ID: 1108558187

View in Genome Browser
Species Human (GRCh38)
Location 13:51616848-51616870
Sequence AACACTTAGAACTATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108558187 Original CRISPR AACACTTAGAACTATGTGCC AGG (reversed) Intronic
901246319 1:7734240-7734262 AAAACTTAGTACTATCGGCCGGG - Intronic
903844515 1:26270161-26270183 CATACTAAGAATTATGTGCCAGG - Intronic
906520275 1:46462704-46462726 AACACTTAAAACTATGTTGAGGG - Intergenic
908665821 1:66489411-66489433 AACCCTAGGAAGTATGTGCCTGG + Intergenic
909631389 1:77772929-77772951 ATATCTTAGAAATATGTGCCAGG + Intergenic
909808777 1:79905547-79905569 AACAGTTTGCACCATGTGCCTGG - Intergenic
911446357 1:97998462-97998484 CAAACTTAGAACCATGTTCCTGG + Intergenic
911898886 1:103475161-103475183 AACAGCTAGAACTGTGGGCCAGG + Intergenic
913222874 1:116673097-116673119 AACACTGAGAACTAAATACCAGG - Intergenic
914687031 1:149989493-149989515 AACAATTAGAAATTTGGGCCAGG + Intronic
918167396 1:181963319-181963341 AAAATTAAGAACTATGGGCCAGG + Intergenic
918805938 1:189044673-189044695 AATAGTTAGAACTATGTATCAGG + Intergenic
920021721 1:202961509-202961531 AACACTTTGATTTGTGTGCCAGG + Intergenic
922097927 1:222458393-222458415 AACAGCTTGCACTATGTGCCTGG + Intergenic
923956496 1:239028390-239028412 AACAGTCAGAGGTATGTGCCAGG - Intergenic
924548669 1:245053927-245053949 AACACTGAGCGCTAAGTGCCTGG + Intronic
1065171424 10:23034358-23034380 ATCATTTTGAACTATATGCCAGG + Intronic
1065408179 10:25391320-25391342 AACAGCTAGCACTGTGTGCCTGG + Intronic
1066510588 10:36091393-36091415 AACACTGTGAACTGTGTGTCTGG + Intergenic
1068374839 10:56165023-56165045 AACAGCTTGCACTATGTGCCTGG + Intergenic
1068859845 10:61836700-61836722 AAAACTCAGAACTGTATGCCGGG - Intergenic
1070251990 10:74781145-74781167 AAGCCTGTGAACTATGTGCCTGG + Intergenic
1071707891 10:88019421-88019443 AACTCTTAGAACTAAGTCTCAGG + Intergenic
1072256383 10:93625278-93625300 AGTATTTTGAACTATGTGCCAGG + Intronic
1072421404 10:95292676-95292698 TACATTAAGTACTATGTGCCAGG - Intergenic
1073340772 10:102742874-102742896 AACACTTATATCTGCGTGCCTGG - Exonic
1074080371 10:110163664-110163686 AACACCTAGCACTGTGAGCCAGG - Intergenic
1078614990 11:12856530-12856552 AACACCTTGAACTTTGTACCTGG - Intronic
1079500213 11:21094377-21094399 AACAGCTTGCACTATGTGCCTGG - Intronic
1084080186 11:66817928-66817950 AACACTTAAATTTATGTCCCAGG - Intronic
1085806436 11:79641263-79641285 AACACTTAGGAATAAATGCCTGG + Intergenic
1086202874 11:84224526-84224548 TACACTTTGTACTATGTGCCAGG + Intronic
1086981363 11:93201395-93201417 AAAACTGAAAACTAAGTGCCTGG + Intergenic
1086991930 11:93313279-93313301 AACAGTTTGCACCATGTGCCTGG - Intergenic
1087058000 11:93952267-93952289 CACACTTACTTCTATGTGCCAGG - Intergenic
1087143247 11:94787395-94787417 ATGACTTAGCACTATCTGCCTGG - Intronic
1088444679 11:109912916-109912938 AACACTTAACACTATGTACTTGG - Intergenic
1089461024 11:118653731-118653753 AACACAAACAACTATGTGCCTGG - Intronic
1092969316 12:13676746-13676768 AACTCTTAGAAGTATGGGCTTGG - Intronic
1096105095 12:48992678-48992700 AACACTTAGAACAATTGGCCAGG - Intergenic
1097135358 12:56848724-56848746 AAAACTTAAAACTATAGGCCGGG - Intergenic
1097960740 12:65529837-65529859 AATACTTAAAACTAAGTGACAGG - Intergenic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1100028795 12:90161623-90161645 AACAGTTTGCACCATGTGCCTGG - Intergenic
1103044974 12:117728590-117728612 AAAACTCAGAACTCTGTGTCTGG + Intronic
1103129438 12:118454266-118454288 AGCACTTACACATATGTGCCAGG + Intergenic
1104419026 12:128619870-128619892 ATCACTTGGAAATCTGTGCCTGG - Intronic
1108558187 13:51616848-51616870 AACACTTAGAACTATGTGCCAGG - Intronic
1108829158 13:54455072-54455094 AACACTAAAAACTATGTGAAAGG - Intergenic
1109003310 13:56835207-56835229 AACAATTTGTACCATGTGCCTGG - Intergenic
1109223576 13:59665331-59665353 ATTAATTAGAACTATGAGCCAGG - Intergenic
1111258740 13:85707301-85707323 AACAATTAGAATTACTTGCCAGG + Intergenic
1111527570 13:89492242-89492264 AACAGCTTGCACTATGTGCCTGG - Intergenic
1113439655 13:110318141-110318163 AATACTGAAAACTATGTCCCAGG + Intronic
1113815152 13:113164433-113164455 AACACACAGAACTGTGTGCAAGG + Intronic
1115266987 14:31510752-31510774 AATACTTAAAATTATGGGCCAGG + Intronic
1116384823 14:44317252-44317274 AACAATTAAAACAATATGCCAGG - Intergenic
1118502561 14:66376040-66376062 AACACTTACTAATCTGTGCCAGG + Intergenic
1119862690 14:77947953-77947975 AACAGCTTGTACTATGTGCCTGG + Intergenic
1120526672 14:85584699-85584721 ACCACTTAGAACCCTGTGTCAGG - Intronic
1121762342 14:96456478-96456500 AACACTTTAAACTATTTTCCTGG + Intronic
1122132098 14:99610281-99610303 AACACTGAGAAGCATATGCCTGG + Intergenic
1122765447 14:104066376-104066398 AACAGTTTGCACCATGTGCCTGG - Intergenic
1123540946 15:21290542-21290564 GAGAATTAGTACTATGTGCCAGG + Intergenic
1123798580 15:23798238-23798260 AACACTTGGAACTATTTTCAAGG + Intergenic
1123826965 15:24092167-24092189 AACAGCTTGCACTATGTGCCTGG - Intergenic
1123851453 15:24361628-24361650 AACAGCTTGCACTATGTGCCTGG - Intergenic
1123856352 15:24416000-24416022 AACAGCTTGCACTATGTGCCTGG - Intergenic
1124841196 15:33243684-33243706 AGGGCCTAGAACTATGTGCCTGG - Intergenic
1126994642 15:54426880-54426902 AGCACTTACTACTATGTACCAGG - Intronic
1127290998 15:57571047-57571069 AACAATTATAACAATATGCCAGG + Intergenic
1128973684 15:72132152-72132174 AAAACATAGAACTATGTGTTTGG + Intronic
1202949259 15_KI270727v1_random:17682-17704 GAGAATTAGTACTATGTGCCAGG + Intergenic
1133244763 16:4440809-4440831 AAAACTTAAAACAATTTGCCAGG + Intronic
1135925981 16:26694585-26694607 AACACTTTGCACTGTGTGCTTGG - Intergenic
1140044055 16:71428088-71428110 AAAACTTAGAACAAGGCGCCAGG - Intergenic
1149194286 17:54101630-54101652 GGCACTTAGAACTATGAACCTGG - Intergenic
1149417220 17:56471781-56471803 AACATTTAGCACTTTGTGTCTGG - Intronic
1151051505 17:70984006-70984028 AACAGTTTGCACCATGTGCCTGG - Intergenic
1151773262 17:76178633-76178655 ATCACATAATACTATGTGCCAGG + Intronic
1154392206 18:13947847-13947869 AGCACTTAAAACTATATTCCTGG + Intergenic
1155764114 18:29605899-29605921 AACAGATTGAACCATGTGCCTGG + Intergenic
1156065695 18:33140338-33140360 AACAGCTTGAACTGTGTGCCCGG + Intronic
1156280774 18:35635485-35635507 AACTCTGAGAACTATGTTCCTGG - Intronic
1157185525 18:45537116-45537138 AATACCTAGGACAATGTGCCTGG - Intronic
1158094307 18:53753616-53753638 AACCCAGAGAACTATATGCCTGG + Intergenic
1160133439 18:76250446-76250468 AACATGTACAAGTATGTGCCTGG + Intergenic
1162672608 19:12269657-12269679 AACATTTATAACTATTGGCCAGG - Intronic
924983857 2:249874-249896 AGCATTTTGATCTATGTGCCTGG + Intronic
925406763 2:3610715-3610737 AACACTTCTTACTCTGTGCCTGG + Intronic
925564386 2:5234731-5234753 AACCCTTAGAACAATGTGCCAGG - Intergenic
928150611 2:28824952-28824974 AATACTGAGTACTATGTGCAAGG + Intronic
933181344 2:79230680-79230702 AACACCTTGTACCATGTGCCTGG + Intronic
933430117 2:82165651-82165673 AACACTCAAAGTTATGTGCCAGG - Intergenic
933510372 2:83233605-83233627 AACCCTTAGAAACATGTGCCTGG + Intergenic
933825406 2:86155533-86155555 AGCACTTAGAACTCAGTGCCCGG + Intronic
935317908 2:101855437-101855459 AATGCTTACTACTATGTGCCTGG - Intronic
936787122 2:116107114-116107136 AACAATTATAACAATATGCCAGG + Intergenic
936982001 2:118273233-118273255 AACACATAAAAATATGTGCAGGG - Intergenic
939697675 2:145347260-145347282 AACATTTAGAACATTCTGCCCGG - Intergenic
940188830 2:151016799-151016821 ATCAGTTATAACTATGTGACTGG + Intronic
942118130 2:172749115-172749137 AACAGCTTGCACTATGTGCCTGG - Intronic
942950132 2:181712483-181712505 AACACTTGGCACCATGTGCCTGG + Intergenic
942969013 2:181934443-181934465 ATCTGTTAGAACTCTGTGCCTGG + Intergenic
943999784 2:194818969-194818991 AAAATTTAGAACTATATGCTAGG - Intergenic
944864437 2:203846923-203846945 AACATTTAGCAATTTGTGCCAGG - Intergenic
944924538 2:204450982-204451004 AAACTCTAGAACTATGTGCCAGG + Intergenic
945333241 2:208562895-208562917 AACAGCTTGCACTATGTGCCTGG - Intronic
1169188095 20:3636608-3636630 ACCACTTAGAACTCAGTGCCTGG - Intronic
1170302754 20:14904031-14904053 AACACTAAGAAGTTTCTGCCTGG + Intronic
1173818507 20:46005611-46005633 AACACTTATTATCATGTGCCAGG + Intergenic
1174479040 20:50818100-50818122 AAGTCTTAGGATTATGTGCCCGG - Intronic
1184960601 22:47925741-47925763 AGCACTTAGGACTCTGGGCCTGG - Intergenic
954936925 3:54335046-54335068 AGGAAGTAGAACTATGTGCCAGG - Intronic
955153461 3:56392187-56392209 AACACATAGAAATGTTTGCCTGG - Intronic
955603311 3:60671642-60671664 AACATTTAGAATTATTGGCCGGG + Intronic
958943028 3:100335361-100335383 AACATTTAAAGCAATGTGCCAGG - Intronic
959440314 3:106366139-106366161 AATACTAGGAACTAAGTGCCAGG - Intergenic
960279199 3:115762216-115762238 TACACTGAGTACTATGTGCCAGG + Intergenic
962846950 3:139281496-139281518 ACCACTTAGAACAATTAGCCAGG - Intronic
963321515 3:143814260-143814282 GTCACTCAGAAATATGTGCCTGG + Intronic
963380291 3:144521431-144521453 AATACTTATTATTATGTGCCAGG + Intergenic
964387323 3:156162081-156162103 AACATTTAGAACACTGTGCGTGG + Intronic
967140148 3:186550824-186550846 AAAACTTAGAACTATGTATGGGG + Intronic
967192172 3:186994025-186994047 AACACATAGAAATATGTGGAAGG - Intronic
967529380 3:190531553-190531575 AACATTCAGGAGTATGTGCCGGG - Intronic
969181539 4:5445948-5445970 GACACTTAGAGCTCTGTGCCTGG - Intronic
973778031 4:54261391-54261413 CACATTTACATCTATGTGCCAGG + Exonic
980153665 4:129079640-129079662 AACAGCTTGCACTATGTGCCTGG - Intronic
980912982 4:139010214-139010236 AACAATTGAAACTATGGGCCCGG - Intergenic
981691663 4:147515480-147515502 AACACTGAGAACTATGCCTCTGG + Intronic
982046579 4:151453309-151453331 AAAAATTAAAACTATGGGCCAGG - Intronic
982589317 4:157284909-157284931 AACACTTAGAAATGTATGCAAGG - Intronic
988343002 5:29999532-29999554 AAGAGTGAAAACTATGTGCCAGG + Intergenic
989435603 5:41409936-41409958 AACACTGAGAACTAAGTGCCTGG + Intronic
989523596 5:42427949-42427971 GACAGTTAGCACCATGTGCCTGG - Intronic
990139400 5:52685491-52685513 GACACATAGAAGTATGTGCCTGG - Intergenic
990931649 5:61098107-61098129 ATAACTTAGACTTATGTGCCAGG + Intronic
991339150 5:65586719-65586741 ACTACATAAAACTATGTGCCTGG - Intronic
991588080 5:68219991-68220013 AACTCTGAGAACTATGTGCCTGG + Intronic
993779159 5:92044022-92044044 AAAACTTAGAAGTACATGCCTGG + Intergenic
994128419 5:96196397-96196419 AGCACTTAGTATTTTGTGCCTGG - Intergenic
994443626 5:99843192-99843214 ATCACTTAAAACTTTCTGCCTGG - Intergenic
996050668 5:118929379-118929401 AACACTTAGCACTCTGTGAATGG - Intronic
998599825 5:143574236-143574258 AACACTTGGCACTATATGCCAGG - Intergenic
998889398 5:146729997-146730019 GACAGTTTGCACTATGTGCCTGG + Intronic
998945979 5:147339562-147339584 AACAGTTTGCACCATGTGCCTGG + Intronic
999769865 5:154767276-154767298 ACCACGTATTACTATGTGCCAGG - Intronic
1000052770 5:157576206-157576228 AGCACTTAGTTCTTTGTGCCTGG - Intergenic
1001182520 5:169533739-169533761 AATACTTAGAATCATGTGCATGG + Intergenic
1002488014 5:179552783-179552805 AACACTTATTATTCTGTGCCAGG - Intronic
1004303481 6:14479028-14479050 AACACTTAGCACACTGTGCTGGG + Intergenic
1004805675 6:19201555-19201577 AACAGCTTGAACCATGTGCCTGG - Intergenic
1005889005 6:30121039-30121061 CACATTAAGAACTTTGTGCCGGG - Intergenic
1007748090 6:44055471-44055493 AACACATAGCACTATGTGCCAGG - Intergenic
1007984795 6:46197164-46197186 AACAGTTTGCACCATGTGCCTGG - Intergenic
1009051629 6:58283124-58283146 AACAGCTTGAACCATGTGCCTGG + Intergenic
1009344216 6:62593999-62594021 AAAAAATAGAACTATTTGCCGGG + Intergenic
1009377504 6:62990709-62990731 AACAGCTTGAACCATGTGCCTGG - Intergenic
1010405283 6:75497770-75497792 AGCCCTTAGAACTCTGTGTCTGG - Intergenic
1012210257 6:96510173-96510195 AACAGCTTGTACTATGTGCCTGG + Intergenic
1012570612 6:100722586-100722608 AGCACTTAGAACTATGTAGCTGG + Intronic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1013748411 6:113372992-113373014 GACACTTAGGTCTATGTGCTTGG - Intergenic
1014004698 6:116404642-116404664 AGCTCTTAGCATTATGTGCCTGG + Intronic
1014135084 6:117879665-117879687 AACACTTAGAAGTCTGAGGCAGG - Intergenic
1015748699 6:136538488-136538510 AAAATTTAAAACTATGGGCCAGG + Intronic
1016729462 6:147413034-147413056 CACACTCATAACTATGTGACAGG + Intergenic
1018943782 6:168329973-168329995 GACACTTAGAACAATATACCTGG + Intergenic
1020954217 7:14719738-14719760 AACACATTGAATTATATGCCTGG - Intronic
1022209994 7:28199138-28199160 GGCACTTAGTACTAAGTGCCAGG - Intergenic
1022392318 7:29954126-29954148 AGCACTGGGAACTGTGTGCCTGG - Intronic
1024408334 7:49008771-49008793 AGCATTTAGAAATATGTGCTAGG - Intergenic
1026551135 7:71369515-71369537 AAGAATGAAAACTATGTGCCAGG + Intronic
1028130507 7:87166744-87166766 AACAATAAATACTATGTGCCAGG + Intronic
1028323133 7:89486990-89487012 ATCACATAGAATTATATGCCTGG - Intergenic
1028961002 7:96749813-96749835 AACAATTTGCACTGTGTGCCTGG - Intergenic
1030322001 7:108179041-108179063 GAAGCCTAGAACTATGTGCCAGG - Intronic
1030786651 7:113671155-113671177 TACAGCTTGAACTATGTGCCTGG + Intergenic
1031114393 7:117652025-117652047 AATACTTAGTTCTCTGTGCCTGG - Intronic
1033063223 7:138127722-138127744 AACAAGTAGAAATTTGTGCCTGG + Intergenic
1033880104 7:145870733-145870755 AACATTTAGAAATATGTTCTTGG + Intergenic
1034143474 7:148846273-148846295 AACACTTAGAACTCTGTTATAGG + Intronic
1037063238 8:14542651-14542673 AGCTTTTAAAACTATGTGCCAGG - Intronic
1040492244 8:47935204-47935226 AAAACTTAAAACTATTGGCCAGG + Intronic
1041450084 8:57996295-57996317 GACACCTAGAACTATATGCAAGG - Intronic
1041617693 8:59927542-59927564 TAAACTTAGAACTAAGTGTCTGG + Intergenic
1041823924 8:62069519-62069541 AAAACATAGAACTATGTGTATGG + Intergenic
1042449347 8:68926219-68926241 AACACTTAAAAGTCTGTTCCTGG - Intergenic
1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG + Intergenic
1043665855 8:82812126-82812148 AACAACTACTACTATGTGCCAGG + Intergenic
1044327103 8:90870814-90870836 AACATTTATTGCTATGTGCCAGG - Intronic
1044701215 8:94966925-94966947 AAAACTTAGAACTATTTTCAAGG + Intronic
1045207464 8:100056930-100056952 AACAGTTTGCACTGTGTGCCCGG + Intronic
1045743791 8:105392934-105392956 AACACTTGGAATTATGTGTAAGG + Intronic
1046316014 8:112502458-112502480 ATCACTTGGAACTGTATGCCAGG - Intronic
1046823305 8:118659300-118659322 ATGACTTAGTTCTATGTGCCAGG + Intergenic
1047569073 8:126078164-126078186 AACACTGTGAACTATGTAACAGG - Intergenic
1047676920 8:127212544-127212566 AACACTTTCAACAATGTTCCAGG + Intergenic
1047853044 8:128879603-128879625 AGCACATAGAACTCTGTGCACGG + Intergenic
1048165897 8:132061254-132061276 AACACTTAGAACCATGCACTGGG + Intronic
1050783188 9:9365094-9365116 AACACTGAGTAATATGTGCTGGG + Intronic
1051172354 9:14331438-14331460 AATATTTAGAAGAATGTGCCTGG - Intronic
1051750523 9:20336699-20336721 CACACTTAGCACACTGTGCCTGG - Intergenic
1055337510 9:75247555-75247577 AACAACTTGTACTATGTGCCTGG + Intergenic
1056310359 9:85334558-85334580 AACCTTTAGAGCTATGTGCTTGG + Intergenic
1056418593 9:86401788-86401810 CACAATTAGAACTCTGGGCCGGG + Intergenic
1056595199 9:88002221-88002243 AACAGTTGGCACCATGTGCCTGG + Intergenic
1056695178 9:88842888-88842910 CAAACTTAGCACTGTGTGCCGGG - Intergenic
1057835795 9:98444182-98444204 AAGGCTTAGAACTGGGTGCCTGG - Intronic
1058821241 9:108732138-108732160 AACACTTAGAAATTAGGGCCGGG + Intergenic
1059602750 9:115798595-115798617 AACACTCACTACTATTTGCCTGG + Intergenic
1060021313 9:120133778-120133800 AACAGTTTGTACTGTGTGCCTGG - Intergenic
1060430217 9:123544801-123544823 ATAAATAAGAACTATGTGCCAGG + Intronic
1061510165 9:131055900-131055922 AACACTTAGAACTTTAGGCTGGG + Intronic
1186358690 X:8815281-8815303 AAATCTTAGATCTATGTGCAAGG - Intergenic
1188134268 X:26474907-26474929 ACCACTTAAGACTATGTGCTTGG + Intergenic
1188259663 X:28008011-28008033 AACAGCTTGCACTATGTGCCTGG - Intergenic
1189809913 X:44772357-44772379 AAAACTTAGAAAAATTTGCCAGG - Intergenic
1189845173 X:45129223-45129245 AACACTTAGAAATATGTACTAGG + Intergenic
1191188616 X:57640460-57640482 AACAGTTTGCACTGTGTGCCTGG + Intergenic
1194082865 X:89489951-89489973 AATAGTTTGCACTATGTGCCTGG - Intergenic
1196540347 X:116900221-116900243 AACACCTTGCACCATGTGCCTGG - Intergenic
1197255136 X:124254718-124254740 AAATTTTAGAACTAAGTGCCAGG + Intronic
1198196489 X:134367981-134368003 AGCCCATAGAACTCTGTGCCTGG - Intergenic
1199193844 X:145003833-145003855 AACACATAAAACTATGTGCTTGG - Intergenic
1200435517 Y:3145823-3145845 AATAGTTTGCACTATGTGCCTGG - Intergenic
1200818498 Y:7557760-7557782 ATCACTAAGAACTAAGTCCCTGG + Intergenic