ID: 1108557253

View in Genome Browser
Species Human (GRCh38)
Location 13:51606010-51606032
Sequence TGGCAAAAGGCAGTGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108557253 Original CRISPR TGGCAAAAGGCAGTGTTGGA TGG Intronic
901531114 1:9853075-9853097 TGGCAGCTGGCAGTGTGGGAAGG - Intronic
902450807 1:16495869-16495891 TGGCAAAAGGCAAGTTTGGAGGG - Intergenic
902502060 1:16917470-16917492 TGGCAAAAGGCAAGTTTGGAGGG + Intronic
903298397 1:22360658-22360680 AGGCAACAGGCAGTGGTGGCAGG + Intergenic
904578320 1:31520922-31520944 TGAGAAAATGAAGTGTTGGAAGG - Intergenic
905126111 1:35717331-35717353 TGGCAAGAGGCAGGTATGGAGGG - Intronic
905797454 1:40823659-40823681 TGGCAAGAGTGAGTGCTGGAGGG + Intronic
905798159 1:40827030-40827052 TGGCAAAAGTCAGAGTGAGAAGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910133725 1:83941089-83941111 AGGCATAGGGTAGTGTTGGATGG - Intronic
910560225 1:88582104-88582126 GGGCACAAGGCAGAGTTGCAAGG + Intergenic
911872928 1:103121901-103121923 ATGGAAAAAGCAGTGTTGGAGGG + Intergenic
912103654 1:106243427-106243449 TGGCAAAAAGCAGTGTTGGCAGG + Intergenic
915900678 1:159844565-159844587 GGGAAAAAAGCAGTGTAGGAGGG + Intronic
917223909 1:172761502-172761524 GTGGGAAAGGCAGTGTTGGAAGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920044720 1:203125927-203125949 TGGGAACAGGCAGGGGTGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
921961595 1:221040890-221040912 TGGCCAGAGGCAGTTTTGGATGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1063984220 10:11483696-11483718 AGGCAAAAGGCAGTGTTGGGGGG + Intronic
1064590508 10:16885300-16885322 TGTCACAAGGCATTGTTGTAAGG + Intronic
1065779184 10:29150989-29151011 TAGCAAAAGGCACTATAGGATGG + Intergenic
1066780757 10:38942735-38942757 TGGCAAAAAGCGGTGGTGGCAGG - Intergenic
1067170546 10:43902735-43902757 TGGCATAAGCCACTGTGGGAAGG - Intergenic
1067232646 10:44422909-44422931 TGGCCAAAGGCAGTGAGAGATGG + Intergenic
1067725922 10:48770928-48770950 TGGCAAAATGCAGCCTGGGAAGG + Intronic
1068527839 10:58150848-58150870 TGGCTAAAGGCCTTGTTGGTAGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070356858 10:75648307-75648329 TAGCAAGAGGCAGTGTGGCAGGG - Intronic
1070545082 10:77445942-77445964 GGCCAAAAGGCAGTGTGGGCTGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071371478 10:84955958-84955980 TGTCAGAAAGCAGTGTTGCAGGG - Intergenic
1071742223 10:88372348-88372370 TGGCAAAAGGCAGTAAAGCAGGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1074060987 10:109965444-109965466 GGGCAAAAGGAACTTTTGGAGGG - Intergenic
1075209374 10:120478079-120478101 TGGCAAAGGGCAATGCGGGAGGG - Intronic
1076014830 10:127019172-127019194 GGGCAAATGGCAGGGTTGGATGG + Intronic
1076148914 10:128147328-128147350 AGGCAAAAGGCACTCTTGCATGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081284484 11:41250421-41250443 TGACACAAGGCAGTGTCAGAAGG - Intronic
1081914029 11:46719517-46719539 GGGCAAGGGGCAGTGTAGGAGGG + Intronic
1081975794 11:47233954-47233976 TGGCAAAAGGCAGTGTAGCATGG + Intronic
1082103650 11:48196280-48196302 TGGCAAAAAGTAGCCTTGGAAGG - Intergenic
1084344029 11:68531586-68531608 TGTCAAAATGCAGTCTTGGCTGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085226868 11:74929463-74929485 AGGCAAAAGAGAGTCTTGGAAGG - Intronic
1085341292 11:75733240-75733262 GGGCAAAGGGCAGAGTTTGAGGG - Intergenic
1085508737 11:77074627-77074649 TGGCAAAAGGTGGTGGTGGGGGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1087355654 11:97090668-97090690 TGGCAAAAGTATGTGTTGAAAGG - Intergenic
1089000061 11:115044422-115044444 TTGCAAGAGGCAGTTTTGCAAGG - Intergenic
1090077434 11:123588092-123588114 AGGCAGAAGGCAGAGTGGGACGG - Intronic
1091822595 12:3487402-3487424 CAGCAAAAGGAAGTGTTGGTTGG + Intronic
1092051117 12:5470980-5471002 TGCCAAAAGGAAGGGTGGGAAGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096386164 12:51196771-51196793 TGGCCAAAGACAGGGCTGGAGGG - Intronic
1097238187 12:57554022-57554044 TGGAAAAAGGGAGTGATGAAAGG + Intronic
1098656803 12:73041494-73041516 TAGAAAAAGTCAGTGTGGGAGGG + Intergenic
1099299214 12:80870241-80870263 TGGCAAATGGCAGTGTTTTAAGG - Intronic
1100462510 12:94815268-94815290 TGGCCAAAAGCAATGTTGGGAGG - Intergenic
1100462870 12:94818401-94818423 TGGCAAAAGGGAGTATAGTATGG - Intergenic
1101589970 12:106116868-106116890 GGGCAAAAGGCAGAATTGTATGG + Intronic
1101664600 12:106800305-106800327 TGGCAGAAGGCAAAGCTGGAGGG + Intronic
1102383481 12:112486806-112486828 TGGCCAATGGCAGTGCTGTAGGG - Intronic
1103211384 12:119169432-119169454 TTGCAAAAGGGAGAGCTGGAAGG - Intergenic
1105548670 13:21371184-21371206 GGGCAAAAGGCAGTGAAGGAGGG - Intergenic
1105908034 13:24833719-24833741 TGGGAAAAGACAGTTTTGGTTGG - Intronic
1105980088 13:25510662-25510684 TGGCAAAAGGAAGTGATAGTGGG + Intronic
1106080767 13:26498633-26498655 TAGCGCAAGGCAGGGTTGGAGGG + Intergenic
1106224721 13:27776207-27776229 TGGCAGGAGGCAGTGATGGATGG - Intergenic
1107926395 13:45266651-45266673 TGGCAAAAGGCCTTTTTGGGGGG + Intronic
1108547256 13:51508304-51508326 TGGCAAAAGGTAGAGTTGGAGGG - Intergenic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109960815 13:69627465-69627487 TTGCAAAAGGCAAGGGTGGATGG + Intergenic
1110386972 13:74923838-74923860 TGGCAGTAGGTAGTGATGGAAGG + Intergenic
1110677507 13:78266866-78266888 TGGCAAAAGGAGGTGCAGGAAGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112394018 13:99012137-99012159 TGGCAAGAGGCACTGTAGTATGG - Intronic
1112615700 13:101002982-101003004 TGGCAGAGGGCAGGGTGGGAGGG - Intergenic
1112681895 13:101776523-101776545 TGGCAAAAGGCAGCCTTCGAGGG + Intronic
1114042211 14:18689415-18689437 TGGGGAAAGGGAGTGTGGGAGGG + Intergenic
1114272024 14:21106560-21106582 TGGCAATAGGCAGTGTGGAGGGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114390319 14:22301150-22301172 AGGCAAAAAGCAATGTTGGATGG + Intergenic
1114758817 14:25288797-25288819 TGTCAAAAAGCAAGGTTGGAGGG + Intergenic
1114813289 14:25926663-25926685 TGGCAGATAGCTGTGTTGGAAGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118519174 14:66561982-66562004 GGGCAAATGGCAGTGTGAGAAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119113081 14:71993918-71993940 AGGGAAAAGGAAGAGTTGGAAGG + Intronic
1119992635 14:79216472-79216494 TTGCAAAAGAGCGTGTTGGATGG + Intronic
1120762596 14:88298954-88298976 ATACAAAAGGCAGTGATGGAGGG - Intronic
1121015819 14:90548374-90548396 TGGCTTAAGGCAGTGTTGTCAGG + Intronic
1121048288 14:90803600-90803622 TGGCAAAAGGCAAAGATGAAGGG + Intronic
1121448346 14:93992565-93992587 TCCCAAGAGGCAGTGTGGGAAGG - Intergenic
1122089784 14:99330622-99330644 TGGCCAAAGACAGTGCGGGAGGG + Intergenic
1122297234 14:100712453-100712475 AGGCAACAGGGAGTGCTGGAGGG - Intergenic
1122804720 14:104250555-104250577 TGTCAGAGGGCAGTGTTGGCAGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124382307 15:29177050-29177072 TGGGAGAAGGAAGAGTTGGAGGG + Intronic
1124957000 15:34366518-34366540 TGGGAAGAGGGAGTGTAGGAAGG + Intronic
1126149033 15:45505763-45505785 TTTCAAAAGGAAGTGCTGGAAGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126981881 15:54253725-54253747 TAGAAAAAGGCCGTGTTGGCTGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129067147 15:72914789-72914811 AGGCAGAAGGAAGCGTTGGATGG - Intergenic
1129365595 15:75052012-75052034 TGGTAAAGGGCAGTGCTAGAAGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131006443 15:88982508-88982530 TGGCACGGGGCAGTGTAGGATGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133039848 16:3054843-3054865 TGGCCAGAGGCAGAGATGGATGG + Intronic
1134395459 16:13858482-13858504 TTGCCAAAGTCAGGGTTGGATGG - Intergenic
1137305071 16:47191053-47191075 TGGCCAAAGTCAGTGTGGGTTGG + Intronic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1140193568 16:72838315-72838337 TGGCAAGAGGCAGCCTGGGAAGG + Intronic
1144819170 17:18059411-18059433 TGGGAAAAGGATGTGGTGGAGGG - Intronic
1148394326 17:47296030-47296052 TGGCAAGAGGCAGAGCTGGCAGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151996842 17:77615019-77615041 TGGCAGAAGGGAGTGTTCAAAGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156082011 18:33347158-33347180 TGGCAAAAGTCAGTGTTTATAGG - Intronic
1156720712 18:40066548-40066570 GGGCAACAGGCAGTCTTGAAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157910167 18:51609979-51610001 TGGCAAAAGGCAATTTTGATTGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160688591 19:449384-449406 TGGCTAAATGCAATGTGGGATGG + Intronic
1161385244 19:3988308-3988330 TGTTAAAAGACAGTGTTGGCCGG - Intergenic
1162346128 19:10119172-10119194 CTGCAAAAGGCAGCGTAGGAAGG + Intronic
1164322911 19:24166788-24166810 TGGGAAAAAGCTGTGTTGGGAGG - Intergenic
1164864106 19:31589714-31589736 TGGGGAAAGGAAGTGTTTGAAGG - Intergenic
1167306859 19:48714579-48714601 TGGGAAGAGGCAGTGCTGGGCGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168484744 19:56751411-56751433 TGGAAACAGGCAGTGGGGGAGGG + Intergenic
925628603 2:5866532-5866554 TGGTAAGAGGTAGTGTTAGAAGG - Intergenic
925672274 2:6323920-6323942 TGGTAAAGGGAAGTGTTGCACGG - Intergenic
926204477 2:10825858-10825880 TCCCAAAAGCCGGTGTTGGAGGG - Intronic
926613639 2:14972998-14973020 TGGGAAAAGGCAGTGTCACAGGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929937368 2:46303339-46303361 TGGGAGAAGGCAGTCTTTGAGGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931128309 2:59302402-59302424 TGGGAAAAGGGATTGTTGGTGGG + Intergenic
931469535 2:62524516-62524538 TGGAATAGGGCAGTGTAGGAGGG + Intergenic
932263274 2:70344746-70344768 TAGGAGAAGGCAGAGTTGGATGG - Intergenic
932756318 2:74412468-74412490 TGGCACAAGTCAGTATTAGAAGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933152859 2:78935640-78935662 TGGAAAAAGGCAATTTTGGAAGG - Intergenic
934040261 2:88122432-88122454 TGGCATAAAGTAGTGTTGAAGGG + Intergenic
934764188 2:96870991-96871013 GGGCAAAAGGCAGAGGTGAAGGG + Intergenic
935426521 2:102924294-102924316 TGCCAAAAGGCATGGTTAGAGGG + Intergenic
935687549 2:105697704-105697726 TGGGAAAATGCAGTGTTGGGAGG - Intergenic
935851915 2:107230922-107230944 GGACAAAAGGCAGTGTTCGTGGG - Intergenic
936164116 2:110105269-110105291 TGGCCACAGGCAGTGTGGGGAGG + Intronic
936607443 2:113972580-113972602 TGGGGAAAGGCAGTGGAGGAAGG + Intergenic
936805774 2:116330659-116330681 CGTCAAAAGACAGTGTTAGAGGG + Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
936972767 2:118190674-118190696 TGACAAAAGGCAGTTTTGCTTGG + Intergenic
937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG + Intergenic
937850146 2:126624929-126624951 TGGCAAGAGACATTGTTGGGTGG + Intergenic
938035702 2:128033142-128033164 TGGCAAATGGCAGAGGTGGTGGG + Intergenic
938268004 2:129943116-129943138 TGGGGAAAGGGAGTGTGGGAGGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940858093 2:158745441-158745463 TGGCTGAACGCAGTGGTGGAAGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830304 2:180232054-180232076 TGGCGAATGGCAGTGGTGGATGG - Intergenic
943909061 2:193540176-193540198 TAGAAAAAGGCAGTGTGGAAAGG + Intergenic
944358131 2:198818233-198818255 TAGCAAAAGGCAGTTATGGTAGG + Intergenic
944992606 2:205255022-205255044 TGGCAAAAGGCAAGGCTGGAAGG - Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945304780 2:208248918-208248940 AGGCAAAGGGCAGAGTTTGATGG - Intronic
946650719 2:221890644-221890666 TGACAAAGGGCAGGGATGGAAGG + Intergenic
947196913 2:227577232-227577254 TGGCAAAAGCCATTTTAGGAAGG - Intergenic
948860075 2:240748546-240748568 TGGCACAAGGCAGGATTGGGAGG + Intronic
1169553891 20:6729656-6729678 TGGCAATACCTAGTGTTGGAAGG - Intergenic
1169905936 20:10603983-10604005 AGGCAGAAGGCAGTTCTGGAAGG - Intronic
1171142116 20:22752277-22752299 TGTAACAAGGCAGTGTGGGATGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG + Exonic
1172260701 20:33562317-33562339 TGGTAACAGGGAGGGTTGGAAGG + Intronic
1172385448 20:34530927-34530949 TGTCAAAAGGCAGTGGCAGATGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173748968 20:45461268-45461290 TGGCAAACATCAGTGTTTGAGGG + Intergenic
1173843874 20:46175977-46175999 TGACTAAAGGAAGAGTTGGATGG + Intronic
1173851456 20:46220932-46220954 TGGCCAGAGTCAGTGTGGGAGGG - Intronic
1174567610 20:51477783-51477805 TGCCAAAAGGCAAAGTTGCAGGG + Intronic
1174772801 20:53317083-53317105 TAGCAAAAGGCAGTGGTCCAAGG + Intronic
1175377490 20:58538857-58538879 TGTCAATAGGCAGTGGTAGAGGG + Intergenic
1176961398 21:15163179-15163201 TGGCACAGGGGAGTGCTGGATGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177466059 21:21481595-21481617 GGGAAAAAGCCAGTGTTAGAAGG + Intronic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178826807 21:36024218-36024240 TTGGGAAAGGCAGTGGTGGAGGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1180133251 21:45841956-45841978 TGACAAAGGGCAGTGATTGAAGG - Intronic
1180830358 22:18902697-18902719 TGGCAAAAGGCTTTGCTGCATGG - Intergenic
1184420768 22:44381748-44381770 TGGCAAGAAGCAGTGTGGGGAGG + Intergenic
1184825707 22:46949442-46949464 TGGCAGGAGGCAGGGCTGGAGGG - Intronic
1203280447 22_KI270734v1_random:127968-127990 TGGCAAAAGGCTTTGCTGCATGG - Intergenic
949709192 3:6855119-6855141 TGACAAAAGGAAATGTTCGAAGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951591925 3:24275670-24275692 CGGCAAAAACCAGAGTTGGATGG - Intronic
952511964 3:34067197-34067219 TGCCAAAAGCCTGTGGTGGAAGG - Intergenic
953390030 3:42528501-42528523 TGGCAGATGGCAGAGTTGGAAGG - Intronic
953866042 3:46584416-46584438 TGGGAAAAGGCCGAGGTGGATGG + Intronic
954138011 3:48591122-48591144 TGGCAGAGGTCAGTGCTGGATGG + Intronic
954727866 3:52630827-52630849 TGGAAGAAGGCTGTGTTGGCAGG + Intronic
954864843 3:53719487-53719509 TGGCAGCAGGCAGTGATGCAGGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957211012 3:77258671-77258693 CAGCAAAAGGAAGTGTTGAAAGG - Intronic
958043330 3:88252213-88252235 TTGCAAATATCAGTGTTGGAGGG - Intergenic
958524605 3:95239883-95239905 TTGCAAAAGGTAATGTTGGCTGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960962987 3:123085016-123085038 TGGCAGAAGGCAGTGGGGGCAGG - Intronic
962648228 3:137461916-137461938 TGGGAAAAGGCATTGTAGGTGGG + Intergenic
962939174 3:140109963-140109985 TGGCACATGGCAGAGTGGGAGGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963047982 3:141117342-141117364 TGGGCAAAGGCAGAGCTGGAAGG - Intronic
963396726 3:144743904-144743926 TGGAAGAAGGAAATGTTGGACGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964558291 3:157964980-157965002 TGTAAAAAGGCAGTCTTGGCTGG + Intergenic
964626606 3:158765802-158765824 TAGCAAAAGGCAGAGCTGCAGGG + Intronic
964696711 3:159516290-159516312 TGGCCAAAGGGAGTGGAGGAAGG - Intronic
965095836 3:164224437-164224459 TGGCAATAGGTATGGTTGGAGGG - Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
968873324 4:3252401-3252423 AGGCATCAGGCAGTGTGGGAAGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973333149 4:48930354-48930376 TGGGATAAAGGAGTGTTGGATGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
976302369 4:83527435-83527457 TTGCAAAAGGCAGTTTCAGAAGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976616216 4:87080214-87080236 TGGGAAAAGGCAGTGTTTTGTGG + Intronic
977196787 4:94072559-94072581 TTATAAAAGGCAGAGTTGGAAGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977838425 4:101672276-101672298 TGGCAAATGGCAGTGATAGGAGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978758608 4:112330830-112330852 TGGCCAGAGGCAGTGTTGTATGG + Intronic
979782358 4:124669090-124669112 GGGCATCAGGAAGTGTTGGAGGG - Exonic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
980940347 4:139268152-139268174 TGGGAAAAAGAAGTGTAGGAAGG + Intronic
981157279 4:141453921-141453943 TGGCAAAAGGGAGGGAGGGAGGG - Intergenic
982064132 4:151637591-151637613 TGGGGAAAGGAAGTGTTGGATGG + Intronic
982225912 4:153166446-153166468 TCCCAAAAGGCAGTGCTGGAAGG + Intronic
982740783 4:159054812-159054834 TGGCAAGGGGCAGGGTGGGAGGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985993869 5:3585314-3585336 TGGGAGAAGACAGTGTGGGAAGG + Intergenic
986634797 5:9810757-9810779 TGGCAAAGGGCATTGCTTGAGGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987299628 5:16585818-16585840 TGGCAAGAGGGAGTGTGGGGAGG + Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988572261 5:32380189-32380211 TGGCAAAATGCAGTGAGGAATGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989329765 5:40243028-40243050 TGGTAAATGGCAGGTTTGGAGGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990330836 5:54723755-54723777 TGGCAACAGATTGTGTTGGAGGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994527890 5:100929285-100929307 TGGCTAAGGGGAGTGTTAGAAGG - Intergenic
994533832 5:101001898-101001920 TGTCAAAAGGCAGGGTTGAAGGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995724510 5:115169627-115169649 TGGCAGAAGGCAGCCATGGAGGG - Intronic
998402321 5:141854169-141854191 TGGGAGAAGGCACTGTAGGAGGG + Exonic
998884807 5:146683174-146683196 TGGGAAAAGGCGGGGTAGGAAGG - Intronic
1000164709 5:158636966-158636988 TGGGGAAAGGAAGTGCTGGATGG - Intergenic
1000427535 5:161110069-161110091 AGGCGAAAGGCAGTGTTGCAAGG - Intergenic
1000659258 5:163918332-163918354 TGTCAAAAACCAGAGTTGGAAGG - Intergenic
1003683665 6:8279929-8279951 TTGCAAAAGGGTGAGTTGGAAGG + Intergenic
1004193315 6:13483549-13483571 TGGCTAGAGGCAGGGTTGGGTGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005362146 6:25041012-25041034 TAGCAATAGGCAGTGGTAGAGGG - Intronic
1005784797 6:29232754-29232776 AGGGAAAAGGCCCTGTTGGAAGG - Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1007264052 6:40584205-40584227 TGGAAACAGGGAGGGTTGGAAGG - Intronic
1007739952 6:44004190-44004212 TGACAAAAGGGAGTGCTGGAGGG - Exonic
1007976153 6:46103559-46103581 TGGCAAAATGCATTATGGGAGGG - Intergenic
1008087444 6:47259669-47259691 CGGGAAAAGGCAATGTTGGCAGG - Intronic
1008289785 6:49700647-49700669 TGGTAAGAGGCAGTGCTGTAAGG - Exonic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009955903 6:70452996-70453018 AGCCAAAAGGCAATGTAGGAAGG + Intronic
1009980178 6:70718420-70718442 TGTGAAAAAGCAATGTTGGAGGG + Intronic
1010567783 6:77438421-77438443 TGGCACAAAGAAGTTTTGGAAGG + Intergenic
1010884815 6:81223290-81223312 GGGCAAAGGGGAGTGTTGAAAGG + Intergenic
1011004501 6:82628946-82628968 ATGCAAAGGGCAGTGTTGGGAGG + Intergenic
1012009981 6:93771491-93771513 TGGAAAAGAGCAGTTTTGGAAGG + Intergenic
1012446747 6:99314717-99314739 TGGCATGAGGCAGTGGTGGCAGG - Intronic
1012683975 6:102220234-102220256 TGACAAAAGCCAGTGTTGTCAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013719522 6:113007176-113007198 TGGACGAAGGCAGTGTAGGACGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015459142 6:133468572-133468594 TGGCCAAAGGCTGTATAGGATGG - Exonic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016710061 6:147160156-147160178 TGGCAAAATGCAGTGTGGTGTGG - Intergenic
1018625834 6:165777860-165777882 AGGCAGGAGGCAGTGTTGGGAGG - Intronic
1020162654 7:5783996-5784018 TGGAAGAAAGCAGTATTGGAAGG + Intergenic
1020186145 7:5960887-5960909 TGACAGAAGGAAGTGTTGGGGGG + Intronic
1020362355 7:7341076-7341098 GGCCAAATGGCAGTGTTGCAAGG - Intergenic
1021188762 7:17596132-17596154 TGGGAAAAGGCAGGGTAAGAAGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022093425 7:27123175-27123197 TGGCCAGAGGCAGTCTTGGGAGG + Intronic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022498307 7:30866801-30866823 TGGCAGAAGGCAGCTTGGGAAGG + Intronic
1022839326 7:34147999-34148021 TGGCAAACGGAAGCCTTGGAAGG - Intronic
1023644197 7:42292356-42292378 TGGAAGAAGGCATTGTTGGCTGG - Intergenic
1024528933 7:50374439-50374461 TGGCAAGTGGCAGAGCTGGAAGG - Intronic
1024630564 7:51243631-51243653 TGAAAAAAAGCAGTCTTGGAAGG + Intronic
1024779629 7:52832677-52832699 GGGAAGAAGGCAGTGTTGCAGGG - Intergenic
1026579487 7:71602024-71602046 TGGCAAAGGCCAGTCTTGCACGG - Intronic
1026732586 7:72924783-72924805 TGGTAACAGGCTGTGCTGGAGGG + Intronic
1027111480 7:75443061-75443083 TGGTAACAGGCTGTGCTGGAGGG - Intronic
1027283711 7:76627594-76627616 TGGTAACAGGCTGTGCTGGAGGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028155236 7:87421986-87422008 TGGCATAAGGCTCTGCTGGAGGG - Intronic
1028361478 7:89972171-89972193 TGAGAAAAGGCAGTTGTGGAGGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028603406 7:92628298-92628320 TGGCAAGAGGCAATGTTGTCGGG - Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030570292 7:111213550-111213572 TGGCCATAGGCAGGGCTGGAAGG - Intronic
1030744193 7:113145448-113145470 TGGCAGAAGGCACTGTTGAAAGG + Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031927864 7:127655212-127655234 TGGCAAAAGAAAGTGTTGCAGGG + Intronic
1033671719 7:143499627-143499649 TGGCAAAAGGGATTTTTGCAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035664994 8:1374202-1374224 TTGCAGAAGGCTGTGGTGGAGGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037170325 8:15884976-15884998 GGGTAAAAGGCACTTTTGGACGG + Intergenic
1038916626 8:32031464-32031486 GGGAAATAGGCAGTGTGGGAGGG - Intronic
1039420025 8:37429833-37429855 TGGCAAAAGGTATTGTTTAATGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039722937 8:40184446-40184468 TAGCAATAGGCAGTGTGGCACGG + Intergenic
1040089678 8:43385042-43385064 TGGCAAATGGCAGTTATGGGGGG - Intergenic
1040402407 8:47064617-47064639 TGGCAAATGGCAGTTATGGGGGG + Intergenic
1040549775 8:48429127-48429149 TGGGGAAAGGCTGTGCTGGAGGG + Intergenic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042629473 8:70801180-70801202 TAGCAAAAGACAGAGTTGAATGG - Intergenic
1042980149 8:74518040-74518062 TGGCAACAGGCAGAGTTGTAAGG - Intergenic
1042980217 8:74518510-74518532 TGGCAACAGGCAGAGTTGTAAGG + Intergenic
1045583859 8:103508619-103508641 TGGCAATAGGGAGTCATGGAGGG + Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046640552 8:116725280-116725302 TGGAAAAAGGGATTGTTCGATGG + Intronic
1047109719 8:121775869-121775891 TGGGAAAAGTCAGTGTTAGAAGG + Intergenic
1047510626 8:125512843-125512865 AGGCAAGAGGCAGAGATGGACGG - Intergenic
1047880631 8:129188994-129189016 TGGCAAAGGGCAGTGAAGAAAGG + Intergenic
1049146192 8:141002144-141002166 TAGCAAAAGGCGAGGTTGGAGGG + Intronic
1050413151 9:5386979-5387001 TGGCAGAAGACAAGGTTGGATGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1056198751 9:84254134-84254156 TGGCAACACAGAGTGTTGGATGG - Intergenic
1056438461 9:86596313-86596335 TTGCTAAAGGCTATGTTGGAAGG - Intergenic
1056476906 9:86961552-86961574 TGGCAAAGCGCAATGTTGGTGGG + Intergenic
1058185179 9:101846193-101846215 AGGCAAGAGGCAGAGTGGGATGG + Intergenic
1059203174 9:112437887-112437909 TAGTATAAGGCAGTGTTGCAGGG + Intronic
1060891037 9:127188582-127188604 TGCCAAGAGGCAGTGTCGGGTGG + Intronic
1061302994 9:129716812-129716834 TTGCAAAAAGCAATGCTGGAGGG + Intronic
1186317534 X:8386958-8386980 TGGCAAAAGAAAGGGGTGGAGGG + Intergenic
1188584491 X:31756756-31756778 GGCCAAAAGGAAGTGTTTGAAGG + Intronic
1188649414 X:32613016-32613038 TGACAAAAGGCAGATTTCGAAGG + Intronic
1188748406 X:33875007-33875029 TGGCAAAAGGCAGAATTAGGAGG - Intergenic
1188794981 X:34452480-34452502 TGCCCAATGGCAGTGTAGGAGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192282216 X:69699064-69699086 TAGGAAAAGGCAGTGGCGGAGGG + Intronic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192925697 X:75752827-75752849 AGGAACAATGCAGTGTTGGATGG - Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199337245 X:146632688-146632710 TGGTAAAAGGCACAGTTGAAAGG - Intergenic
1199471662 X:148202514-148202536 TGGGAAAAGGCAGTATTTAAGGG - Intergenic
1199976234 X:152896505-152896527 TTGCAGAAGGAAGTGATGGATGG - Intergenic
1201905226 Y:19080314-19080336 TGGCAAAGAGCATTGCTGGATGG - Intergenic