGG - Intronic
1058731426 9:107853843-107853865 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1058993267 9:110275082-110275104 TACTACTGCATTCCAGCCTGGGG + Intergenic
1059134980 9:111796190-111796212 TGCCACTGCATTCCAGCCTGGGG + Intergenic
1059159189 9:112018123-112018145 TGCCACTGTACTTCAGCCTGGGG - Intergenic
1059328058 9:113516736-113516758 TACCACTGCACTCCAGCCTGGGG - Intronic
1059356469 9:113703060-113703082 TACTACTGCACTCCAGCCTGCGG + Intergenic
1060622345 9:125078860-125078882 TACCACTGTACTCCAGCCTGGGG + Intronic
1061197206 9:129113133-129113155 TGCCACTGCACTTCAGCCTGGGG - Intronic
1061228038 9:129292291-129292313 CACCACTGGACTCCAGCCTGAGG - Intergenic
1061308380 9:129745990-129746012 TGCCATTGCATTTCAGCCTGGGG + Intronic
1061753052 9:132793977-132793999 TTCACCTGGCTGTCAGCCTGGGG - Intronic
1203528562 Un_GL000213v1:114006-114028 TACCACTGAACTCCAGCCTGGGG + Intergenic
1203744432 Un_GL000218v1:34105-34127 TGCCACTGTACTTCAGCCTGAGG + Intergenic
1203565676 Un_KI270744v1:85379-85401 TGCCACTGTACTTCAGCCTGAGG - Intergenic
1185572121 X:1142767-1142789 TGCCACTGGACTCCAGCCTGTGG - Intergenic
1185678560 X:1868812-1868834 TACCACTGGACTCCAGCCTGGGG + Intergenic
1185777682 X:2818427-2818449 TGCCACTGCATTCCAGCCTGAGG + Intergenic
1185824441 X:3236400-3236422 AACACCTTGATTTCAGCCTGGGG - Intergenic
1186007330 X:5087430-5087452 TACCACTGCACTCCAGCCTGGGG - Intergenic
1186476423 X:9861206-9861228 TACAACTGCACTCCAGCCTGGGG - Intronic
1186528583 X:10272497-10272519 TACAACTGGAATAAAGCTTGTGG - Intergenic
1186553528 X:10532493-10532515 CACCACTGGACTCCAGCCTGGGG + Intronic
1187068584 X:15865449-15865471 GACACCTTGATTTCAGCCTTGGG + Intergenic
1187325354 X:18281668-18281690 CACCACTGCATTCCAGCCTGGGG + Intronic
1187601111 X:20831243-20831265 TACTACTGCACTTCAGCCTGGGG + Intergenic
1187903055 X:24042393-24042415 TACCACTGCACTCCAGCCTGGGG - Intergenic
1187909171 X:24094538-24094560 TACCACTGCACTCCAGCCTGGGG - Intergenic
1188178802 X:27027622-27027644 TGCCACTGCACTTCAGCCTGGGG - Intergenic
1189757143 X:44283222-44283244 TACCACTGCACTCCAGCCTGGGG - Intronic
1189910889 X:45809741-45809763 TACCACTGCACTACAGCCTGGGG + Intergenic
1190080877 X:47355924-47355946 TACCACTGCACTCCAGCCTGGGG - Intergenic
1190140463 X:47838826-47838848 CACCACTGCATTCCAGCCTGAGG - Intronic
1190870206 X:54418451-54418473 TGCCACTGGACTCCAGCCTGGGG + Intergenic
1191830687 X:65412507-65412529 TGCCACTGTATTCCAGCCTGGGG - Intronic
1192461923 X:71324297-71324319 TACCACTGCACTCCAGCCTGGGG - Intergenic
1192786960 X:74345331-74345353 AACCACTGCATTCCAGCCTGGGG - Intergenic
1193342482 X:80365797-80365819 TACCACTGCACTCCAGCCTGGGG + Intronic
1193655708 X:84194940-84194962 CGCCACTGGATTCCAGCCTGGGG - Intergenic
1194044314 X:88983064-88983086 TACAACAGAATTGCAGCATGGGG + Intergenic
1194729198 X:97434448-97434470 CACCACTGCACTTCAGCCTGGGG - Intronic
1194883415 X:99282521-99282543 TTCCACTGCATTCCAGCCTGGGG + Intergenic
1194915953 X:99708943-99708965 AACACATTGATTTCAGCCTGTGG - Intergenic
1195271457 X:103235383-103235405 AACAACTTGATTTCAGTCTTGGG - Intergenic
1195775830 X:108405238-108405260 TGCCACTGCATTCCAGCCTGGGG - Intronic
1196556534 X:117091207-117091229 TGCCACTGGACTCCAGCCTGGGG - Intergenic
1196672501 X:118383919-118383941 TGCCACTGCATTCCAGCCTGGGG - Intronic
1196912164 X:120494978-120495000 CACCACTGCACTTCAGCCTGGGG + Intergenic
1197234981 X:124051630-124051652 TACCACTGCACTCCAGCCTGGGG - Intronic
1197462750 X:126762443-126762465 TGCCACTGTACTTCAGCCTGGGG + Intergenic
1198035274 X:132795645-132795667 TACCACTGCACTCCAGCCTGAGG - Intronic
1198641553 X:138761495-138761517 TACTACTGGCTTTAACCCTGTGG - Intronic
1200253552 X:154566965-154566987 GACAACTTGATTGCAGACTGTGG - Intergenic
1200264215 X:154637443-154637465 GACAACTTGATTGCAGACTGTGG + Intergenic
1200418549 Y:2937444-2937466 TACCACTGCACTCCAGCCTGGGG + Intronic
1200828298 Y:7665682-7665704 TACCTCTGCTTTTCAGCCTGGGG + Intergenic
1201098404 Y:10652796-10652818 TGCCACTGTACTTCAGCCTGAGG - Intergenic
1201119436 Y:10861696-10861718 TGCAACTGCACTCCAGCCTGTGG - Intergenic
1201138965 Y:11012170-11012192 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1201139346 Y:11015372-11015394 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1201157761 Y:11149089-11149111 TGCCACTGCATTTCAGCCTGAGG + Intergenic
1201421616 Y:13805800-13805822 TGCCACTGCATTCCAGCCTGGGG - Intergenic
1202101117 Y:21309114-21309136 CACCACTGCATTACAGCCTGGGG + Intergenic
1202626680 Y:56866823-56866845 TGCCACTGCATTCCAGCCTGTGG + Intergenic