ID: 1108539185

View in Genome Browser
Species Human (GRCh38)
Location 13:51421261-51421283
Sequence CTCATGATGACTGGTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108539185_1108539187 15 Left 1108539185 13:51421261-51421283 CCTGAGGCACCAGTCATCATGAG 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1108539187 13:51421299-51421321 TAGCACTTCTTGAAAACCACTGG 0: 1
1: 0
2: 0
3: 9
4: 153
1108539185_1108539188 16 Left 1108539185 13:51421261-51421283 CCTGAGGCACCAGTCATCATGAG 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1108539188 13:51421300-51421322 AGCACTTCTTGAAAACCACTGGG 0: 1
1: 0
2: 2
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108539185 Original CRISPR CTCATGATGACTGGTGCCTC AGG (reversed) Intronic
900285538 1:1897848-1897870 GGCATGATGTCTCGTGCCTCAGG + Intergenic
901385373 1:8904902-8904924 CTCATGATGGCTGGTGTGTTTGG - Intergenic
911392804 1:97267930-97267952 CTCAAGATGAATTGTGCCTTGGG - Intronic
914884994 1:151577397-151577419 CTAATGATGACTGGTGGCTGGGG - Intronic
915299621 1:154944628-154944650 CACATGCTGACCGGTGCCTTGGG - Exonic
915570677 1:156743654-156743676 CTCATGATCTCTGATGCCTGGGG + Exonic
915571317 1:156746801-156746823 GCCATGATGACTGGGGCCCCAGG + Intronic
915886201 1:159723661-159723683 CTGAGGATGAATGTTGCCTCAGG - Intergenic
916018761 1:160775165-160775187 CTTCTCAAGACTGGTGCCTCAGG - Intergenic
917211228 1:172633892-172633914 CTAATGATGACTGGTGGCTCCGG + Intergenic
917821201 1:178766001-178766023 CTGAGGATGAATGTTGCCTCAGG - Intronic
922796962 1:228345008-228345030 CACATGTTGGCTGGTGCCTTGGG - Intronic
923292562 1:232560637-232560659 CTCATGAAGGCTGAGGCCTCTGG - Intronic
1064628503 10:17285629-17285651 ACCATGATGACTTCTGCCTCTGG + Intergenic
1064915647 10:20454425-20454447 CTAATGAGGACTGTTGCCTTTGG - Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1065879009 10:30023604-30023626 CTCATGTTGACAGCTTCCTCGGG - Intronic
1071666101 10:87560319-87560341 CTCTTGGTAACTGCTGCCTCTGG + Intergenic
1076805585 10:132857042-132857064 CTCATGATCCCTGGGGCATCGGG - Intronic
1077295096 11:1822822-1822844 CTCATGGTGACAGCTGCTTCTGG - Intergenic
1081737530 11:45414316-45414338 TTCAATATGGCTGGTGCCTCAGG + Intergenic
1082863076 11:57873778-57873800 CTCTTGATCTCTGGTGGCTCTGG + Intergenic
1083177122 11:60957390-60957412 CTCATGAATACTGATCCCTCAGG + Intergenic
1083302459 11:61746097-61746119 CTCATGATCACTGGTACCTGGGG + Exonic
1089342330 11:117766771-117766793 CTCGTGTTCACAGGTGCCTCTGG - Intronic
1090037825 11:123264083-123264105 CTCATGATGGTTGGAGGCTCAGG - Intergenic
1092695194 12:11164043-11164065 CTGATGATATCAGGTGCCTCTGG - Intronic
1092837009 12:12500078-12500100 CTCATGATGACTGCTGGCTGGGG - Intronic
1093274946 12:17114002-17114024 CTGTTGATGACTGATGCATCTGG - Intergenic
1096650835 12:53061199-53061221 GACATGGTGACTGATGCCTCTGG - Exonic
1103558375 12:121779382-121779404 CTCATGGTGTCTGGGGCCTGCGG - Exonic
1103827337 12:123750261-123750283 CTGGTGATAACTGGTGGCTCAGG + Intronic
1108539185 13:51421261-51421283 CTCATGATGACTGGTGCCTCAGG - Intronic
1110239130 13:73247381-73247403 CTCATGAAGGCTGATGTCTCTGG - Intergenic
1110484895 13:76027331-76027353 CTCATGCTCACTCATGCCTCAGG - Intergenic
1123515553 15:21027436-21027458 CTCGTGGTGACTGCTGTCTCTGG + Intergenic
1127347647 15:58116606-58116628 CTCATGAACAGTGGGGCCTCAGG - Intronic
1130622219 15:85475514-85475536 CACATGATGGTTGGTACCTCTGG - Intronic
1130922114 15:88356420-88356442 CTCATGATGTCTGAAGCCTCAGG + Intergenic
1131407154 15:92174679-92174701 CTCAATATGACAGGTGCCCCTGG + Intergenic
1132567455 16:630039-630061 CTCCAGATGTCTGGGGCCTCAGG - Intronic
1135398274 16:22147621-22147643 GTCATGATGACTGCTGCTTCAGG + Intronic
1138277017 16:55742599-55742621 CGAATGAAGACTGGGGCCTCAGG + Intergenic
1138554558 16:57763971-57763993 CTCTTAAGGCCTGGTGCCTCAGG + Intronic
1141010424 16:80391857-80391879 CTCGTGATCACTGGGGGCTCTGG - Intergenic
1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG + Intronic
1143940962 17:10541042-10541064 CTGAGGATGAATGTTGCCTCAGG + Intronic
1144226482 17:13153288-13153310 TTCTTGATGACTGGGTCCTCTGG + Intergenic
1144483013 17:15642992-15643014 CTCATGCTGACTGCAGCCCCAGG - Intronic
1144915669 17:18722039-18722061 CTCATGCTGACTGCAGCCCCAGG + Intronic
1147058905 17:37858251-37858273 CTGAGGATGAATGTTGCCTCAGG + Intergenic
1147260838 17:39209133-39209155 CTCTTGATCCCTGGAGCCTCTGG + Intergenic
1149185596 17:53993305-53993327 AACAGGATGACTGGTGCCTGTGG - Intergenic
1149400016 17:56286409-56286431 TTCATGATGCCTGGGGCCTAAGG + Intronic
1152744999 17:82034480-82034502 CTCAGGCTGATTTGTGCCTCTGG + Intergenic
1158789342 18:60757826-60757848 CTCATGACAACTAGTGCCTGAGG - Intergenic
1158801797 18:60919845-60919867 CTCATGCTGACTAGTCACTCAGG - Intergenic
1161455163 19:4366276-4366298 CTCATGCCGACTGGTTCCTCAGG - Intronic
1161775503 19:6260045-6260067 CTCCTGTTGCCTGGTTCCTCTGG - Intronic
1162028753 19:7908519-7908541 CTCCTGGTGACTGGTGCCCAGGG - Intronic
1163523105 19:17803709-17803731 GGCATGGTGACTGGTGCCTGTGG + Intronic
1164330600 19:24251019-24251041 CTGAGGATGAATGTTGCCTCAGG + Intergenic
1165181449 19:33975025-33975047 CTCAGGATGACTGCAGCCCCAGG - Intergenic
1165933344 19:39374357-39374379 CTCATGAGGCCTGGTGACTCAGG - Intronic
925580844 2:5408987-5409009 TTCATGAGGATTCGTGCCTCTGG - Intergenic
933453265 2:82485912-82485934 GTGATGATGATTGGGGCCTCTGG + Intergenic
942427706 2:175877141-175877163 CTCAGGATGACAGGAGCCTTTGG + Intergenic
946934662 2:224707817-224707839 CTCATGATGACATTTGCCCCTGG + Intergenic
1168917800 20:1505529-1505551 GTCATGGTGCCTGGGGCCTCAGG + Intergenic
1173256278 20:41396044-41396066 CTCACGGTGCCTTGTGCCTCCGG + Intergenic
1178169273 21:30020559-30020581 CTCTATATGACTGTTGCCTCTGG + Intergenic
1181639062 22:24187406-24187428 CTCCTGGGGACTGGTGCCTGGGG - Exonic
1184993000 22:48183199-48183221 CTCTGGGTGACTGGTGTCTCCGG - Intergenic
949787851 3:7761414-7761436 CTCAGGATGAATGTCGCCTCAGG + Intergenic
955588311 3:60506340-60506362 CTCCTGAACACTGGTGCCTTTGG + Intronic
956124728 3:66000592-66000614 TTCATCATGTCTGGTGCCTTTGG - Intronic
956337868 3:68185134-68185156 CCCATGCGGACTGGTTCCTCTGG - Intronic
958730370 3:97954451-97954473 CGCTTGATGAATGGTTCCTCTGG + Exonic
959331375 3:105009556-105009578 GTCCTGATGACAGGTGCCTAAGG - Intergenic
960741015 3:120833819-120833841 CCCAAGATGATTGGTCCCTCAGG - Intergenic
961511951 3:127408705-127408727 CTCATGAGGACTGGAGCTCCTGG - Intergenic
962212667 3:133491912-133491934 CTCATGACCTCTGGGGCCTCTGG - Intergenic
963273415 3:143307651-143307673 CCCAGGCTGACTGGTCCCTCTGG + Intronic
964680650 3:159334972-159334994 CTCATGACAACTTCTGCCTCTGG + Intronic
965278963 3:166723882-166723904 CTCATGAAGAGGGGTGCCTTAGG - Intergenic
967121358 3:186385418-186385440 CGCATGTGCACTGGTGCCTCAGG - Intergenic
973976173 4:56264630-56264652 CTCAGGATGTATGTTGCCTCAGG - Intronic
976912857 4:90328770-90328792 CTCAGGCTGAATTGTGCCTCAGG + Intronic
982169289 4:152645550-152645572 CACATGATGAATGGTGCAGCAGG - Intronic
985122356 4:186656614-186656636 CTGATGATGAATGGTACCTGGGG + Intronic
987317568 5:16738226-16738248 CTCCTCTTGACTGGTTCCTCTGG - Intronic
988639492 5:33025806-33025828 CTCAAGATGAATTGTGCCTTGGG - Intergenic
994081530 5:95712705-95712727 TCCATGATGTCTGGGGCCTCAGG - Intergenic
997614098 5:135234724-135234746 CTCATTAAAACTGATGCCTCAGG + Intronic
1001305929 5:170572724-170572746 CTGATGATGACTGATGGCACAGG + Intronic
1002621311 5:180490480-180490502 CTCATGCTGATTGGTTCCTTTGG - Intergenic
1006591425 6:35160763-35160785 CTCAGGATCACTGGTTCCTGGGG + Intergenic
1010218618 6:73427950-73427972 GGCATGGTGACTGGTGCCTGTGG - Intronic
1012542759 6:100380797-100380819 CTGATGATGACTTGTGCATAAGG + Intergenic
1013289523 6:108708397-108708419 CTCCTGATGTCTAGTGTCTCAGG - Intergenic
1013523692 6:110955422-110955444 CTGATGCTGACGGGTGCCTATGG + Intergenic
1014006396 6:116424185-116424207 CTCATGGTGACTGGTGGGCCAGG - Intronic
1015474352 6:133643353-133643375 CCCATGATCACTGATGCCACTGG + Intergenic
1015757341 6:136620804-136620826 CTCATGATTTCTGCTGCCTTAGG - Intronic
1016413544 6:143808981-143809003 ATCATGCTGGCTGGGGCCTCCGG + Intronic
1016951846 6:149587885-149587907 CTAATGATGACTGATGGCTGGGG - Intronic
1018164046 6:161077176-161077198 TTCATGATCATTGTTGCCTCTGG + Intronic
1021907749 7:25352471-25352493 CTCAGCATAACTGGTGCCTGAGG + Intergenic
1022785200 7:33631491-33631513 TTCATGATGCCTGCTGCCTGTGG - Intergenic
1024408865 7:49015385-49015407 CTGAGGATGAATGTTGCCTCAGG - Intergenic
1025749538 7:64281372-64281394 CTGAGGATGAATGTTGCCTCAGG - Intergenic
1027734973 7:81920646-81920668 CTCATGCTGAGGGGTGCCTGCGG + Intergenic
1031861833 7:126989086-126989108 ATCATCATGTCTGGTCCCTCTGG - Intronic
1036604531 8:10293795-10293817 CTCCTGATGACTGGGGCAGCAGG + Intronic
1037533313 8:19801267-19801289 GTAATCATGACTGGTGCTTCTGG + Intergenic
1037551115 8:19972610-19972632 CTCATGATGACTGATTTTTCAGG + Intergenic
1040679106 8:49787548-49787570 CTGAGGATGAATGTTGCCTCAGG - Intergenic
1045798680 8:106077065-106077087 CTGAGGATGACTGTCGCCTCAGG + Intergenic
1047211969 8:122847665-122847687 CTCATGATGACTGTCCCCTTGGG + Intronic
1050606669 9:7308963-7308985 CTGAGGATGAATGTTGCCTCAGG + Intergenic
1052566499 9:30160303-30160325 CACATGCTCACTGGGGCCTCGGG - Intergenic
1060083449 9:120675016-120675038 GACATGATGGCTGGTGCCTGTGG - Intronic
1060770794 9:126330264-126330286 CTCATGTTGACTCCTGCCACAGG - Intronic
1189557645 X:42162121-42162143 CTGAGGATGAATGTTGCCTCAGG - Intergenic
1190106604 X:47565278-47565300 CTCATGCTGTCTGGAGCCTCCGG - Exonic
1195387092 X:104323756-104323778 CTCAAGGAGACTGCTGCCTCAGG + Intergenic
1195792665 X:108606104-108606126 CTCATGAGAACTGGTGTCACGGG - Intronic
1197925887 X:131646859-131646881 CTCATGATCTCTGATGCCTGGGG - Intergenic