ID: 1108555617

View in Genome Browser
Species Human (GRCh38)
Location 13:51588873-51588895
Sequence CTGGATAAAAAGGCCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108555611_1108555617 9 Left 1108555611 13:51588841-51588863 CCCTTTGGTTGAAAGATTTCAGG 0: 1
1: 1
2: 1
3: 16
4: 183
Right 1108555617 13:51588873-51588895 CTGGATAAAAAGGCCTGTGTTGG 0: 1
1: 0
2: 0
3: 7
4: 170
1108555613_1108555617 8 Left 1108555613 13:51588842-51588864 CCTTTGGTTGAAAGATTTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1108555617 13:51588873-51588895 CTGGATAAAAAGGCCTGTGTTGG 0: 1
1: 0
2: 0
3: 7
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108555617 Original CRISPR CTGGATAAAAAGGCCTGTGT TGG Intronic
903607931 1:24588689-24588711 TTGTTTACAAAGGCCTGTGTGGG - Intronic
904751382 1:32742843-32742865 CTGGAGAAACATGCCAGTGTCGG + Intronic
906750303 1:48252661-48252683 CTGGAGAAAAAGGCATGTTGAGG + Intergenic
907317370 1:53581025-53581047 CTGGATAAGAACGCCTCTCTGGG + Intronic
908518429 1:64917067-64917089 ATGGAGAAAAAGACCTGTTTGGG + Intronic
911726763 1:101249654-101249676 ATTTATAAAAAGGCCAGTGTTGG + Intergenic
915167356 1:153955723-153955745 CAGAAAAAAAAGGCCAGTGTTGG + Intronic
916849813 1:168692122-168692144 ATGGATAAATAGGCCTGCATTGG + Intergenic
917269147 1:173254473-173254495 CAGGATAAAATGGTCTGTTTTGG + Intergenic
919435409 1:197553506-197553528 CTGGGTAAACAGGCCTGGCTGGG - Intronic
920184308 1:204151028-204151050 CTGGGGAAGATGGCCTGTGTGGG + Intronic
920770318 1:208878539-208878561 CTGGAAAATAAGCTCTGTGTAGG - Intergenic
923698632 1:236279793-236279815 CTGGATGCAATGGCATGTGTTGG - Intronic
1063944600 10:11164786-11164808 CTGGAGAAAAAGGCCGGAGCTGG - Intronic
1071679306 10:87688786-87688808 CTGAATAAGAAGGACTGTTTGGG - Intronic
1071694447 10:87857201-87857223 CTGTATAAAGAAGCCTGGGTTGG + Intergenic
1073235809 10:102014994-102015016 TTGGTTAAATAGGTCTGTGTGGG - Intronic
1073422356 10:103434569-103434591 CTTGAGAAAAACACCTGTGTAGG - Intronic
1075176053 10:120162304-120162326 CTGGAGGGCAAGGCCTGTGTGGG + Intergenic
1079738930 11:24033984-24034006 CTGGATATAAAAGTCTGGGTTGG + Intergenic
1081572954 11:44302830-44302852 CTGGACAAAAATGCGTGTGGGGG + Intronic
1082771535 11:57211363-57211385 CTGCAGAAGAAGGCCTGGGTTGG + Intergenic
1085227504 11:74935670-74935692 CTGGAAAAAGAGGTCTGTTTTGG + Intronic
1085528701 11:77179156-77179178 CTGGGTTCAAAGGCCTGTTTGGG - Intronic
1087002586 11:93435661-93435683 CTGGAAAGAAAGAGCTGTGTAGG - Intronic
1092241451 12:6838705-6838727 CTGGATTCAAAGGGCTGAGTGGG + Intronic
1094546180 12:31406593-31406615 CTGCAGAAAAAGGCATGTTTAGG + Intronic
1095663310 12:44763569-44763591 CTGGTTAAAAAGGCTTGAATAGG + Intronic
1098574411 12:72024712-72024734 CTGGTTAATGAGGCATGTGTGGG + Intronic
1099449730 12:82794360-82794382 CAGAAAAAAAGGGCCTGTGTTGG + Intronic
1102838061 12:116086002-116086024 CTGGATAAAATGGCTTCTGCTGG + Intronic
1103283862 12:119784070-119784092 CAGGTTAAAAAGGCCCGTGGAGG + Intronic
1104427438 12:128689813-128689835 CTGGTTACAAATGCCCGTGTGGG + Intronic
1108497449 13:51039703-51039725 CTGGAAAAAAAGTCTTGGGTGGG - Intergenic
1108555617 13:51588873-51588895 CTGGATAAAAAGGCCTGTGTTGG + Intronic
1109222407 13:59653642-59653664 CTGGACAGGGAGGCCTGTGTTGG + Intergenic
1109432132 13:62249873-62249895 CAGGAGAAAATGCCCTGTGTAGG + Intergenic
1110276729 13:73649244-73649266 CTGCAGAAAGGGGCCTGTGTAGG + Intergenic
1110493427 13:76136364-76136386 CTACATAAAAAGGCCCATGTGGG + Intergenic
1111404734 13:87788824-87788846 ATGGGTAAAATGGCCTGTATGGG + Intergenic
1114743418 14:25121369-25121391 CTGGTTCAGTAGGCCTGTGTGGG + Intergenic
1119423179 14:74520083-74520105 CTGGAGGAAGAGGCCAGTGTGGG - Intronic
1127002430 15:54525286-54525308 CTAGATAACAAAGCCTTTGTTGG - Intronic
1129754691 15:78090509-78090531 CAAGATAAAAATGCCTGTGAGGG - Intronic
1130648280 15:85747344-85747366 CTGGATCTAATGGCCTGTCTTGG + Intronic
1131448317 15:92518184-92518206 CTGGATTAGAAGGCCAGTCTTGG - Intergenic
1135185054 16:20308459-20308481 CTGGGTATACAGGCCTGTGTGGG + Intergenic
1136767783 16:32803321-32803343 CTGGATAAAATGGCCTACGGTGG + Intergenic
1136800366 16:33067376-33067398 CTGGATAAAATGGCCTACGGTGG - Intergenic
1138123307 16:54418207-54418229 CTGGATAAAAAGTTCTATGGAGG + Intergenic
1139188905 16:64838955-64838977 CTGGTACAAAAGTCCTGTGTTGG + Intergenic
1203070174 16_KI270728v1_random:1065343-1065365 CTGGATAAAATGGCCTACGGTGG + Intergenic
1144281547 17:13732011-13732033 CTGGAGAACAATGCCTGTCTGGG - Intergenic
1144372730 17:14607491-14607513 TTGGATGAAAATGCCTGTGATGG + Intergenic
1146773400 17:35589579-35589601 CTGGATATATAGTCCTGTGCAGG + Intronic
1149301455 17:55307995-55308017 CTAAATACAAAGGCCTGGGTGGG + Intronic
1153081755 18:1234985-1235007 CTGGATACAAAATTCTGTGTTGG + Intergenic
1153173210 18:2339931-2339953 CTGGATAAAAGGTAATGTGTGGG - Intergenic
1157709761 18:49842327-49842349 GTGGATAAAATTGCCTGTGGAGG + Intronic
1162743282 19:12785619-12785641 CTGGATGCAAAGGTCTATGTAGG - Intronic
1165356440 19:35307213-35307235 CTGAATAAAAAGTCCTGTTCGGG - Intronic
1166254726 19:41595245-41595267 TTGAATAAAAAGATCTGTGTGGG + Intronic
1166351247 19:42199433-42199455 CTGGATCAGGAGGCCTCTGTCGG + Exonic
925618439 2:5766651-5766673 CTTGCTACAAAGGCCTGTTTTGG + Intergenic
928697507 2:33864065-33864087 CTAGAAAAAAAGTCCTGTCTGGG + Intergenic
933587390 2:84194301-84194323 CAGGATATAAAGCCCAGTGTGGG + Intergenic
933741393 2:85537450-85537472 CTGGAACAAAATGCGTGTGTAGG - Intergenic
935889294 2:107658272-107658294 CTGTAAAAGAAGCCCTGTGTGGG - Intergenic
937773904 2:125753147-125753169 CTGGAAATAAAGACCTGTTTAGG - Intergenic
938979553 2:136513363-136513385 GTGAATAAAAAGGCCTGGGAAGG + Intergenic
941049824 2:160720400-160720422 ATGGATAAAAAAGCCTGTCATGG - Intergenic
943092149 2:183388476-183388498 CTGGATATAAAATTCTGTGTTGG + Intergenic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
948784362 2:240344139-240344161 CAGGAGAGAGAGGCCTGTGTTGG + Intergenic
1173979443 20:47211856-47211878 CCTGGTAAAAAGGCATGTGTGGG + Intronic
1177112994 21:17050876-17050898 CTGGATAAATAGGTTTGTGTGGG + Intergenic
1181365353 22:22372328-22372350 GTGGATAAAAATGCCTGGGAGGG - Intergenic
1182038773 22:27219946-27219968 CTGGGTAAAAAGGGATGAGTAGG + Intergenic
1182799771 22:33022536-33022558 CAGGAGATCAAGGCCTGTGTGGG - Intronic
951805826 3:26642611-26642633 GTAGAGAAACAGGCCTGTGTGGG - Intronic
955352576 3:58204740-58204762 CCAGACAGAAAGGCCTGTGTGGG + Intronic
956740475 3:72271827-72271849 CTGAATAAAAAGTGCTGGGTGGG + Intergenic
956980613 3:74633158-74633180 CTGGAGATAAAGGCCAGTGTAGG - Intergenic
957403029 3:79741595-79741617 CTTGATAAAATGCCATGTGTTGG + Intronic
958064581 3:88527273-88527295 CTGGATATGAAGTCCTTTGTTGG + Intergenic
959257984 3:104038660-104038682 CTAGATAATTAGTCCTGTGTTGG - Intergenic
960522700 3:118674016-118674038 CTGGATTTAAATGCCTGTGAAGG - Intergenic
961464008 3:127070597-127070619 GTGGATAAGAAGGGCTGTGGGGG - Intergenic
962447577 3:135480925-135480947 CAGGACAAAAGGGCCTGTGAAGG - Intergenic
962869640 3:139476764-139476786 CTGGATGAAATGTTCTGTGTGGG - Intronic
963001480 3:140685613-140685635 CTGAATCAATGGGCCTGTGTTGG - Intronic
963131085 3:141858460-141858482 CTGAAGAAACAGCCCTGTGTGGG + Intergenic
964526742 3:157622800-157622822 CTGCAGAAAAAAGTCTGTGTGGG - Intronic
966435390 3:179878045-179878067 CTGGAGAAAAAGAACTGAGTAGG - Intronic
966567769 3:181402466-181402488 CTGGCTAAACAGGACTCTGTGGG + Intergenic
970715244 4:18913822-18913844 CTGGATACATAGGTGTGTGTAGG - Intergenic
973266377 4:48215208-48215230 TTTTATAAAAAGGCCTGTGCCGG + Intronic
973872616 4:55181493-55181515 ATAGAGAAAAAGGCCTGGGTTGG - Intergenic
976321644 4:83723752-83723774 CTGTGTATGAAGGCCTGTGTGGG + Intergenic
977981409 4:103327395-103327417 CTGGTTAAAAATGCCTTTGATGG - Intergenic
980693633 4:136328564-136328586 CTGGAGAACAAGGCCTGCGGGGG - Intergenic
984340752 4:178453090-178453112 ATGCATATAAAGGCCCGTGTAGG - Intergenic
984426466 4:179593524-179593546 CTGGATAAAGAAAACTGTGTGGG - Intergenic
986617098 5:9629003-9629025 CTGGATAAACAGGCCTGAAGGGG + Exonic
986993001 5:13575642-13575664 CTGGACAATGAGTCCTGTGTGGG + Intergenic
987048518 5:14129647-14129669 CTAGTTGTAAAGGCCTGTGTAGG - Intergenic
987286290 5:16461019-16461041 CAGGATAAAAAGGATTGGGTAGG + Intronic
988035049 5:25817129-25817151 CTGGACAAAAAGGGCTTTCTGGG + Intergenic
988302569 5:29449830-29449852 CTTGCTAGAAAGCCCTGTGTAGG + Intergenic
991762204 5:69930093-69930115 CTTGCTAGAAAGCCCTGTGTAGG - Intergenic
991785124 5:70188007-70188029 CTTGCTAGAAAGCCCTGTGTAGG + Intergenic
991841432 5:70805142-70805164 CTTGCTAGAAAGCCCTGTGTAGG - Intergenic
991877571 5:71188405-71188427 CTTGCTAGAAAGCCCTGTGTAGG + Intergenic
993251132 5:85524442-85524464 CTGTATAAAAAAGACTGTATGGG - Intergenic
993770106 5:91916244-91916266 CTGGCTAAAACAGCCTGGGTTGG + Intergenic
996356913 5:122605505-122605527 CTGGATACCAAGGGCTGGGTGGG - Intergenic
997133032 5:131295983-131296005 CTGGATAAAAAGAAATGTGTTGG - Intronic
997379106 5:133422458-133422480 CGGGGTAAGAAGGACTGTGTAGG + Intronic
999396319 5:151231108-151231130 CTGGATAGAAAGGCTGGTTTTGG + Intronic
999523055 5:152372526-152372548 CTGGGTAAAAAGGCAAATGTAGG - Intergenic
1000682989 5:164209954-164209976 CTGGATAAACAGCCATCTGTGGG - Intergenic
1001143347 5:169163463-169163485 CTGGCTCAGAAAGCCTGTGTCGG - Intronic
1003022987 6:2528205-2528227 CTGGGTCAAGAAGCCTGTGTTGG + Intergenic
1003120571 6:3316044-3316066 CTGAATAAAAACGCCTGTGGTGG - Intronic
1004413280 6:15401085-15401107 TTGGAGAAATAGGCCTTTGTGGG + Intronic
1005306459 6:24518728-24518750 CTGGAAAGCTAGGCCTGTGTGGG - Intronic
1007546004 6:42695268-42695290 GTGGATGAAAAGCCCTGTCTTGG + Intergenic
1009005863 6:57785737-57785759 CTTGCTAGAAAGCCCTGTGTAGG + Intergenic
1010935802 6:81859990-81860012 CAGGATATGAAGGCCTGTTTTGG - Intergenic
1011181421 6:84625905-84625927 CTGGACCAAAAGGCCTTTGGAGG - Intergenic
1016628174 6:146196875-146196897 ATCGATACAAAGCCCTGTGTTGG + Intronic
1018613939 6:165668238-165668260 CTGGATAAAAAGGGTTGGCTGGG + Intronic
1018963426 6:168465046-168465068 CTGGCCAAGAAGGTCTGTGTGGG - Intronic
1021485853 7:21167719-21167741 CAAGATAAAAACGCATGTGTTGG - Intergenic
1022738256 7:33096332-33096354 ATGGCTGAAAAGGCCAGTGTTGG - Intronic
1025196744 7:56940149-56940171 CTGCATACACAGGCTTGTGTGGG + Intergenic
1025482469 7:60999522-60999544 CTGGATAAAATGGCCTACCTTGG - Intergenic
1029967609 7:104756108-104756130 CTGGATAAATAGTGCTGTTTGGG + Intronic
1030418468 7:109275775-109275797 TTGAATAAATAAGCCTGTGTTGG + Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031153400 7:118081099-118081121 CTGTATAAAAAAGAATGTGTGGG + Intergenic
1032531671 7:132626001-132626023 CTGAATAGAGAGGCCTGTGAGGG - Intronic
1034218967 7:149429950-149429972 CTGGATGAAAGGGCCTGTCTAGG - Intergenic
1035606179 8:931091-931113 CTGAATAGAAACGCATGTGTAGG + Intergenic
1035957270 8:4094789-4094811 CTGGATAAACAGGCCTGCCAGGG + Intronic
1038444904 8:27596532-27596554 CTGGATATAAAGGCCTGGCACGG + Intergenic
1038849561 8:31262329-31262351 CAGGATTAAATGGCCTGTATGGG + Intergenic
1038995769 8:32921264-32921286 CTGGATGAAAAGCTCTGTGGTGG + Intergenic
1039707906 8:40026120-40026142 CTGGATAAGAAGACATGTCTAGG + Intergenic
1040695992 8:49999581-49999603 CTGTATAAAGAGGCCCATGTAGG - Intronic
1042310441 8:67373945-67373967 CTCTATAAAAATTCCTGTGTGGG + Intergenic
1042855409 8:73261802-73261824 CTGGTTCCAAAGGCCTGTTTTGG + Intergenic
1044450794 8:92334146-92334168 CTGGATATAAAATCCTGGGTTGG + Intergenic
1047207749 8:122817301-122817323 CAGGATAAAAGGGCCTGTAAAGG - Intronic
1048200893 8:132373104-132373126 CTGGTGAAAAAGGCCTGCATGGG - Intronic
1048293585 8:133198464-133198486 CTGGGAAAACAGGCTTGTGTAGG - Intronic
1048522349 8:135168554-135168576 CTTGATAAGAAGGCATGTTTGGG - Intergenic
1048695104 8:137018935-137018957 CTTGATTGAAAGGCCTGTTTTGG + Intergenic
1050776100 9:9262538-9262560 CTGTATAAAAAGGCATATCTTGG - Intronic
1050999326 9:12260651-12260673 TTGGATAAAAATGCTTGTTTAGG + Intergenic
1051521639 9:17995803-17995825 CTGGATAAAAATGCTGGTGCTGG + Intergenic
1051577658 9:18635201-18635223 CTGAATAAGAATGCCTGTGATGG + Intronic
1052400471 9:27993813-27993835 TTGGATAAAATGTTCTGTGTCGG - Intronic
1059551772 9:115236290-115236312 CTTGAAAAAAAGCCATGTGTTGG - Intronic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1062147707 9:134999219-134999241 CTGGCTTAAAATGCCTGAGTAGG - Intergenic
1186589282 X:10912782-10912804 CTGGGTATAAAATCCTGTGTTGG + Intergenic
1187525536 X:20050868-20050890 CTGGCTAAAGAAGACTGTGTGGG + Exonic
1189910269 X:45804193-45804215 CTGGAAACTATGGCCTGTGTTGG + Intergenic
1190750648 X:53358782-53358804 CTGTATACCAAGCCCTGTGTTGG + Intergenic
1196624642 X:117864356-117864378 CTGGATAAAAATGACTGAGGGGG - Intergenic
1198627757 X:138597566-138597588 CTGGATAAAAATGTAGGTGTGGG - Intergenic
1199252988 X:145685995-145686017 CTGGATAAAGAGGACTCTGAAGG - Intergenic
1199764626 X:150932042-150932064 GTGGTTAAAAATCCCTGTGTTGG + Intergenic
1202167593 Y:22007645-22007667 CTCTATAAAAATGCCTGTTTGGG - Intergenic
1202223767 Y:22578724-22578746 CTCTATAAAAATGCCTGTTTGGG + Intergenic
1202319349 Y:23616937-23616959 CTCTATAAAAATGCCTGTTTGGG - Intergenic
1202551420 Y:26053120-26053142 CTCTATAAAAATGCCTGTTTGGG + Intergenic