ID: 1108546857

View in Genome Browser
Species Human (GRCh38)
Location 13:51503550-51503572
Sequence CGCTGAGTATGGTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108546857_1108546865 -3 Left 1108546857 13:51503550-51503572 CCCCCTCCCCACCATACTCAGCG No data
Right 1108546865 13:51503570-51503592 GCGTTTTCTATCAAAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108546857 Original CRISPR CGCTGAGTATGGTGGGGAGG GGG (reversed) Intergenic
No off target data available for this crispr