ID: 1108542061

View in Genome Browser
Species Human (GRCh38)
Location 13:51453621-51453643
Sequence CTCGCGCCGGGGCGGCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 226}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108542061_1108542075 -3 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542075 13:51453641-51453663 GAGCGGGCGCGGGCGGGGGAGGG 0: 1
1: 0
2: 14
3: 162
4: 1791
1108542061_1108542071 -9 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542071 13:51453635-51453657 CGGCGCGAGCGGGCGCGGGCGGG 0: 1
1: 0
2: 6
3: 69
4: 507
1108542061_1108542072 -8 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542072 13:51453636-51453658 GGCGCGAGCGGGCGCGGGCGGGG 0: 1
1: 1
2: 29
3: 150
4: 937
1108542061_1108542076 -2 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542076 13:51453642-51453664 AGCGGGCGCGGGCGGGGGAGGGG 0: 1
1: 0
2: 19
3: 201
4: 1985
1108542061_1108542070 -10 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542070 13:51453634-51453656 CCGGCGCGAGCGGGCGCGGGCGG 0: 1
1: 0
2: 5
3: 54
4: 435
1108542061_1108542079 23 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542079 13:51453667-51453689 GTGAGAGGTTGTTTATGACCGGG 0: 1
1: 0
2: 1
3: 6
4: 153
1108542061_1108542078 22 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542078 13:51453666-51453688 AGTGAGAGGTTGTTTATGACCGG 0: 1
1: 0
2: 0
3: 4
4: 130
1108542061_1108542080 24 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542080 13:51453668-51453690 TGAGAGGTTGTTTATGACCGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1108542061_1108542073 -7 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542073 13:51453637-51453659 GCGCGAGCGGGCGCGGGCGGGGG 0: 1
1: 1
2: 16
3: 135
4: 840
1108542061_1108542077 8 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542077 13:51453652-51453674 GGCGGGGGAGGGGAAGTGAGAGG 0: 1
1: 1
2: 31
3: 740
4: 5718
1108542061_1108542074 -4 Left 1108542061 13:51453621-51453643 CCGGCGCGCCGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 29
4: 226
Right 1108542074 13:51453640-51453662 CGAGCGGGCGCGGGCGGGGGAGG 0: 1
1: 0
2: 16
3: 175
4: 1340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108542061 Original CRISPR CTCGCGCCGGGGCGGCGCGC CGG (reversed) Intronic
900199803 1:1399372-1399394 CACGCGACGGGGCGGGGCGGTGG - Intergenic
900349497 1:2227984-2228006 CGCGGGGCGGGGCGGCGCGGCGG + Intergenic
900349652 1:2228462-2228484 CTAGAGCCCGGGGGGCGCGCGGG + Intergenic
900418862 1:2547001-2547023 CTAGCGCCAGGGCGGGGCGTGGG + Intergenic
901022142 1:6260933-6260955 CTGGCGGCGGAGCGGCCCGCGGG + Exonic
901100355 1:6715104-6715126 CTCCCGACGGGGCGGCTGGCCGG + Intergenic
901489419 1:9589096-9589118 AGCGGGCCGGGGCGGCGCGGGGG - Intronic
902315759 1:15617389-15617411 GTTGCGGCGGGGCGGGGCGCCGG + Intergenic
902348746 1:15837560-15837582 GTCGGGCCGGGGCAGCGCGCTGG + Intergenic
903750585 1:25618054-25618076 CTCGCCCGGGGCCGGCGCGGCGG - Exonic
904237341 1:29123856-29123878 CTGGCGCCGCAGCGCCGCGCGGG + Intronic
905847144 1:41242306-41242328 CGGGGGGCGGGGCGGCGCGCTGG + Intergenic
905862745 1:41361838-41361860 CACGCCCCGGGGAGGCCCGCGGG - Intergenic
906319272 1:44806503-44806525 CTCGCGCCGGGGCTCCATGCTGG - Exonic
908501020 1:64744632-64744654 CCCGCGCTGGGGCGGCCCGGGGG - Intergenic
912514580 1:110210109-110210131 AGCGCGCAGGGGCGGCGCGCTGG + Intergenic
913109238 1:115642445-115642467 CGCGTGCCGGGGCGGCGGGCAGG + Intronic
913131009 1:115838560-115838582 CCCGCGCCAGGGCGAGGCGCAGG - Exonic
914393562 1:147243007-147243029 CCCCCGCCTGCGCGGCGCGCGGG + Intronic
916660789 1:166920991-166921013 CTCGTACCTGGGCAGCGCGCGGG - Exonic
917131055 1:171742317-171742339 CTCGGGACTGGGCGCCGCGCCGG + Intergenic
919486863 1:198157118-198157140 CGTCCGCCGGGGCGGCGCGGCGG + Exonic
922648614 1:227318111-227318133 CCCGCACCGGGCCGCCGCGCCGG + Exonic
1064209092 10:13348143-13348165 CCCGCGCCTGGGCGCCGCGGGGG + Exonic
1064209113 10:13348209-13348231 CTCCCGCCGGCTGGGCGCGCGGG + Exonic
1065024526 10:21527285-21527307 CGGGCGCGGGGCCGGCGCGCCGG + Intergenic
1065342956 10:24723619-24723641 CTCACGCCGGGCGGGCGGGCGGG - Exonic
1065533683 10:26697933-26697955 GTCGCGACGCGGGGGCGCGCGGG + Intronic
1067060935 10:43077551-43077573 CTCGGGCGGGAGCGGAGCGCGGG + Intronic
1067474451 10:46556680-46556702 CTGGCACCGGGGCGGCGGGAGGG + Intergenic
1073403444 10:103277083-103277105 CCGGGGCTGGGGCGGCGCGCTGG - Intergenic
1075335861 10:121608687-121608709 CTGGCGCTGGGGCAGCGCCCGGG + Intergenic
1075768974 10:124917317-124917339 CTCGCTCCCAGGCGGCGCCCAGG + Intergenic
1076371668 10:129959551-129959573 CTAGAGCCGGGGGAGCGCGCAGG - Intronic
1077034819 11:489530-489552 CTCGCGACGGCGCGGCGGGCGGG + Intronic
1077121464 11:910854-910876 CGTGCGCGGCGGCGGCGCGCGGG - Intronic
1077413647 11:2414677-2414699 CTGGGGCCGGGCCCGCGCGCGGG - Intronic
1083965714 11:66042584-66042606 GAAGCGCCGGGGCGGTGCGCGGG - Exonic
1083997214 11:66278402-66278424 CTTGCGCCCGGGCCCCGCGCTGG + Exonic
1086455445 11:86955425-86955447 CTCGCGGCGCGGCGGCGGGGCGG + Intergenic
1086993422 11:93330581-93330603 CACGCGGCGGCGCCGCGCGCGGG + Intronic
1090473974 11:127003533-127003555 CGCGTCCGGGGGCGGCGCGCGGG + Intergenic
1093435279 12:19129567-19129589 CGCGCGGCGGGGCGGCCGGCCGG + Intergenic
1094219355 12:27975497-27975519 CGGGCGCAGGGGAGGCGCGCTGG - Intergenic
1094580465 12:31729342-31729364 GTCGCGGCGGGGCTGCGCGCTGG - Intergenic
1096251025 12:50032836-50032858 CCCGCGCGGGGGCGGCAAGCGGG + Intronic
1096469844 12:51869196-51869218 CTCGCCCCAGGGGGGCTCGCGGG + Intergenic
1100391539 12:94149255-94149277 CCCGGGCCGGGGCCGCGCGGGGG - Exonic
1102101587 12:110282034-110282056 CTCCCGCGGGGCCGGCGCGCTGG - Intronic
1102519817 12:113471279-113471301 CGCGCGCAGGGTGGGCGCGCAGG + Intronic
1103085828 12:118061209-118061231 GACGCGCGGGGGCGGGGCGCAGG + Intronic
1104259054 12:127166126-127166148 CGCGGGGCGGGGCGGCCCGCCGG + Intergenic
1104602358 12:130162323-130162345 CCCGCGGCGGGGCGGCGGGGAGG + Intergenic
1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG + Exonic
1106340247 13:28820246-28820268 CTCGAGCGGGGGCGGCGGCCTGG + Intergenic
1108330340 13:49378430-49378452 CTCCCGACGGGGCGGCTGGCCGG - Intronic
1108542061 13:51453621-51453643 CTCGCGCCGGGGCGGCGCGCCGG - Intronic
1113082627 13:106534778-106534800 CTCCCGCCCGGACGGCGCGGCGG + Intronic
1113846366 13:113394015-113394037 CGGGAGTCGGGGCGGCGCGCAGG - Intergenic
1117680683 14:58200083-58200105 CTCGCGCGGCCGCGGCGCGCCGG - Intronic
1118955627 14:70477779-70477801 CTCCCGGCGGGGCGGCTGGCCGG - Intergenic
1119539262 14:75428107-75428129 CTGGCGCCGCGGCGGCTCCCGGG + Intronic
1122081623 14:99271046-99271068 CAGGCGCCGGGGCCGCCCGCTGG - Intronic
1122220823 14:100238510-100238532 CTCGGGCCGGGGCCGCACTCGGG - Intronic
1122624179 14:103075712-103075734 CTCGAGCCGGGAGGGGGCGCTGG + Intergenic
1122689662 14:103526204-103526226 CTCGCACAGGGCCGGCGCTCTGG - Intergenic
1122975437 14:105168908-105168930 CGCGCGCCGGGCCGGGGCGCTGG - Intergenic
1127606512 15:60592481-60592503 CTCGGGCGGCGGCGGCGCGGCGG - Intronic
1128457482 15:67840373-67840395 CTGGGGCCGGGGCGGCGCGGAGG + Intergenic
1129541114 15:76347384-76347406 CTCGAGCCGGAGCGCCGCGCTGG + Intergenic
1129612313 15:77070777-77070799 GGCGCGCGGGGGCCGCGCGCGGG - Intronic
1129644832 15:77420204-77420226 CGCGCGGAGGGGCGGCGCGCGGG - Intergenic
1129803828 15:78438040-78438062 CGCGAGCGGGGGCGGAGCGCTGG - Intronic
1130023635 15:80251915-80251937 GTGCCGCCGGGGCGTCGCGCGGG - Intergenic
1131160431 15:90101869-90101891 CTCTCGCCAGGGGAGCGCGCGGG + Intronic
1132314374 15:100879662-100879684 CTCCCGCAGGGGCGGCGGGCGGG + Exonic
1132719684 16:1309615-1309637 CTGGCGCGGGCGGGGCGCGCGGG - Intronic
1134134140 16:11668567-11668589 CTCGGGCCGGGCGGGGGCGCCGG + Intronic
1136003574 16:27313871-27313893 CGGGCGCCGGGGCGGGGAGCAGG + Intronic
1136365247 16:29806561-29806583 CGGGCGGCGGGGCGGCCCGCGGG + Intronic
1137300573 16:47144152-47144174 CTCTCGCCGTGGCTGCGCGGCGG + Intergenic
1137707938 16:50548351-50548373 CGCGGGCCGCGGCGGCGGGCTGG + Exonic
1138015180 16:53421394-53421416 CGGGAGCCGGGGCTGCGCGCGGG - Intergenic
1138043585 16:53698639-53698661 CTCCCGACGGGGCGGCTGGCCGG - Intronic
1138105411 16:54285053-54285075 CCCTGGCTGGGGCGGCGCGCAGG - Exonic
1141456422 16:84145239-84145261 CTCGGGACGGACCGGCGCGCTGG - Intergenic
1141620847 16:85235879-85235901 CCAGCGCGGGGGCGGGGCGCGGG - Intergenic
1142589602 17:996764-996786 CTCGCGCCTCGGCCCCGCGCGGG - Intergenic
1143167005 17:4901828-4901850 CTCGGGGCGGGGCTTCGCGCTGG - Exonic
1143202810 17:5123567-5123589 CTCACACCGGGGGGGCACGCCGG + Intronic
1143582666 17:7835783-7835805 CTTGCGCCTGCGCGGCGAGCCGG + Intergenic
1143783138 17:9239965-9239987 CTAGCGCCGAGGCAGCGGGCGGG + Exonic
1144756081 17:17681530-17681552 CGCGGGCGGGGGCGGCGCCCGGG - Exonic
1144769572 17:17752194-17752216 CTGGGCGCGGGGCGGCGCGCGGG + Intronic
1145381967 17:22391719-22391741 CTGGCGCTGGGGCTGCGTGCAGG + Intergenic
1145382441 17:22394083-22394105 CTGGCGCTGGGGCTGCGTGCAGG + Intergenic
1145384566 17:22404401-22404423 CTGGCGCTGGGGCTGCGTGCAGG + Intergenic
1146271371 17:31487967-31487989 CTCGCGCCGGGGCGGGGCGGGGG - Intronic
1147189384 17:38730096-38730118 CAGGCGCCGAGGCTGCGCGCGGG + Intergenic
1147353167 17:39868152-39868174 CGCGCGCGGGGGCGGGGCGACGG - Exonic
1147722667 17:42548417-42548439 CTCTGGCCCGGGCTGCGCGCAGG - Intergenic
1147994648 17:44354103-44354125 CTCGCGGGCCGGCGGCGCGCGGG + Exonic
1148081059 17:44967921-44967943 CCGGCGCCGGGGCCCCGCGCGGG + Exonic
1148225203 17:45894494-45894516 CTCGCGCCTGCGCCGCCCGCCGG + Exonic
1148262164 17:46193275-46193297 GTCTCGCCGCGGCGGCGCGGGGG - Intronic
1148271790 17:46267163-46267185 CTCGCGGGGCGGCGGCGCGGCGG - Intergenic
1148337475 17:46851436-46851458 CCCGCGACGGGGCGGGGCGAGGG + Intronic
1148577141 17:48720042-48720064 CTCGGGCGGGGGCGACGGGCTGG + Intergenic
1148818230 17:50346004-50346026 CGCGCGCCGGGGCGGGGCCGGGG - Intergenic
1149314029 17:55421967-55421989 CGGGCTCCGGGGCGGGGCGCAGG - Exonic
1151538091 17:74749768-74749790 CTCGCGCCGGGGCTCCACACAGG - Intronic
1151608314 17:75154210-75154232 CTCGCGCCGGGGCGGGTGGCGGG - Intronic
1152183643 17:78840703-78840725 GTCGGGTCGGGGCGGTGCGCAGG - Intronic
1152625853 17:81387606-81387628 CCCGCGGCGGGGCCGGGCGCGGG - Intergenic
1152795233 17:82303249-82303271 CTCGGGCCGGGGCTGACCGCTGG - Intergenic
1152923907 17:83079182-83079204 TCCGCGCCGGGGCTGCCCGCAGG + Intergenic
1155096460 18:22560233-22560255 CGCGCCCCGGAGCGGAGCGCCGG - Intergenic
1156488999 18:37485440-37485462 CGGGCGGCGGCGCGGCGCGCGGG - Intronic
1159511269 18:69400849-69400871 CCCGCGCCGGGGAGCCGCGGTGG + Intergenic
1160919539 19:1513249-1513271 CTCGGGCGGGGGCGCGGCGCGGG + Intronic
1161959581 19:7516271-7516293 CTGGGGCCGGGGCGGGGGGCTGG + Intronic
1162802370 19:13118490-13118512 CTCCAGCCGGGGCGGCCCGAGGG + Intronic
1162914208 19:13865545-13865567 CCCGCCCCGGGGCTGCGAGCAGG - Intronic
1162940542 19:14006344-14006366 CACGCGCGGGGGCGGGGCCCGGG + Intronic
1164639019 19:29811690-29811712 CGCGGGGCGGGGCGGCGGGCGGG - Intergenic
1166366406 19:42280627-42280649 CGCGGGCCGCGGCGGGGCGCCGG - Intronic
1167101609 19:47407311-47407333 CTCGCCCCGGGCCGGCCCGCGGG + Intronic
1167258321 19:48443760-48443782 TGCGCGCAGGGGCGGCGCGAGGG - Exonic
1167258323 19:48443762-48443784 CTCGCGCCGCCCCTGCGCGCAGG + Exonic
1167501450 19:49851019-49851041 CCCGCGCCGGAGAGGCCCGCAGG + Intronic
1168344266 19:55642726-55642748 CTCGCGCTGGGGCGGGCCCCGGG - Exonic
1168403137 19:56097678-56097700 CTCGCGCCGTGCCTGCACGCAGG - Intronic
1168408046 19:56120933-56120955 CGCGCGCCCGGGCGGCCCGCGGG - Intronic
928186465 2:29115459-29115481 CAGGCGGCCGGGCGGCGCGCAGG - Exonic
930011407 2:46940992-46941014 CGGGCGCCGGGGCTCCGCGCGGG + Intronic
930096465 2:47570348-47570370 CCGGGGCCGGGGCGGCGCTCGGG + Exonic
934296835 2:91749089-91749111 CCAGCGCCGCGGCGGCGCCCCGG + Intergenic
935622896 2:105144296-105144318 CTCGGGCGGTGCCGGCGCGCGGG + Intergenic
937077798 2:119119640-119119662 CTAGCGCTGGGGAGGCGTGCAGG + Intergenic
937132610 2:119524482-119524504 CTGGCGCGGGGTCGGCGCGGAGG + Exonic
937369005 2:121284997-121285019 CTCGGGCCGGGCCGGCGGGCCGG - Intronic
941603001 2:167563631-167563653 CTCGGGACGGGGCGGCTGGCCGG + Intergenic
943571545 2:189580876-189580898 CTCGCGCCGCGGGGACGCCCGGG - Exonic
947549762 2:231037786-231037808 CGGGGCCCGGGGCGGCGCGCGGG + Exonic
947635990 2:231681039-231681061 TCTGCGCCGGGGCGGGGCGCGGG - Intergenic
947800826 2:232927845-232927867 GGCACGCGGGGGCGGCGCGCCGG + Intronic
948046830 2:234951874-234951896 CCCGCGCCGGGGCGGGGCTTCGG - Intergenic
948116115 2:235495018-235495040 CTCGCGGCGCGGCGGGGCGCAGG - Intronic
948824858 2:240569127-240569149 CGGGCGCCGGGGCTGCGGGCCGG + Intronic
1168837238 20:885381-885403 CCAGGGCCGGGGAGGCGCGCGGG - Intronic
1170889709 20:20367554-20367576 GGCGCGCCGGGGCGGTGCGGGGG - Intergenic
1171452837 20:25248022-25248044 CCCGCCCCGGCGCGGCGCGCAGG + Intergenic
1172109346 20:32536302-32536324 CTCGGGCCGAGGAGGCGCCCTGG + Intronic
1173166250 20:40689003-40689025 CTGGGGACGCGGCGGCGCGCCGG + Exonic
1174053958 20:47785564-47785586 CTTTGGCTGGGGCGGCGCGCGGG - Intronic
1175714639 20:61247321-61247343 CCCACGCCGGGGAGGCGGGCGGG + Intergenic
1175859798 20:62143938-62143960 CGCGCGCGGGGACGGGGCGCGGG + Intronic
1175927032 20:62476027-62476049 GGCGGGCCGGGGCGGCGCGGAGG - Intergenic
1176198020 20:63846530-63846552 CTGGAGCCGGGCCGGCGGGCCGG + Intergenic
1176234744 20:64049090-64049112 CTCGGGCCGGGGTGGGGCGGGGG - Intronic
1176547941 21:8209436-8209458 GTGGGGCCGGGGCGGGGCGCGGG - Intergenic
1176549148 21:8214011-8214033 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1176557041 21:8258232-8258254 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1176568080 21:8397049-8397071 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1176575983 21:8441269-8441291 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1178493599 21:33070000-33070022 CTTGTGCCGGGGCCGCGCGGAGG - Intergenic
1179411836 21:41168314-41168336 CCAGCTCCGGGGCGGCGCGCAGG - Exonic
1180959267 22:19755331-19755353 CGCGTGCCGGGGCTGCCCGCGGG - Intergenic
1182547551 22:31084871-31084893 CGGGGGCCGGGCCGGCGCGCGGG - Intronic
1183437028 22:37802347-37802369 CTCACGCCCGGGGGGCGCGACGG + Intergenic
1183466541 22:37983129-37983151 CTCCCTACGGGGCGGCGGGCAGG - Intronic
1183524909 22:38317205-38317227 CGCGGGCGGGGGCGGCCCGCCGG + Exonic
1185206454 22:49541700-49541722 TTCACGCCGGGGCGGGCCGCTGG + Intronic
1203254033 22_KI270733v1_random:130327-130349 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1203262089 22_KI270733v1_random:175406-175428 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
950434025 3:12967791-12967813 CTGGGGGCGGGGCTGCGCGCGGG + Intronic
950509882 3:13419843-13419865 CTCGCGCCTCAGCGGCGCGGAGG + Intronic
953485104 3:43287019-43287041 CCCGCTCCGGGGCGGGGCGCGGG - Intronic
954702001 3:52455475-52455497 CACGCGCGGGGGCGGGGCGAGGG + Intronic
959398368 3:105869045-105869067 CTCGGGGCGGGGCGGGGCGGGGG + Intronic
961346599 3:126267419-126267441 GTGGCGCTGGGGCGGTGCGCTGG + Intergenic
965962115 3:174441185-174441207 TTCACGCCGGGTCGGCGCCCCGG - Intronic
967142220 3:186570782-186570804 CTCACACCGGGGGGGCGCGGGGG - Exonic
967859600 3:194141290-194141312 CGCCCGCCGGGGCGGCCCGGGGG + Intergenic
968372829 4:11298-11320 CTCCCGCCCCGGCGCCGCGCCGG - Intergenic
968556592 4:1248990-1249012 CTCGCGGCGGCGCAGCGCGCCGG - Exonic
968674684 4:1871235-1871257 TCCGCGCCGGGGCCGCGCACGGG - Intergenic
969240378 4:5893116-5893138 CGCGCGCCGGGGCGGGGCCGGGG + Intergenic
969436541 4:7192427-7192449 CGAGCGCCTGGGCGGCGGGCCGG + Intergenic
973279109 4:48341365-48341387 CTCGCGGCGGGGCGGGGCCACGG - Exonic
973758959 4:54100143-54100165 CCCGAGCCGGGGCGCCGGGCGGG + Exonic
974003123 4:56530554-56530576 CTCGGGGCGGGGCTGGGCGCGGG + Intergenic
975689588 4:76950308-76950330 CCCGCGCCGAGGGGGCGCTCAGG + Intronic
978443977 4:108763122-108763144 CCCCCGCCGGGGCCGCGGGCAGG + Intergenic
985778419 5:1857235-1857257 CACACCCCGGGGCGGCGCACAGG + Intergenic
985996467 5:3599957-3599979 TGCGCGCCGGGGTGGCCCGCGGG - Exonic
987108718 5:14664935-14664957 CTCGGGCCGCGGCTGCCCGCTGG - Exonic
988547715 5:32174037-32174059 CTCCCGCCGAGGCGCCGAGCCGG + Exonic
995438221 5:112160946-112160968 CTCACGCAGGGGCGCCGGGCGGG + Intronic
997266261 5:132496908-132496930 CTGGCGGTGGGGCGGGGCGCAGG + Intergenic
999747594 5:154604169-154604191 CTCTCGCCAGGGCGGCCGGCTGG - Intergenic
1001556502 5:172641046-172641068 CCCGGGCCGGGAAGGCGCGCAGG - Intergenic
1002190218 5:177473809-177473831 CTGGCCCTGGAGCGGCGCGCAGG - Intronic
1002277531 5:178113656-178113678 CTCGGGCCGGGACTGCGTGCCGG - Exonic
1003868679 6:10384860-10384882 CGCGCGCCGGGCCGGGGCGCGGG + Intergenic
1005992885 6:30914350-30914372 CGCGCGCCGGGGCGGCCTCCGGG + Exonic
1007451310 6:41941771-41941793 CGCGCGCGCGGGCGGCGGGCGGG - Exonic
1007633457 6:43285144-43285166 CTGGCTCCGGGGGGACGCGCTGG - Exonic
1007633492 6:43285223-43285245 CCCGCCCCGGGGCGTCCCGCCGG + Exonic
1007901669 6:45419779-45419801 CTCGCACCCTGGCGGCGCCCGGG + Intronic
1010781220 6:79947602-79947624 CGCGCGCGGGGGCGGGGGGCCGG + Intergenic
1013619412 6:111873282-111873304 CTCGCCGCCGGGCGGCGGGCGGG + Exonic
1015149341 6:130020218-130020240 CTCGCGCCGCGGCGGCGGGGCGG + Intronic
1016713880 6:147203091-147203113 CCCTCGCCGGGGAGGAGCGCGGG - Intergenic
1019111983 6:169724138-169724160 CTCCCGCGCGGGCGGCGCGCTGG - Intronic
1020796800 7:12686830-12686852 CCGGCGCCCGGGCGGCGCGCGGG + Intergenic
1021313233 7:19117398-19117420 CCCGGGCCGGCGCCGCGCGCGGG - Exonic
1022102983 7:27180192-27180214 CTCGCGGGCGGGCGGCGGGCGGG - Intronic
1023435263 7:40135071-40135093 CTCCGGCCGGGGCGGCGGGAGGG + Exonic
1024919392 7:54542229-54542251 CTCGCGCCGGGCGGCCGCGGAGG - Intergenic
1029444393 7:100604424-100604446 CTCGCGCCTGGGGGGGGCCCTGG - Intronic
1029536998 7:101162953-101162975 CGCGCGCGGCGGGGGCGCGCGGG + Exonic
1031406720 7:121395923-121395945 CCCACGCCGGGGCGGCGGCCGGG + Intronic
1032037292 7:128530637-128530659 CGCCCTCCGGGGCGACGCGCGGG + Intergenic
1032306122 7:130733804-130733826 CCCGCGCCGGGGCTGGGGGCGGG + Exonic
1033186488 7:139231579-139231601 CTCCAGCCGGGGGGGCTCGCGGG - Exonic
1033222875 7:139540274-139540296 CTCGGGCTGGGGGGGCGGGCAGG + Intronic
1034147249 7:148884193-148884215 GGCGCGCGGGGGCGACGCGCGGG - Exonic
1034448114 7:151123657-151123679 GTCGGGCCGGGGCGGCGGGACGG - Intronic
1035266547 7:157692845-157692867 CTGGCTCGGGGGCGGCGCGGCGG + Intronic
1037297145 8:17413339-17413361 ATCGCGCCGCAGAGGCGCGCAGG - Intronic
1039608391 8:38901113-38901135 CGGGCGCCGGGGCCGCGCGGGGG - Intergenic
1039979126 8:42391808-42391830 CTCGGGGAGGGGCGGCGCGCAGG + Intronic
1040501453 8:48008670-48008692 CTCGCGCGTCGGCCGCGCGCCGG + Intronic
1044569387 8:93700515-93700537 CTCGCGCCGCCGCGGCAGGCCGG - Exonic
1045277483 8:100721320-100721342 CTCGGGCGGCGGCGGCGGGCGGG - Intronic
1048980723 8:139702355-139702377 CCCGCGCCGGGGCGGTGGGTGGG + Intronic
1049238599 8:141525252-141525274 CTGGGGCCGGGGCGGCGGGAAGG + Intergenic
1049936398 9:504863-504885 CGCGCGCCGGGGTTGCGCGGCGG + Intronic
1052300391 9:26946988-26947010 CTCGCTCCGGGGCCACGAGCTGG - Exonic
1055466507 9:76571794-76571816 CGCACGGCGGGGCGGCCCGCCGG - Intergenic
1057259593 9:93576450-93576472 GACGCGCGGGGGCGGCGGGCGGG - Exonic
1057432309 9:95005174-95005196 GTCGCGCCGGGGCGGAGTGCGGG + Exonic
1060176321 9:121499755-121499777 CTCGGGCGGAGGCGGCGCGGTGG - Intergenic
1060468721 9:123930116-123930138 CGCGCGCCGGGCACGCGCGCCGG - Intronic
1060770151 9:126326738-126326760 CGCGGGCCGCGGCGGCGGGCCGG - Intergenic
1061472176 9:130835348-130835370 GGGGCGCCGGGGGGGCGCGCGGG + Intronic
1062574578 9:137200262-137200284 CCCGCGGCGGCGCGGCGCGGCGG + Exonic
1203470434 Un_GL000220v1:113471-113493 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1203478255 Un_GL000220v1:157443-157465 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1185471532 X:386724-386746 CCCGGGGCGGGGCGGGGCGCGGG - Intronic
1187403652 X:18984131-18984153 CGCGCGGCGGGGAGGCGCGGGGG + Exonic
1189354230 X:40299095-40299117 CCCGGGCGGGGGCGGGGCGCGGG + Intergenic
1196124331 X:112082933-112082955 CTGGCGGCGGGGCGGGGCGGGGG + Intergenic
1196808019 X:119605892-119605914 CTCGGGCGGGGGCGGCGGGAGGG + Intronic
1198214603 X:134545082-134545104 CTTGCGCCGGGGCAGTGCGCGGG - Intergenic
1200163321 X:154019976-154019998 TGCGCGCCGCGGCCGCGCGCTGG + Exonic