ID: 1108539149

View in Genome Browser
Species Human (GRCh38)
Location 13:51420936-51420958
Sequence GGTTCTACTAACTCAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108539145_1108539149 15 Left 1108539145 13:51420898-51420920 CCGAGTTCCTCACTTACAGATCT 0: 1
1: 0
2: 1
3: 16
4: 201
Right 1108539149 13:51420936-51420958 GGTTCTACTAACTCAAAAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 94
1108539144_1108539149 25 Left 1108539144 13:51420888-51420910 CCAGGAAATACCGAGTTCCTCAC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1108539149 13:51420936-51420958 GGTTCTACTAACTCAAAAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 94
1108539146_1108539149 8 Left 1108539146 13:51420905-51420927 CCTCACTTACAGATCTTAAGCTT 0: 1
1: 0
2: 1
3: 12
4: 142
Right 1108539149 13:51420936-51420958 GGTTCTACTAACTCAAAAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 94
1108539143_1108539149 26 Left 1108539143 13:51420887-51420909 CCCAGGAAATACCGAGTTCCTCA 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1108539149 13:51420936-51420958 GGTTCTACTAACTCAAAAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 94
1108539142_1108539149 27 Left 1108539142 13:51420886-51420908 CCCCAGGAAATACCGAGTTCCTC 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1108539149 13:51420936-51420958 GGTTCTACTAACTCAAAAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108539149 Original CRISPR GGTTCTACTAACTCAAAAGC TGG Intronic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
908544840 1:65152208-65152230 GGATCTACTATCTCAAGTGCAGG + Intronic
914328601 1:146645376-146645398 GGCTCTGCAAATTCAAAAGCTGG + Intergenic
915769342 1:158403318-158403340 TGTTCTCCTAAATCAAAACCTGG + Intergenic
919229140 1:194750668-194750690 TGTTTTACTAACTTAAAGGCAGG + Intergenic
921561918 1:216669328-216669350 GGTTCCAGTAAGTCAAAACCAGG + Intronic
923281173 1:232444451-232444473 GGGTCTCCCAACTCAAAAGTCGG - Intronic
1068025187 10:51633961-51633983 GGTTCTGCTTCCTCAAAAGAGGG - Intronic
1068367013 10:56064861-56064883 GGATCAACAAAATCAAAAGCTGG - Intergenic
1070052148 10:72899661-72899683 GGTTCTCCATACTCAAAAGTTGG - Intronic
1070664189 10:78331969-78331991 GGTTCTATTTACTTAAAAACTGG + Intergenic
1074271146 10:111955083-111955105 GTTTCTAGTCACTCAAAACCAGG + Intergenic
1074521154 10:114225353-114225375 GGTGCTGCTCATTCAAAAGCAGG - Intronic
1078298322 11:10098804-10098826 GAATCTACAAACTCAAAAACAGG + Intronic
1083568434 11:63741077-63741099 TGCTGTACTAACTCTAAAGCTGG + Intronic
1084588204 11:70075622-70075644 GGTTTTACTAATTCATGAGCAGG + Intergenic
1085852311 11:80136439-80136461 GAACCTACTAACTAAAAAGCAGG - Intergenic
1086539274 11:87888404-87888426 TGTTTGTCTAACTCAAAAGCTGG - Intergenic
1095234122 12:39776870-39776892 GGTTTTATTAATTCAAAATCAGG - Intronic
1095369877 12:41454350-41454372 GTTTCCTCTAACTCAAACGCAGG - Intronic
1106339342 13:28814061-28814083 GGGTCAACAAAGTCAAAAGCTGG + Intergenic
1108539149 13:51420936-51420958 GGTTCTACTAACTCAAAAGCTGG + Intronic
1110292429 13:73822810-73822832 GCTTCCACTAACTCTAGAGCTGG + Intronic
1110416255 13:75256351-75256373 GATTCATCTAACTCAAAAGTTGG - Intergenic
1110934717 13:81273019-81273041 GGTTATACAAGCTGAAAAGCAGG + Intergenic
1114878302 14:26751331-26751353 AGTTCAACTAGCTCAAAAGAAGG - Intergenic
1117666077 14:58057500-58057522 GGTGTTACTAGCTCAAAAGGTGG + Intronic
1117786560 14:59291923-59291945 GGTTCTATTACCTCAAGAGATGG + Intronic
1117982851 14:61358872-61358894 GGAGTTACTAAGTCAAAAGCAGG - Intronic
1121108178 14:91294237-91294259 GGTTCTGCTGGCTCAACAGCTGG + Exonic
1123439062 15:20276909-20276931 GGTTCTGCTCACCCAGAAGCCGG - Intergenic
1127038051 15:54941487-54941509 GCTTCTTCTACCTCAAAGGCAGG - Intergenic
1134863902 16:17587211-17587233 GCAGCCACTAACTCAAAAGCTGG + Intergenic
1140004962 16:71065567-71065589 GGCTCTGCAAATTCAAAAGCTGG - Intronic
1142550726 17:737403-737425 GGTTTTACTAACTTAAATCCTGG - Intronic
1157146204 18:45165115-45165137 GGTTGTTCTCACTCAAAAGTGGG - Intergenic
1158584179 18:58715957-58715979 AGTTCTACTCACCCAAAGGCTGG - Exonic
1163156946 19:15444831-15444853 GGTCCTAGAACCTCAAAAGCAGG - Intronic
1163869396 19:19806622-19806644 GGTTCTACTAAATCAAAAATTGG + Intronic
1163901477 19:20104659-20104681 GGTGCTACTGAATCAAAAGTTGG - Intronic
1163988721 19:20977707-20977729 AGTACTACTGAATCAAAAGCTGG + Intergenic
1164134644 19:22403068-22403090 GATACTACTAAATCAAAAACTGG + Intronic
1164164171 19:22653714-22653736 GATACTACTAAATCAAAAACTGG - Intronic
1164285134 19:23808219-23808241 GGTACTACTGAATCAAAAACTGG - Intronic
931982348 2:67707338-67707360 GGTTGTACCAACTCAGAAGAAGG + Intergenic
933641245 2:84762544-84762566 GGTTCTCATGACTCACAAGCAGG - Intronic
935423655 2:102896915-102896937 GGTTCTACTAACAAAAACGATGG - Intergenic
939115433 2:138055264-138055286 GGTTTTACAAAGTAAAAAGCAGG - Intergenic
944992130 2:205249714-205249736 GATTCTACCAACTCAGAAACAGG - Intronic
1169237330 20:3941540-3941562 TGTTCTAATAACCCAAAAGAAGG + Intronic
1169735194 20:8830382-8830404 GATTCTGCTAAAACAAAAGCTGG - Intronic
1173165773 20:40686381-40686403 CTTCCTACTATCTCAAAAGCAGG + Exonic
1177724685 21:24951553-24951575 GAATCTACTTAGTCAAAAGCAGG + Intergenic
1179264161 21:39787706-39787728 TGTTATAATAACTCAAAAGTAGG - Intronic
949794886 3:7838464-7838486 GTTTCTACTTATTCAGAAGCAGG - Intergenic
954114541 3:48458639-48458661 AGTTATAAAAACTCAAAAGCTGG - Intronic
956014135 3:64863262-64863284 GGTTCCAATATCTGAAAAGCTGG + Intergenic
960795787 3:121486048-121486070 GGTTCAACTCTCTCAAAACCTGG + Intronic
962543843 3:136411243-136411265 GGTTGTACAAACTATAAAGCAGG + Intronic
964439908 3:156697240-156697262 GGTTCTACTATCTCACCAGGAGG - Intronic
964827416 3:160844069-160844091 GGTTTTTCTGGCTCAAAAGCAGG - Intronic
970632495 4:17965643-17965665 GGTTCTCCTATTTCAAAATCTGG - Intronic
972072184 4:35035946-35035968 GGTTCTACAAACACACAATCAGG + Intergenic
972282922 4:37620404-37620426 GATTCTACCATCTCAAAGGCTGG - Intronic
977375631 4:96199491-96199513 GGTTCTGCCAGATCAAAAGCAGG - Intergenic
978146662 4:105381810-105381832 GGATCAACTAAAACAAAAGCTGG - Intronic
980387854 4:132110488-132110510 GGTTTTACTGAGTGAAAAGCGGG + Intergenic
988473231 5:31560244-31560266 GTTTCTACTAACTCAGAAATAGG - Intergenic
993772418 5:91946059-91946081 GCTTCGGCTAACTCAAAAGGTGG + Intergenic
998494808 5:142579091-142579113 GCTTCTACTAACAGTAAAGCCGG + Intergenic
998578244 5:143341264-143341286 GGATCTGCTAACTCAGAATCAGG + Intronic
999072739 5:148764537-148764559 TATTAAACTAACTCAAAAGCAGG - Intergenic
1005197950 6:23310731-23310753 CGTTCTGGTAACTCAAAGGCTGG + Intergenic
1006545434 6:34776996-34777018 GGATCTACTGAATCAAAATCTGG - Intergenic
1012756337 6:103236360-103236382 GTTTCTACTAACTCAATGGCAGG + Intergenic
1015739268 6:136435793-136435815 GATTCTACTATTTCTAAAGCAGG - Intronic
1016811991 6:148270235-148270257 GGGTCTCCCAACTCATAAGCCGG + Intergenic
1022682560 7:32563598-32563620 TGTTCTAGTAACTGAAAAGGTGG - Intronic
1026622779 7:71964952-71964974 GTCTCTACTAACTCAAAGTCTGG - Intronic
1034658332 7:152747312-152747334 CCTTCTTCTAACTCAAAGGCGGG - Intergenic
1037406366 8:18546967-18546989 GGTTCTGCTGGCTCAAGAGCAGG + Intronic
1037462726 8:19129230-19129252 AGTTTTACGAACTCAAAAACAGG + Intergenic
1039846424 8:41329041-41329063 GGTGCTAATCCCTCAAAAGCTGG + Intergenic
1041484226 8:58356734-58356756 GGCAATACTAGCTCAAAAGCAGG + Intergenic
1042715406 8:71766577-71766599 GGTTTTTCTGACTCCAAAGCTGG - Intergenic
1045741984 8:105371600-105371622 GGTTATACAAACTCAAATTCAGG + Intronic
1050709597 9:8446094-8446116 GGTTATACTGACAAAAAAGCAGG + Intronic
1051712364 9:19945243-19945265 GGCTCTTCTAGCACAAAAGCAGG + Intergenic
1051712991 9:19950989-19951011 GGTTCTACCAACTGTAGAGCTGG + Intergenic
1060422325 9:123478059-123478081 GGTTCTAGAAACTCAGAATCTGG - Intronic
1061003434 9:127915504-127915526 GGTTTTAATAATTGAAAAGCTGG + Intronic
1188554357 X:31395278-31395300 AGTTCTAAAATCTCAAAAGCAGG - Intronic
1190485215 X:50917083-50917105 GGTAATACTAACACAGAAGCAGG - Intergenic
1190635510 X:52429107-52429129 GTTTCTACAAACTGATAAGCTGG - Intergenic
1193149052 X:78105712-78105734 GGTTCTTCTATCTCCACAGCAGG - Intronic
1197526110 X:127565541-127565563 AGTCCTACTAACACAAAAGGTGG + Intergenic
1197941101 X:131791423-131791445 GTTTCTACGAATTCAAAAACAGG - Intergenic