ID: 1108554699

View in Genome Browser
Species Human (GRCh38)
Location 13:51581692-51581714
Sequence CTCAAAGAGTATTCGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108554699 Original CRISPR CTCAAAGAGTATTCGGGAGA GGG (reversed) Intergenic
900459047 1:2791463-2791485 TTCAAACAGGATTCTGGAGAGGG + Intronic
901133752 1:6979644-6979666 CTCTAAGTGTTTTAGGGAGATGG - Intronic
905154169 1:35960261-35960283 CTCAAAGGATATTAGGGAAAAGG - Intronic
906741211 1:48187216-48187238 GTCAAAGAGTCCTCGGTAGAAGG + Intergenic
910689135 1:89948218-89948240 CTCAAAGAGTAAAAGGCAGATGG + Intergenic
911208961 1:95119602-95119624 CTCAAAGAGAAAGAGGGAGAAGG - Intronic
911371114 1:96995983-96996005 CACAAAGTATATTCTGGAGAGGG + Intergenic
912727020 1:112067623-112067645 CTGAAAGAGTATTTGAGAGTGGG - Intergenic
915490704 1:156248541-156248563 CTCAAATTGTATTCGGGGGGGGG - Intergenic
915729230 1:158041405-158041427 TTCAAAAAGTATTCTGGAGTTGG + Intronic
918179565 1:182074655-182074677 TTCAAAGAGTTTTGGGTAGAGGG + Intergenic
919245690 1:194980441-194980463 CCCAAAGATTACTCGGGAGCTGG + Intergenic
920845971 1:209593381-209593403 TTCAAGGAGTATGAGGGAGAGGG + Intronic
921564806 1:216703963-216703985 CTCAAAGACTTTTTGGGAAAAGG + Intronic
922629599 1:227092374-227092396 TGCAAAAAGTATTTGGGAGAGGG + Intronic
1065056340 10:21846645-21846667 TACAAAGAGTATTAGCGAGATGG + Intronic
1071164816 10:82793372-82793394 CTGAGACAGTATTAGGGAGAGGG + Intronic
1072683818 10:97525216-97525238 CTCACAGTGTAGTCTGGAGAGGG + Intronic
1072917486 10:99547962-99547984 CTCAAAGAGTTTTCTGGAGAAGG - Intergenic
1073764869 10:106671024-106671046 CTGAAAGAGGACTCGGAAGATGG - Intronic
1074051089 10:109881894-109881916 CTCAGAGAGGATTGGGGAGTTGG - Intronic
1081159978 11:39738431-39738453 CTCTAAAAGTATTAGGGCGATGG - Intergenic
1084673217 11:70619728-70619750 CCCAAAGAGAATGAGGGAGATGG - Intronic
1086986594 11:93257101-93257123 CTGCAAGGGTATTAGGGAGAGGG + Intergenic
1087818187 11:102682060-102682082 CTCAAAGACCATTCGGCAGAAGG + Intronic
1088585228 11:111355309-111355331 CTCGCAGAGCATTCAGGAGAAGG - Intronic
1091244906 11:134083920-134083942 TTCATAGAGAATTGGGGAGATGG + Intronic
1095088964 12:38086557-38086579 CTCACAGGGTATTGGGGAGGAGG + Intergenic
1107950368 13:45455816-45455838 CTCAAAGAGTTCTCTGGAGTAGG + Intergenic
1108554699 13:51581692-51581714 CTCAAAGAGTATTCGGGAGAGGG - Intergenic
1116019570 14:39443887-39443909 CTCAAAGTGTGTTCTGTAGACGG + Intergenic
1116321265 14:43466574-43466596 CTCAAACAGTATTCAGCAAATGG - Intergenic
1117439412 14:55745941-55745963 CTCAGAGTGTATCTGGGAGAGGG - Intergenic
1125725007 15:41863703-41863725 CACCAAGAGGATTCAGGAGAAGG - Exonic
1128345673 15:66851007-66851029 CTCACAGGGTTTTCGGGGGAGGG + Intergenic
1134611433 16:15611950-15611972 CTCAACGACTGTTTGGGAGAAGG - Intronic
1137476416 16:48813383-48813405 CTCCAAGAAAATTCTGGAGAAGG - Intergenic
1146218779 17:31000328-31000350 CTCAAAGACAATAAGGGAGAGGG + Intergenic
1148368451 17:47074291-47074313 CTCAGAAAGTAGTCAGGAGAAGG + Intergenic
1150629954 17:66872947-66872969 CTCAAAGAGTGTTGGGAAGAAGG - Intronic
1155023815 18:21922503-21922525 CTCTCTGAGTATTAGGGAGAGGG + Intergenic
1157571668 18:48716408-48716430 CTCCAGGAGGATTTGGGAGATGG + Intronic
1164907208 19:31977254-31977276 CACAAAAGATATTCGGGAGAAGG - Intergenic
933395258 2:81723276-81723298 CTCAAAGAGTAGTTGTGAAAGGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935048063 2:99499360-99499382 CCTAAAGAGTATGGGGGAGAAGG + Intergenic
943538917 2:189187143-189187165 CTCAAAGAGTATGTGTGAGCTGG - Intergenic
943975997 2:194478439-194478461 CTTAAAGAGAATTCCTGAGAAGG + Intergenic
1168823705 20:794385-794407 CCTAAAGAGTATGGGGGAGAAGG + Intergenic
1168973906 20:1949881-1949903 CTCAGAGAGTGGTGGGGAGAAGG - Intergenic
1174178594 20:48660436-48660458 ATCATAGAGTATTCTGCAGATGG + Intronic
1176019710 20:62956437-62956459 CTCAAAGAGAACAGGGGAGAGGG - Intronic
1181875667 22:25938661-25938683 CTCGATGAGTAATCGGGAAAGGG + Intronic
1182120613 22:27784077-27784099 CTCAGAGGGTACTCGGGAGCTGG + Intronic
949949509 3:9217532-9217554 TTCAAAGGGTATTCGGGGCAGGG + Intronic
951262005 3:20521203-20521225 CTCAATGAATATTCAGGAGCAGG + Intergenic
953878109 3:46677779-46677801 ATCAAGGAGTATTCCAGAGAAGG - Intronic
958888927 3:99761693-99761715 GTCAGAGAGTATTGGAGAGAGGG - Intronic
961582347 3:127893039-127893061 CTCAGAAAGTATACGTGAGAAGG + Intergenic
962415884 3:135181500-135181522 ATCAAAGAGTGTTGGGGAGGCGG + Intronic
964176991 3:153835849-153835871 CTCAAAGAGTATACAGGGAAAGG - Intergenic
965681248 3:171253694-171253716 TTCAGAGAGGATTCGGGAGAAGG - Intronic
965819547 3:172671256-172671278 CTCAAAGAATTTTATGGAGATGG + Intronic
966032672 3:175369861-175369883 CTCAAAGAATTTTATGGAGATGG - Intronic
966683522 3:182669080-182669102 CTCAAAGACTATTAGGGAATAGG + Intergenic
967748347 3:193084659-193084681 CTCATAGAGTATACATGAGAAGG - Intergenic
970472057 4:16388817-16388839 CTCAAAGAGAAATGGGGAAAGGG - Intergenic
972562876 4:40243999-40244021 CCCAAAGACTAATGGGGAGAGGG + Exonic
973675808 4:53261478-53261500 CCCAAAGATTATTCAGGAGCAGG + Intronic
976788027 4:88844835-88844857 GTCAAAGAGCATTCTGGAGTTGG + Intronic
978279647 4:106994887-106994909 CTCAAACAGTTCTAGGGAGATGG + Intronic
980834650 4:138176038-138176060 ATCATAGAGTAGTTGGGAGAAGG + Intronic
983162951 4:164439885-164439907 CTCACAGAGAAGTCTGGAGAGGG + Intergenic
988043560 5:25918383-25918405 CTCAAAAGTTATTCGGGAGCAGG - Intergenic
988730793 5:33970705-33970727 CTCAAAAAATATTGGTGAGATGG - Intronic
993221129 5:85098525-85098547 ATCAAAGAGTCCTAGGGAGATGG - Intergenic
994465077 5:100116787-100116809 CAGAAAGAGTAGTCGGCAGAGGG - Intergenic
995881098 5:116845480-116845502 ATCAAAGAATAATAGGGAGAAGG - Intergenic
996875143 5:128232692-128232714 CCCAAAGATTATTCAGGAGCAGG + Intergenic
997777771 5:136626823-136626845 TTCAATGAGGATTCTGGAGAAGG + Intergenic
998592171 5:143489363-143489385 GTCAAAGAGGATTGGGAAGAGGG - Intergenic
1007376733 6:41462081-41462103 CTCTATGAGTCTTTGGGAGAGGG - Intergenic
1009002295 6:57733670-57733692 CTGAAAGACTGTTTGGGAGATGG - Intergenic
1010666615 6:78638238-78638260 CTCAAATAGTAATCTGGAAAGGG - Intergenic
1012192195 6:96293959-96293981 CTCAGAGAGAATTTGGGAGGGGG + Intergenic
1013599430 6:111690540-111690562 CTCAAACACTATTCAGGAAAGGG - Intronic
1016690283 6:146930098-146930120 GGCAAAGAGCATTCAGGAGAAGG - Intergenic
1018378552 6:163236306-163236328 ATGAAAGAGTATTCAGAAGAAGG - Intronic
1019183489 6:170207686-170207708 CTCAGAGGGGACTCGGGAGAGGG - Intergenic
1020608801 7:10369639-10369661 CCCAAAGATTATTCAGGAGCAGG - Intergenic
1023846312 7:44122738-44122760 CTCTATAAGTATACGGGAGAGGG - Intronic
1026039881 7:66859425-66859447 TTAAAAGAGTATTGGGGAGCAGG - Intergenic
1028202289 7:87975933-87975955 CTCAAAGAGCTTTAGGTAGAGGG + Intronic
1029867167 7:103646016-103646038 CTCAAAGATCATTCAGGAGCAGG - Intronic
1030456097 7:109775692-109775714 CTCAAAGATTATTCAGAAGCAGG - Intergenic
1031907251 7:127474428-127474450 CTCAAAGAGAAGTAGGGGGAAGG - Intergenic
1038409218 8:27345158-27345180 CTCAAAAAGGGTTAGGGAGAGGG + Intronic
1039251840 8:35674545-35674567 CTAAAAGAGTATTTGGCACATGG + Intronic
1051471434 9:17447300-17447322 CCCAAAGTGTATTCGTGAGCTGG - Intronic
1057387835 9:94620156-94620178 CTCAGGGAGGATTCGAGAGATGG + Intronic
1058157901 9:101535249-101535271 CTCAAAGAGAAATATGGAGATGG + Intronic
1060514480 9:124257499-124257521 CTCCAAGAGTATTCCGATGAGGG - Intergenic
1060744391 9:126120865-126120887 ATCAAAGAATATTCTGGAAAAGG + Intergenic
1061807101 9:133142651-133142673 CTCAAAGAGTCTTAGGGCCAGGG - Intronic
1062228656 9:135468465-135468487 CTTAAAGTGTATTCTGGAGTTGG - Intergenic
1189606091 X:42679658-42679680 ACCACAGAGCATTCGGGAGAGGG - Intergenic
1192688425 X:73332397-73332419 CTCAATGATTATTCAGGAAAAGG + Intergenic
1193643732 X:84042700-84042722 CTCAATGATTATTCATGAGAAGG + Intergenic
1194395043 X:93372954-93372976 CTCAAGGAGAATTTGGGAGCTGG + Intergenic
1194438859 X:93904232-93904254 CTCAAAGATCATTCTGGAGCAGG + Intergenic