ID: 1108556874

View in Genome Browser
Species Human (GRCh38)
Location 13:51602063-51602085
Sequence ATGCATTTATTGTTGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108556874 Original CRISPR ATGCATTTATTGTTGGAACA GGG Intronic
901286618 1:8084812-8084834 ATGTATTTATTTTTGAGACAGGG + Intergenic
902063312 1:13663566-13663588 TTGCATTTATAGTAGGGACAGGG + Intergenic
903593792 1:24478747-24478769 ATGTATTTATTGTAGAGACAGGG - Intergenic
903606634 1:24579720-24579742 ATTTATTTATTTTTGAAACAAGG - Intronic
905745939 1:40417371-40417393 CTGCATTCATTGTTTGTACAGGG - Intronic
906089031 1:43161841-43161863 ATTTATTTATTGTAGGGACAGGG - Intergenic
906207436 1:43994743-43994765 AGGTATTTATTTTTGAAACAGGG - Intronic
907116028 1:51969278-51969300 ATGTATTTAATGTTGAGACAGGG - Intronic
907935365 1:59036813-59036835 TTGCATTTTTAGTTGAAACAGGG - Intergenic
908953079 1:69586400-69586422 ATGACTTTATTGATGGTACATGG + Intronic
909987549 1:82181403-82181425 ATTCATTTATTTTTGAGACAAGG + Intergenic
910356434 1:86362304-86362326 ATTAATTTATTTTTGAAACAGGG + Intronic
911926795 1:103842879-103842901 ATGTATTTATTTTTGATACAGGG - Intergenic
912666920 1:111589716-111589738 ATTAATTTATTTTTGCAACAGGG + Intronic
912943455 1:114065647-114065669 GTGCATTTCTGGTTGGAAAAAGG - Intergenic
913134631 1:115876212-115876234 ATTTATTTATTTTTGCAACAAGG - Intergenic
915155785 1:153874878-153874900 ATTTATTTATTTTTGAAACAGGG + Intronic
916093404 1:161327099-161327121 TTGCATTTTTTGTGGAAACAGGG + Intronic
916306661 1:163342792-163342814 ATGCATATGATGTTGGAAAAAGG - Intronic
917326830 1:173841790-173841812 ATGTATTTATTTTTGAGACACGG - Intronic
917374556 1:174335682-174335704 TTGCATTTATACTTGTAACATGG + Intronic
918193588 1:182200073-182200095 TTGCATTTTTTGTAGAAACAGGG - Intergenic
919948782 1:202342879-202342901 ATGCATCTAGCGTTGGAAGATGG - Intergenic
922936806 1:229429352-229429374 ATTTATTTATTTTTGAAACAGGG + Intergenic
923042732 1:230331407-230331429 ATTTATTTATTTTTGGGACAGGG - Intronic
923759662 1:236829802-236829824 ATGAATTTTGTGTTGAAACAAGG + Intronic
924021777 1:239791109-239791131 ATTCATTTATTTTTGAGACAGGG + Intronic
924859010 1:247901967-247901989 ATGAACTTAGTGTTGGAAGATGG + Intergenic
1063392867 10:5661501-5661523 ATTTATTTATTTTTGAAACAGGG + Intronic
1064595007 10:16935176-16935198 ATGTATTTATTTTTAGGACAGGG + Intronic
1064973764 10:21092183-21092205 TTTCATTGATTGTGGGAACAAGG + Intronic
1065763593 10:29006440-29006462 ATGTATTTATTTTTGAGACAGGG - Intergenic
1066701690 10:38136316-38136338 TTGCATTTTTAGTAGGAACAGGG + Intergenic
1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG + Intergenic
1069312761 10:67059232-67059254 ATGTATTTATTTTTGGAAAATGG - Intronic
1070208947 10:74294860-74294882 ATGTATTTATTTTTGAGACAGGG + Intronic
1070285566 10:75081031-75081053 TTTCATTTTTTGTTGAAACAGGG + Intergenic
1071550233 10:86560987-86561009 ATGCATTTTTTGTAGAAGCAGGG - Intergenic
1072181197 10:92982161-92982183 ATGAATTTACTGTTGGCATATGG + Intronic
1074952348 10:118350245-118350267 ATGCATTTTTTGTTGTTGCATGG + Intergenic
1081197629 11:40180567-40180589 ATGATTTTTTTGTTGGAATATGG + Intronic
1081889087 11:46525292-46525314 ATTTATTTATTTTTGAAACAGGG - Intronic
1084362603 11:68678497-68678519 ATGCATTTAGTTCTGGATCATGG - Intergenic
1084536407 11:69759888-69759910 AGGCATTTCTAGGTGGAACATGG + Intergenic
1085620984 11:78037811-78037833 ATTTATTTATTTTTGAAACAGGG - Intronic
1085949778 11:81316131-81316153 CTGCATTTAGTGTTTGAATAGGG - Intergenic
1087254818 11:95941627-95941649 AAACATTTATTGTTAAAACAGGG - Intergenic
1087478424 11:98667364-98667386 ATTCATTTATTTTTGAGACAGGG - Intergenic
1087783251 11:102324355-102324377 ATGCATTTAGAGTTTCAACATGG - Exonic
1088932592 11:114366915-114366937 ATGCATTTGTTGTAGGAACAAGG - Intergenic
1091553687 12:1555776-1555798 ATGTATTTATTTTTGAGACAGGG + Intronic
1091568599 12:1664866-1664888 ATTCATTTATTTTTGAAACAGGG - Intergenic
1092371727 12:7922235-7922257 TTGTATTTATTGTAGAAACAGGG + Intronic
1092427152 12:8384130-8384152 ATTTATTTATTTTTGAAACAGGG + Intergenic
1093472413 12:19516852-19516874 TTGCATTTTTAGTTGAAACAGGG - Intronic
1094204215 12:27823628-27823650 ATGACCTTATTGTTGGAAAATGG - Intergenic
1095607259 12:44084196-44084218 ACATATTTATTATTGGAACAAGG + Intronic
1096025889 12:48360641-48360663 ATGTATTTATTTTTGAGACAGGG - Intergenic
1096030713 12:48411681-48411703 ATCCAATTAGTGTTGGAACTAGG - Intergenic
1096118965 12:49074272-49074294 ATTTATTTATTTTTGAAACAGGG + Intergenic
1096330302 12:50706145-50706167 ATTCATTTACTGTTGGAATTAGG - Intronic
1096734481 12:53641864-53641886 ATTTATTTATTTTTGAAACAGGG - Intronic
1097431790 12:59518411-59518433 CTGCATTTAATGTTGCAACTAGG - Intergenic
1098375783 12:69812299-69812321 ATGCATTTAATGTGGGACCTAGG - Intronic
1099068167 12:78010040-78010062 ATTTATTTATTGTAGAAACAGGG - Intronic
1099352412 12:81590500-81590522 ATTTATTTATTTTTGAAACAGGG + Intronic
1099365654 12:81763275-81763297 CTGCATTTATTGTTGCAAGTTGG + Intergenic
1099821508 12:87716973-87716995 CTGCATTTAATGTTGGAACTTGG - Intergenic
1100308095 12:93369885-93369907 ATGAATTTATTTTTGAGACAGGG + Intergenic
1101144318 12:101827134-101827156 ATGTATTTATTTTTGAGACAAGG + Intronic
1101661743 12:106772534-106772556 ATATATTTATTTTTGGAGCAAGG - Intronic
1103385762 12:120531324-120531346 TTGCATTTTTTGTTGAGACAGGG + Intronic
1103757998 12:123225269-123225291 TTGCATTTTTTGTTGAGACAAGG - Intronic
1104510478 12:129373240-129373262 ATGCAGTTATTATTGGAATGAGG - Intronic
1106332139 13:28748978-28749000 TTGCATTTATAGTAGAAACAGGG + Intergenic
1107273681 13:38651956-38651978 ATAGATTTATAGTTGGAAAAGGG + Intergenic
1107357468 13:39583345-39583367 ATGTATTTTTTGTAGAAACAGGG + Intronic
1108312450 13:49208982-49209004 ATCCATTTCTTTTTTGAACAAGG - Exonic
1108556874 13:51602063-51602085 ATGCATTTATTGTTGGAACAGGG + Intronic
1109909159 13:68887963-68887985 ATGCATATATTTCTGGTACAAGG + Intergenic
1110754074 13:79151293-79151315 ATGCATTTTTTATTGAAAAAGGG - Intergenic
1111918673 13:94388003-94388025 ATGCAGTTATTGTTGATCCAGGG + Intronic
1112858460 13:103800595-103800617 ATTCATCTATTGTTGAAAGAGGG + Intergenic
1116009501 14:39334300-39334322 TTGTATTTTTTGTAGGAACAGGG - Intronic
1117577170 14:57111127-57111149 ATGCATTTATTGTACTGACAAGG - Intergenic
1118047862 14:61991978-61992000 ATTCATTCATTCATGGAACATGG + Intergenic
1118838907 14:69496530-69496552 ATTTATTTATTTTTGCAACAGGG + Intronic
1118943586 14:70361400-70361422 ATTTATTTATTTTTGAAACAGGG - Intronic
1119046667 14:71324212-71324234 ATTCATGGATTGTTGGAACTAGG + Intronic
1119494280 14:75065078-75065100 ACGAATTTATTTTGGGAACAGGG + Intronic
1120608927 14:86614940-86614962 ATTCATTTATTTTTGAGACAGGG - Intergenic
1121060382 14:90902593-90902615 ATGCATTTATTTTTGATATAAGG - Intronic
1121102007 14:91255819-91255841 ATTTATTTATTTTTGAAACAGGG + Intergenic
1121531031 14:94653686-94653708 ATGTATTTATTTTTGAGACAGGG + Intergenic
1121978058 14:98424544-98424566 ATACATTTATTTTTGAGACAGGG + Intergenic
1123431664 15:20222905-20222927 TTGTATTTTTTGTTGGGACAGGG - Intergenic
1126008965 15:44284721-44284743 ATGTATTTATTCTTGACACAGGG + Intergenic
1127250638 15:57233501-57233523 ATGTATTTATTTTTGAGACAGGG + Intronic
1127501036 15:59554348-59554370 ATGCATTTATTGTGAGCACAAGG + Intergenic
1129767071 15:78176919-78176941 ATTTATTTATTTTTGAAACAGGG - Intronic
1134225355 16:12385819-12385841 AAGAATTTATTGTTGGAAAACGG + Intronic
1135048751 16:19175118-19175140 ATGTATTTATTTTTGAGACAGGG - Intronic
1135109818 16:19681853-19681875 CTGCTTTTGTGGTTGGAACAGGG + Intronic
1135567051 16:23519213-23519235 TTGCATTTTTTGTAGAAACAGGG + Intronic
1135624924 16:23986258-23986280 ATGTATTTATTTTTGAAACAGGG + Intronic
1136236716 16:28918606-28918628 ATTCATTTATTATTGAGACAGGG - Intronic
1136852987 16:33628324-33628346 TTGTATTTTTTGTTGGGACAGGG + Intergenic
1138581239 16:57941856-57941878 ATTCATTTATTTTTGAGACAGGG + Intronic
1139161125 16:64510421-64510443 TTGCATTAATTGTTGAAACAAGG - Intergenic
1140742969 16:77957912-77957934 ATGCATTTATTTTTGAGACAGGG + Intronic
1140803865 16:78514652-78514674 ATGCATTTAGTGTTGGCAAAAGG + Intronic
1141739350 16:85880493-85880515 AAGCATTTTTTGTTGAAAGAAGG + Intergenic
1142359147 16:89618532-89618554 ATGCATTTAGTTTTGAGACAGGG + Intronic
1203114583 16_KI270728v1_random:1476746-1476768 TTGTATTTTTTGTTGGGACAGGG + Intergenic
1143113534 17:4567518-4567540 ATGTATTTATTTTTGAGACAGGG + Intergenic
1143977452 17:10840440-10840462 ATGTATTTATTTTTGAGACAAGG + Intergenic
1144026724 17:11283701-11283723 CCACCTTTATTGTTGGAACAGGG + Intronic
1144501776 17:15794097-15794119 TTGTATTTATTGTTGAGACAGGG + Intergenic
1144706834 17:17374168-17374190 ATGTATTTATTTTTGAGACAGGG + Intergenic
1145163952 17:20596761-20596783 TTGTATTTATTGTTGAGACAGGG + Intergenic
1146285356 17:31570949-31570971 ATGCATTTATCGTTTTGACAAGG - Intergenic
1146286621 17:31578316-31578338 TTGCATTTATTGTAGGGACAGGG + Intergenic
1147473142 17:40683244-40683266 ATGTATTTATTTTTGAGACAAGG - Intergenic
1148488754 17:48009507-48009529 ATTTATTTATTTTTGAAACAGGG + Intergenic
1148655945 17:49283627-49283649 TTTCATTTTTTGTAGGAACAGGG + Intergenic
1148911496 17:50945306-50945328 ATGTATTTATTTTTGAGACAGGG + Intergenic
1149222185 17:54428039-54428061 AGGCATTGATTTTTGCAACAAGG + Intergenic
1149442856 17:56689916-56689938 ATGCATTTGGGGTTGGGACAGGG + Intergenic
1149554583 17:57564157-57564179 GTGGATTTCTTGCTGGAACAGGG + Intronic
1149909456 17:60553594-60553616 TTGCATTTTTTGTAGAAACAGGG + Intergenic
1151721530 17:75859308-75859330 ATGTATTTATTTTTGATACAGGG + Intergenic
1151723459 17:75871556-75871578 ATGTATTTATTTTTGAGACAGGG + Intergenic
1153102519 18:1489543-1489565 ATGTATTTATTGTAGAGACAGGG + Intergenic
1153849743 18:9081998-9082020 ATTCATTTATTTTTGAGACAGGG + Intergenic
1155426624 18:25714038-25714060 CTGCATTTCTTGCTGGAGCAAGG - Intergenic
1155766266 18:29637133-29637155 TTGTATTTTTTGTTGAAACAGGG + Intergenic
1156301822 18:35843080-35843102 ATGCATATATTGTTTAAATAAGG + Intergenic
1156814243 18:41290041-41290063 ATTTATTTATTTTTGAAACAGGG - Intergenic
1157843679 18:50982616-50982638 CTGAATTTATTGCTGGAATATGG - Intronic
1157923572 18:51738990-51739012 ATGCATCTGTTGATGGAACTTGG - Intergenic
1158670311 18:59468376-59468398 ATGCATTTATTTTTGAGACAGGG - Intronic
1160000447 18:75014856-75014878 TAGCTATTATTGTTGGAACATGG - Intronic
1160304034 18:77715021-77715043 CTGTCTTTCTTGTTGGAACAAGG + Intergenic
1161533659 19:4805308-4805330 ATTTATTTATTTTTGAAACAAGG - Intergenic
1161549113 19:4901310-4901332 ATGTATTTATTTTTGAGACAGGG - Intronic
1161999448 19:7733973-7733995 ATTTATTTATTGTTGAGACAGGG - Intergenic
1163780845 19:19247087-19247109 ATTTATTTATTTTTGAAACAGGG + Intronic
1164789376 19:30963156-30963178 ATGAATTTATTTTGGGAAAAGGG + Intergenic
1165038800 19:33054370-33054392 TTGCATTTTTAGTAGGAACAGGG + Intronic
1165649811 19:37476362-37476384 GTGATATTATTGTTGGAACAAGG + Exonic
1167195997 19:48028916-48028938 ATGTATTTATTTTTGAGACAGGG - Intergenic
1167303091 19:48690860-48690882 TTGCATTTTTTGTAGGCACAGGG + Intergenic
1167752280 19:51388302-51388324 ATGCGTTTATTGTTCAACCAGGG + Exonic
925115389 2:1374216-1374238 ATGCAATGATTGTTGCTACAAGG + Intronic
926952415 2:18257339-18257361 CTGAATTTAGTGTTGGAACTTGG - Intronic
928586717 2:32766790-32766812 ATTTATTTATTTTTGCAACAGGG + Intronic
929619802 2:43343032-43343054 ATTTATTTATTTTTGAAACAAGG + Intronic
929761353 2:44810214-44810236 ATGCAAATATTTTTGGAAAAAGG + Intergenic
930246193 2:48985629-48985651 ATACATTTACTTTTAGAACAGGG + Intronic
930451702 2:51547242-51547264 CTGCCTTTATTTTTGGAAAAAGG + Intergenic
931012483 2:57933236-57933258 ATCCATTTATTGTTGAAAGTTGG + Intronic
931991810 2:67797715-67797737 TTGCATTTATTTCTGGCACATGG + Intergenic
935522348 2:104123122-104123144 ATTCATTTATTTTTGAGACAAGG + Intergenic
935602594 2:104938382-104938404 ATGCATATAAATTTGGAACAGGG - Intergenic
936956439 2:118027146-118027168 ATTTATTTATTTTTGAAACAGGG - Intergenic
937342107 2:121097659-121097681 ATGTATTTATTTTTGAGACAGGG - Intergenic
937705645 2:124917804-124917826 AGGCATGTATTGTTGCAACAGGG + Intergenic
937938761 2:127268433-127268455 TTGTATTTTTTGTAGGAACAGGG + Intronic
939523906 2:143267635-143267657 ATTCATTTACTATTGGAAAAAGG - Intronic
939639794 2:144626394-144626416 ATGGATTTATTGTTTGAAGAGGG + Intergenic
940017167 2:149119135-149119157 AGGCAGTTATTGTTTTAACAGGG - Intronic
941555764 2:166979128-166979150 ATGCCTTTTTTCATGGAACATGG + Intronic
941786979 2:169507847-169507869 AGTCATTTATTGTTTAAACAAGG + Intronic
942160488 2:173180667-173180689 ATGGATTTATTTTTGAGACAAGG - Intronic
942199283 2:173554499-173554521 ATGTATTTATTTTTGAGACAGGG - Intergenic
942875287 2:180788503-180788525 ATGCATATATTGTTACAACCTGG + Intergenic
943652054 2:190467822-190467844 ATTCAGCTCTTGTTGGAACATGG + Intronic
943963715 2:194302662-194302684 TAGCATTCATTGTTGGAAAAGGG - Intergenic
944279715 2:197881819-197881841 ATGGATTGATTGTTGGAGCTGGG - Intronic
945583052 2:211621106-211621128 ATGTATTTATTCTTGAGACAGGG - Intronic
945973422 2:216252377-216252399 CTGCATTTCTTCTTGGAAGAGGG + Intergenic
946232324 2:218299451-218299473 ATTCATTTATTTTTGAGACAGGG + Intronic
946723869 2:222641733-222641755 ATGCTTTTATTTTAGGATCAAGG - Intronic
947265700 2:228277594-228277616 ATTCATTTATTTTTGAGACAGGG - Intergenic
948277825 2:236723638-236723660 ATGTATTTATTTTTGAGACAGGG + Intergenic
1168771376 20:419147-419169 AAGCATTTATCGGTGGAATAGGG + Intronic
1169071422 20:2734399-2734421 ATTAATTTATTTTTGGAACAGGG - Intronic
1169287983 20:4325532-4325554 AAGAATTTATTGTTTGACCAAGG - Intergenic
1169789660 20:9395967-9395989 ACTCATTTATTTTTGAAACAAGG - Intronic
1169906624 20:10611190-10611212 CTGCTTTTATTGTTGGCAGAAGG + Intronic
1169975636 20:11324116-11324138 ATGCATTTATTATTTCCACATGG - Intergenic
1170145151 20:13165300-13165322 ATGCTTTTATGAGTGGAACAAGG - Exonic
1170464078 20:16607034-16607056 ATGCAAATATTCTTGGAACAAGG + Intergenic
1171219110 20:23378137-23378159 TTGCATTTTTTGTTGAGACAAGG - Intronic
1172369401 20:34376439-34376461 ATGTATTTATTTTTGAGACACGG - Intronic
1173535936 20:43813444-43813466 ATGTATTTATTTTTATAACAGGG + Intergenic
1174263583 20:49315264-49315286 ATTCATTTATTTTTGAGACAGGG + Intergenic
1174625887 20:51913960-51913982 ATGCATTTTTAGTAGAAACAGGG - Intergenic
1174676900 20:52366769-52366791 GTGCATTTATGGTTGCTACATGG + Intergenic
1176222812 20:63978173-63978195 ATGCAGTTACTGTGGGAAGAGGG - Intronic
1177380278 21:20331569-20331591 ATGGATTTATTATTGGACTATGG + Intergenic
1178701160 21:34834936-34834958 GCGCATTAATTGTTGGCACATGG + Intronic
1182297936 22:29320807-29320829 ATTTATTTATTTTTGAAACAGGG + Intergenic
1182445872 22:30389137-30389159 ATGCATTTATTTTTGAGACAGGG + Intronic
1183140591 22:35934939-35934961 ATTCATTTATTTTTGAGACAGGG + Intronic
1183559907 22:38564160-38564182 ATTCATTTATTTTTGAGACAAGG - Intronic
1184216506 22:43070917-43070939 ATGTATTTATTTTTGAGACAGGG + Intronic
1184603854 22:45560580-45560602 CTGCATTTAATGTTGCAACTCGG - Intronic
1184957947 22:47904804-47904826 ATGTATTTTTTGTAGGGACAGGG - Intergenic
1185237510 22:49723340-49723362 ATGTATTTATTTTTGAGACAGGG - Intergenic
950608715 3:14110192-14110214 ATGTATTTATTTTAGAAACAGGG - Intergenic
950877606 3:16290543-16290565 ATGTATTTATTTTTTAAACATGG + Intronic
953175012 3:40542942-40542964 ATGTATTTATTTTTGAGACAGGG + Intronic
953994658 3:47510630-47510652 TTGCATTTTTTGTAGAAACAGGG + Intronic
954561648 3:51561873-51561895 ATTTATTTATTGTTGAGACAAGG + Intronic
954740162 3:52743250-52743272 CTCCATTTATTTTTGGGACAGGG - Intronic
955595759 3:60588653-60588675 ATTCATTTATTTTTGAGACAGGG + Intronic
955645153 3:61129434-61129456 ATGGATGAATAGTTGGAACATGG + Intronic
955739666 3:62076751-62076773 TTGTATTTTTTGTAGGAACAGGG + Intronic
957015042 3:75053420-75053442 ATGCAATAAGTGTTGGAACTGGG - Intergenic
957412527 3:79859909-79859931 GTCCATTTATTGTTGGAATTAGG - Intergenic
957666355 3:83234609-83234631 ATGCATTCATAGTTAGAAAATGG + Intergenic
957770485 3:84685887-84685909 AAGCATTTATTTTAGGAAAAGGG + Intergenic
958591915 3:96169815-96169837 TTCCATTTATTCTTGGAAGAAGG + Intergenic
959211429 3:103388066-103388088 AGACATTTATTGTAGGAACCTGG - Intergenic
960535270 3:118808643-118808665 ATTCTTTTATTGTTAGAATAGGG - Intergenic
962113276 3:132472771-132472793 TTGCATTTATTGTTGTCCCAAGG + Intronic
963172155 3:142261951-142261973 ATGTATTTATTTTTGAGACAGGG - Intergenic
963218940 3:142784544-142784566 ATGCTTTTATTGTTAGAAAAAGG + Intronic
963335030 3:143965029-143965051 GTGTATTTATTGTTGAGACAGGG + Intergenic
963903377 3:150753619-150753641 TTGTATTTTTTGTAGGAACAGGG - Intronic
964253224 3:154744564-154744586 ATGTATTTATTTTTGAGACAGGG - Intergenic
964530546 3:157663160-157663182 ATGCATTTATTTATGAAACAGGG - Intronic
965202712 3:165680385-165680407 ATGCAATTTTTGTTAGTACATGG + Intergenic
965592077 3:170370693-170370715 TTGCATTTTTTATGGGAACAAGG + Intronic
966198648 3:177338884-177338906 ATGCATTTTATGGTGAAACAAGG - Intergenic
966243529 3:177781039-177781061 TTGCATTTTTTGTTGAGACAGGG + Intergenic
968668732 4:1836209-1836231 ATTTATTTATTTTTGAAACAGGG - Intronic
969084415 4:4645108-4645130 ATGTATTTATTTTTGAGACAGGG - Intergenic
969269413 4:6088971-6088993 AAGCAATTACTGTTGGGACAGGG - Intronic
969270637 4:6097697-6097719 TTGCATTTTTTGTTGCAAAATGG - Intronic
969571054 4:8008596-8008618 ATGAATACGTTGTTGGAACACGG + Intronic
969693393 4:8720476-8720498 ATTCATTTATTTTTGAGACAGGG - Intergenic
970342746 4:15123757-15123779 ATTCACTTAATGTTGGCACAGGG - Intergenic
970460470 4:16269819-16269841 ATCCCTTTTTTGCTGGAACAAGG + Intergenic
971001819 4:22332151-22332173 ATGTATTTATTCTAGAAACAGGG - Intergenic
971124344 4:23736395-23736417 ATGCAATTATATTAGGAACAGGG - Intergenic
972242368 4:37206936-37206958 ATGCTTTTATTCTAGGAAGAGGG - Intergenic
975296853 4:72744539-72744561 AAGTATTAAATGTTGGAACAAGG - Intergenic
975582735 4:75921438-75921460 ATTCATTTATTATTTAAACAGGG + Intronic
975659116 4:76670937-76670959 ATTTATTTATTTTTGAAACAGGG - Intronic
975797304 4:78020978-78021000 ATGTATTTATTGGTAAAACAGGG + Intergenic
976936558 4:90642846-90642868 ATGTATTTATTTTTGAGACAGGG - Intronic
978706231 4:111715119-111715141 ATTTATTTATTTTTGAAACAGGG - Intergenic
978706248 4:111715321-111715343 ATTTATTTATTTTTGAAACAGGG - Intergenic
978724379 4:111953151-111953173 ATGCATTTATTGATTGAGTATGG - Intergenic
978908126 4:114033710-114033732 TTGCATTTATTTTTAGAAGAAGG - Intergenic
979402981 4:120273709-120273731 AAGCATTTATTTTTTTAACATGG + Intergenic
981737859 4:147971647-147971669 ATGCAGCTCTTGTTGGAACATGG + Intronic
981792410 4:148553341-148553363 ATGTATTTATTTTTGGAACAGGG - Intergenic
981817254 4:148844960-148844982 ATAGATTTATTGTTGGAATAGGG + Intergenic
982741616 4:159062675-159062697 TTGCATTTTTTTTTGAAACAGGG + Intergenic
982881664 4:160726718-160726740 TTGCATTTAGTTTTGAAACATGG - Intergenic
983104801 4:163673454-163673476 CTGTTTTTATTATTGGAACATGG - Intronic
984122754 4:175766825-175766847 TTGCATTTTTAGTAGGAACAGGG + Intronic
984466503 4:180106391-180106413 ATTCATTTATTATAGGAACAGGG + Intergenic
985131437 4:186742100-186742122 ATTCATTTATTTTTGAGACAGGG + Intergenic
985328822 4:188803856-188803878 ATGTATTTATTTTTGAGACAGGG + Intergenic
985526616 5:406269-406291 CTGCATTTCTTGCAGGAACATGG + Intronic
985944363 5:3165499-3165521 TTGCATTTCCTGTTGGAACCCGG - Intergenic
986930872 5:12819083-12819105 TTGCATTTTTTGTAGGGACAGGG + Intergenic
987379798 5:17275020-17275042 ATGTATTTATTTTTGAGACAGGG - Intronic
987713026 5:21528420-21528442 ATTTATTTATTTTTGGGACAGGG - Intergenic
988035418 5:25822210-25822232 ATGCTTACATTGATGGAACATGG - Intergenic
989484959 5:41978862-41978884 ATGCTTCTATTCTTGGAACTTGG + Intergenic
989705564 5:44326403-44326425 ACGTATTTATTGTTGAGACAGGG + Intronic
990501893 5:56404861-56404883 TGGCATTTCTTGTAGGAACAAGG + Intergenic
990674086 5:58163633-58163655 ATACAATTATTGTTGCATCATGG - Intergenic
991048905 5:62251919-62251941 TTGTATTTTTTGTTGGGACAGGG - Intergenic
991518855 5:67471790-67471812 ATGCACTTATTAGTGGTACATGG + Intergenic
992835561 5:80637603-80637625 ATTCATTTATTTTTGAGACAGGG - Intronic
992871908 5:81014924-81014946 ATGTATTTATTTTTGAGACAGGG + Intronic
993818669 5:92585576-92585598 ATGGATATATAGTTGGAAGAGGG + Intergenic
994121118 5:96114048-96114070 ATACACTTATTGTTGAAAAATGG - Intergenic
994947337 5:106412687-106412709 ATGCATTCAGTGTTCAAACAAGG - Intergenic
995004219 5:107171611-107171633 ATCCATTCAGTGTTGGAGCATGG - Intergenic
995070808 5:107919606-107919628 ATTCATTTGTTGGTGGAACAGGG - Intronic
995106024 5:108379861-108379883 ATGTATTTTTTGTTGGGAGATGG - Intronic
997147008 5:131445926-131445948 ATGCATATATATTTGGATCAAGG - Intronic
998241659 5:140451679-140451701 TTGTATTTTTTGTAGGAACATGG + Intronic
998590613 5:143473825-143473847 ATTCATTTATTTTTGGACCGTGG - Intergenic
999041543 5:148418837-148418859 AATCATATATTGTTGCAACAAGG + Intronic
999472422 5:151867102-151867124 ATGTATTTATTTTTGAGACAGGG - Intronic
1000833349 5:166129533-166129555 ATTCATTTATGGTTGGGAGATGG + Intergenic
1001853796 5:174993123-174993145 ATGCATTTCTTCATGCAACATGG - Intergenic
1003633336 6:7808509-7808531 TTGCATTTATTCTTAGGACATGG + Intronic
1003781991 6:9439606-9439628 ATGCAAATATTGTTGGTCCAGGG + Intergenic
1004503697 6:16230513-16230535 ATGCATTTAAGGTGGTAACAGGG - Intergenic
1008186166 6:48393719-48393741 ATTCATTTATTTTTGGCATATGG - Intergenic
1009389845 6:63132850-63132872 ATGCATTTCTGGTTGTACCAAGG - Intergenic
1011459190 6:87585884-87585906 ATGCATTTCTTTTAGGCACAAGG + Intronic
1011477398 6:87761405-87761427 TTGCATTTTTTGTAGAAACAGGG - Intergenic
1011835653 6:91427856-91427878 ATGCATTTTTTGTTGCATAAAGG - Intergenic
1012293626 6:97491615-97491637 TTGCATTTTTTTTTGTAACATGG + Intergenic
1012921080 6:105221678-105221700 CTGCATTTAATGTTGCAACTTGG - Intergenic
1014320383 6:119921289-119921311 AAACATTTATTGTTAGTACATGG - Intergenic
1014683798 6:124469401-124469423 ATGCATATATTAATGGACCATGG + Intronic
1015433410 6:133156580-133156602 ATGCAGATATTGTTGGAAAATGG + Intergenic
1017700003 6:157059858-157059880 ATGCATTTTGTTTTAGAACAAGG + Intronic
1017977404 6:159370254-159370276 CTGCATTTATTGTTGCAGCTTGG - Intergenic
1018560156 6:165093643-165093665 ATTCATTCATTGTTGGGTCAGGG + Intergenic
1019513003 7:1427524-1427546 ATTTATTTATTTTTGGGACAGGG - Intergenic
1020225884 7:6279633-6279655 ATTTATTTATTTTTGAAACAGGG + Intergenic
1020502928 7:8945508-8945530 ATGCATTATTTGTTCCAACAGGG - Intergenic
1021208872 7:17819251-17819273 ATCCATTCATTTATGGAACAGGG + Intronic
1022298676 7:29082028-29082050 GTGCATTTATTTTTTGAAGATGG + Intronic
1022374303 7:29799336-29799358 ATGTATTTATTTTTGAGACAAGG + Intergenic
1022601862 7:31768393-31768415 ATTCATCTGTTGTTGGATCAAGG + Intronic
1025685113 7:63709970-63709992 ATGTATTTATTACTGAAACAAGG - Intergenic
1026816035 7:73512959-73512981 ATGTATTTATTTTTGACACAGGG + Intronic
1027997807 7:85447966-85447988 ATGTATTTATTTTTGAGACAGGG + Intergenic
1028075587 7:86510395-86510417 ATGCAGCTCTTCTTGGAACAGGG - Intergenic
1028490697 7:91408142-91408164 AAGCATTAGTTCTTGGAACATGG - Intergenic
1029462599 7:100705159-100705181 ATGCATTTATTTTTGAGACAGGG - Intergenic
1031108894 7:117581926-117581948 TTGCATTTTTTGTGGGGACAGGG + Intronic
1031808960 7:126341909-126341931 AGGAAGTTATTGGTGGAACAGGG + Intergenic
1031869988 7:127080962-127080984 ATGCGTTTATTTTTGGTAAAGGG - Intronic
1032331861 7:130987799-130987821 TTGCATTTTTAGTTGAAACAGGG - Intergenic
1032698031 7:134354739-134354761 ATTTATTTATTATTGGGACAGGG - Intergenic
1033911718 7:146271961-146271983 ATGAATTTATTGGTAGAAGATGG - Intronic
1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG + Intronic
1034511599 7:151539846-151539868 ATGTATTGATTTTTGAAACAGGG + Intergenic
1034552036 7:151827243-151827265 ATTCATTTATTTTTGAGACAGGG + Intronic
1035211706 7:157333480-157333502 ATGTATTTATTTTTGAGACAGGG + Intergenic
1037964991 8:23127391-23127413 ATGTATTTATTTTTGAGACAGGG + Intergenic
1038175550 8:25179214-25179236 TTGCATTTTTTGTAGAAACAGGG + Intergenic
1038274981 8:26113896-26113918 TTGCATTTTTTGTAGGGACAGGG - Intergenic
1038620551 8:29138747-29138769 ATTCATTTATTGTAGAAACTGGG - Intronic
1039644098 8:39261449-39261471 ATCCATTTGTTGTTGGAAACAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041224971 8:55689047-55689069 ATGCATTTATTTTATGAAAAAGG - Intergenic
1041892677 8:62888613-62888635 TAGCTTTTATTGTTGGAGCATGG + Intronic
1042126204 8:65539553-65539575 ATGCATTTATTTTTGGAGTCAGG - Intergenic
1043407546 8:79953421-79953443 AGGCCTTTATTTTTGGAAAAAGG + Intronic
1043590452 8:81826524-81826546 ATGCATTGATTGTAGAAATATGG - Intronic
1044677454 8:94743627-94743649 ATTCATTTATTTTTGAGACAGGG - Intronic
1045878780 8:107014051-107014073 ATTTATTTATTTTTGAAACAGGG - Intergenic
1046131484 8:109973601-109973623 ATGCATGCATTTTTGGAGCATGG + Intronic
1047114560 8:121826311-121826333 ATGCATTTCTTTTTAGAAAAAGG + Intergenic
1047153012 8:122285649-122285671 ATGCATTTCTTTTTGAAACAGGG + Intergenic
1047243255 8:123114196-123114218 ATGGATTTATTGTTGTAGCCAGG + Intronic
1047644840 8:126859578-126859600 ATGCATTTAATGTTCGGAAATGG + Intergenic
1047893707 8:129342283-129342305 ATTCATTTTTTGTAGAAACAGGG + Intergenic
1048528701 8:135227908-135227930 ATCCATTGTTTTTTGGAACAAGG - Intergenic
1048541970 8:135350206-135350228 AAGCATATATTAATGGAACATGG + Intergenic
1051237988 9:15022155-15022177 ATGCCTTTAGTGAAGGAACAAGG - Intergenic
1053439069 9:38099821-38099843 TTGCAATGATAGTTGGAACAAGG - Intergenic
1055009122 9:71544267-71544289 ATTTATTTATTTTTGAAACAGGG - Intergenic
1055172112 9:73271398-73271420 ATGCTTTTGTTGTTGAAACAAGG + Intergenic
1055188700 9:73490870-73490892 ATTCATTTAGAGTTGGAAAAGGG - Intergenic
1055302224 9:74893468-74893490 TTGCATTTATTGTAGAGACAGGG - Intergenic
1057454395 9:95194451-95194473 ATGCATTTTTGGTAGGAACATGG - Intronic
1057980951 9:99662662-99662684 ATGCATTTTATGATGGAAAATGG + Intergenic
1059183928 9:112247257-112247279 ATTTATTTATTATTGAAACAGGG - Intronic
1060294598 9:122334675-122334697 ATGCAGTGAGTGTTGGAACTGGG + Intergenic
1060506209 9:124200146-124200168 ATGTATTTATTCTGGGAACCAGG - Intergenic
1061774752 9:132954263-132954285 TTGCATTTTTTGTAGAAACAAGG + Intronic
1185685581 X:1925677-1925699 ATACATTAATTATTGGATCAAGG - Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186387032 X:9120492-9120514 ATGCATTTATTATTGTTACATGG - Intronic
1186688677 X:11952027-11952049 ATTTATTTATTTTTGAAACAGGG - Intergenic
1187945890 X:24426168-24426190 ATGTGTTTATTTTTGAAACATGG - Intergenic
1189028116 X:37420353-37420375 TTGGATTTCTTGTGGGAACAAGG - Intronic
1189508500 X:41637612-41637634 ATTCATTTATTTTTGAGACAGGG - Intronic
1189523471 X:41795491-41795513 TTGTATTTTTTGTAGGAACAGGG - Intronic
1189760583 X:44317781-44317803 ATGTATTTATTTTTGAGACAGGG - Intronic
1190601765 X:52099961-52099983 CTGCATTTAATGTTGCAACTTGG - Intergenic
1190828062 X:54035794-54035816 ATTCATTTATTTTTGAGACAGGG - Intronic
1190976137 X:55403028-55403050 ATCCATTCATTCTTGGAACATGG - Intergenic
1193774601 X:85626615-85626637 ATGCATTTATTTTAGGATCAAGG - Intergenic
1194075512 X:89386945-89386967 ATTTATTTATTGTTGAGACAGGG + Intergenic
1194753206 X:97707048-97707070 ATTTATTTATTTTTGGTACAGGG + Intergenic
1196854452 X:119969846-119969868 ATCCATTTCTTTTTTGAACAAGG - Intergenic
1197193148 X:123671122-123671144 ATGCTTTTATTGCTGGACCCAGG - Intronic
1198113272 X:133521632-133521654 ATGCTGTTATTCTTGGAAAACGG + Intergenic
1198130072 X:133685153-133685175 ATGCAATTATTTTAAGAACACGG - Intronic
1199737705 X:150699557-150699579 ATGCATTTATTATTATAAAATGG - Intronic
1200531442 Y:4345564-4345586 ATGCTTTTTTTGTTTGATCACGG + Intergenic
1200731114 Y:6741106-6741128 ATTTATTTATTGTTGAGACATGG + Intergenic
1201955476 Y:19618007-19618029 ATGTATTCATTCTTGGGACAAGG + Intergenic