ID: 1108558579

View in Genome Browser
Species Human (GRCh38)
Location 13:51620772-51620794
Sequence CACTTCCCATTTAGGATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108558579_1108558586 16 Left 1108558579 13:51620772-51620794 CCCAGAATCCTAAATGGGAAGTG 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1108558586 13:51620811-51620833 ATGTCAATATTTCTCTCACCCGG 0: 1
1: 0
2: 2
3: 20
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108558579 Original CRISPR CACTTCCCATTTAGGATTCT GGG (reversed) Intronic
905500168 1:38430128-38430150 CACTTGTCATTTAGAATTATTGG - Intergenic
906978956 1:50607830-50607852 CAGTTCCCACCTGGGATTCTGGG - Intronic
907337015 1:53706459-53706481 CACTTCCCATCTAGGGACCTAGG - Intronic
907737845 1:57132574-57132596 CATTTCACATTTTGGATTTTTGG + Intronic
908788834 1:67761101-67761123 CCCTTCACTTCTAGGATTCTGGG + Intronic
908901347 1:68959876-68959898 CCCTTGCCACTTAGGGTTCTTGG + Intergenic
911667118 1:100565572-100565594 CACCTCCCATTTATCTTTCTGGG - Intergenic
912932298 1:113975344-113975366 CCCTTTCCATTTTGGATTCTCGG + Exonic
914048471 1:144111320-144111342 CACTTCCCATCTTAGCTTCTGGG - Intergenic
914130713 1:144854128-144854150 CACTTCCCATCTTAGCTTCTGGG + Intergenic
915155532 1:153872567-153872589 CACTTCCCAGTTAGTTTTGTGGG - Intronic
916690205 1:167182969-167182991 GACTTCCCATTTAGGATCATTGG - Intergenic
917179253 1:172276721-172276743 GGTTCCCCATTTAGGATTCTGGG - Intronic
918229213 1:182513057-182513079 CTGTTCCCATTTAGGGTTGTAGG + Intronic
918604859 1:186411170-186411192 CATTTCAGATTTTGGATTCTTGG + Intronic
918811562 1:189127858-189127880 CTCTTCCCATTGTGTATTCTTGG - Intergenic
919700618 1:200627711-200627733 CACATCTCATTTAGAATCCTGGG - Intronic
923183225 1:231543516-231543538 CATTTCGGATTTAGGATTTTTGG + Intronic
924164543 1:241268189-241268211 CACCTGCCATTCAGCATTCTGGG + Intronic
1064786627 10:18904742-18904764 CACTGCCCATGCAGTATTCTTGG + Intergenic
1064970329 10:21059382-21059404 GACTTGCCCTTTAGTATTCTGGG - Intronic
1065695606 10:28376818-28376840 CACTGCCCATTTAGGACTCCAGG + Intergenic
1066134562 10:32431523-32431545 CTCTTACCATTGTGGATTCTTGG + Intergenic
1066305059 10:34132742-34132764 CTGTTCCCATTTAGGGTTATGGG - Intronic
1067176993 10:43957122-43957144 CACTTCTCCTTTAGGGGTCTGGG - Intergenic
1071845952 10:89521429-89521451 CTCTGCCCGTGTAGGATTCTAGG - Intronic
1072010876 10:91301911-91301933 CATTTGTCATTTAGAATTCTTGG + Intergenic
1073510384 10:104039121-104039143 AACTTCTCATTTTGGATTCCAGG - Exonic
1074696625 10:116055669-116055691 CACTTCCGCTTGATGATTCTGGG + Intergenic
1074962912 10:118464002-118464024 CACTCCCCATTTGGGGTTCTGGG + Intergenic
1075427920 10:122356331-122356353 CACTGCCCACCTAGGATTCCAGG - Intergenic
1078914698 11:15768490-15768512 CCCTTCCCCTTTATGAGTCTTGG - Intergenic
1079311352 11:19369085-19369107 CATTTCCCACTTAGGAAGCTCGG - Intronic
1079524339 11:21366372-21366394 TCCTTCCCATTTTGGATTTTAGG + Intronic
1079724824 11:23867738-23867760 GAATTCCCATTAAGGCTTCTAGG - Intergenic
1080092531 11:28365601-28365623 CATTCCTCATTTAGGACTCTGGG + Intergenic
1083125088 11:60557009-60557031 CTCTTCCCATTGTGTATTCTTGG - Intergenic
1084088332 11:66864905-66864927 CACTGCCCATTTCCGCTTCTCGG + Intronic
1085259690 11:75197320-75197342 CACTTCCCATGAAGGCTTCTGGG - Intronic
1088628538 11:111751450-111751472 CATTTCACATTTTGGATTTTTGG - Intronic
1089410591 11:118238570-118238592 ACCTTCCCATTTAGGAACCTGGG + Intronic
1090774748 11:129953633-129953655 CAATTCAAATTTAGAATTCTGGG + Intronic
1094631557 12:32180405-32180427 CACATTCTATTTATGATTCTGGG + Intronic
1095498886 12:42814937-42814959 AACTTCCAAATTAGGTTTCTAGG + Intergenic
1106211286 13:27649627-27649649 CAATTCAAATTTAGGATTATAGG - Intronic
1106972705 13:35162442-35162464 CATTTTCCTTTTAGGATTCAAGG + Intronic
1108558579 13:51620772-51620794 CACTTCCCATTTAGGATTCTGGG - Intronic
1110297567 13:73886189-73886211 CATTTCCCATTGAGGATACATGG - Intronic
1110881145 13:80574187-80574209 CACTTCCAATTTTGGCATCTCGG + Intergenic
1111413762 13:87912190-87912212 CTCTTCTCATTTAGGTTTGTGGG - Intergenic
1112259726 13:97867432-97867454 CTCTTCCCATTTAGGGTTGTGGG - Intergenic
1112345418 13:98585224-98585246 CTCTTCCAATTTGGGATTGTTGG + Intergenic
1113420646 13:110169361-110169383 CATTTCCCTTTTATGGTTCTTGG + Intronic
1115781338 14:36772155-36772177 CACTTCCTATGTAGGCTTTTGGG - Intronic
1115927969 14:38458289-38458311 CACTTCCAATTTGTCATTCTAGG + Intergenic
1117202114 14:53401584-53401606 CCCTTCCCATTTTGAACTCTTGG + Intergenic
1117465214 14:55986497-55986519 CATTTACCATTTATGACTCTAGG + Intergenic
1117753181 14:58945005-58945027 CATTTCCAATTTCGAATTCTAGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1119040682 14:71271695-71271717 CACTTCACATCTAAAATTCTTGG + Intergenic
1120011741 14:79423296-79423318 CACTTTCCATTTTGTACTCTGGG + Intronic
1121224835 14:92313828-92313850 GACTTCCCATCTTGCATTCTTGG - Intergenic
1124583032 15:30978980-30979002 CAATTCCCATATCAGATTCTGGG + Intronic
1128889168 15:71315506-71315528 TCCTTCCCATTTGGAATTCTGGG - Intronic
1129647062 15:77445905-77445927 AACTTCCCATTTAATATTTTTGG + Intronic
1129832569 15:78680354-78680376 CATTTCCAATTTCGGATTTTCGG - Intronic
1135574115 16:23572004-23572026 AACATCACATTTTGGATTCTAGG + Exonic
1140993830 16:80241561-80241583 AACTTCTCAATTAGGATTGTGGG + Intergenic
1142982885 17:3681546-3681568 CACTTCTGTTTTGGGATTCTTGG - Intronic
1149525514 17:57352503-57352525 CTGTTCCCATTTAGGAATCAGGG - Intronic
1150474905 17:65467424-65467446 CACTTTGTATTCAGGATTCTAGG + Intergenic
1156951867 18:42910448-42910470 CTGTTCCCATTTAGGGTTGTGGG - Intronic
1157570210 18:48707239-48707261 CATTTCCCATTTACCATTCAAGG + Intronic
1159005405 18:63005775-63005797 CACTTCCCATTTCAGTGTCTCGG + Intergenic
1159164882 18:64686681-64686703 CATTTGCCATTTAGAATTATTGG - Intergenic
1160117605 18:76096443-76096465 CACTTCCCACAAAGAATTCTGGG + Intergenic
1162136326 19:8557657-8557679 CACTTCCCATGAAGGATGCCAGG + Intronic
1163369788 19:16895663-16895685 CATTTCAGATTTAGGATTTTTGG - Intronic
1166670640 19:44707745-44707767 CACTCCCCATGTAGGGTGCTGGG - Intronic
1202687924 1_KI270712v1_random:64218-64240 CACTTCCCATCTTAGCTTCTGGG - Intergenic
925669788 2:6298860-6298882 TACTTCCACTTTAGGCTTCTTGG - Intergenic
925813857 2:7727987-7728009 CACTTCAGATTTTGGATTTTGGG - Intergenic
927958887 2:27227006-27227028 CTCTTGACATTTAAGATTCTTGG - Intronic
931092779 2:58904119-58904141 CACTTCCCATTAAAAATCCTTGG - Intergenic
931533487 2:63244958-63244980 CACTTCAGATTTTGGATTTTTGG - Intronic
933958427 2:87391369-87391391 CACTTCCCATCTTAGCTTCTGGG + Intergenic
934242555 2:90283288-90283310 CACTTCCCATCTTAGCTTCTGGG + Intergenic
934270621 2:91533390-91533412 CACTTCCCATCTTAGCTTCTGGG - Intergenic
934986471 2:98890693-98890715 CATTTCAGATTTAGGATTTTTGG - Intronic
936076788 2:109406364-109406386 GACTGCCCATTTAGGGTCCTCGG - Intronic
936756335 2:115717210-115717232 CACTTTCCAATTAGGATGCCTGG + Intronic
937330985 2:121029664-121029686 CACTTCAGATTTTGGATTTTCGG + Intergenic
937433236 2:121858552-121858574 CTCATCCCATTTAGAATTCAGGG - Intergenic
937582433 2:123503231-123503253 AATTTCCCATTTAATATTCTTGG + Intergenic
942099164 2:172560919-172560941 CATTTCCCAGTTATGATTCATGG + Intronic
942832991 2:180258682-180258704 CACTTTCCCTCTAGGATTTTGGG - Intergenic
944940571 2:204620744-204620766 TACTTCCCATCAAGCATTCTGGG - Intronic
944980892 2:205118907-205118929 AATTTTGCATTTAGGATTCTAGG + Exonic
945362084 2:208904832-208904854 CATTTCTCATTTAGAATTATTGG - Intergenic
945425983 2:209702773-209702795 CACTTCCCACTCAAGATACTGGG + Intronic
945744928 2:213708822-213708844 CACTTGCCATTTAACATTTTGGG - Intronic
946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG + Intergenic
948496650 2:238354421-238354443 CAATTCCGATTTAGGATTGTAGG + Intronic
1169026423 20:2375188-2375210 CACTTCCCCTCTAGGATTCCAGG - Intergenic
1169313913 20:4572119-4572141 CACTTCCCCTGGAGGTTTCTGGG - Intergenic
1170125576 20:12959818-12959840 TATTTCCCATTTGGGATCCTGGG - Intergenic
1170946950 20:20900133-20900155 AAGTTTACATTTAGGATTCTTGG + Intergenic
1173689389 20:44948310-44948332 TACTTCACATTTTGGCTTCTGGG + Intronic
1178024625 21:28452207-28452229 AAGATCCCATTTGGGATTCTGGG - Intergenic
1178768081 21:35473731-35473753 GACTTCCCATTCTGGTTTCTAGG - Intronic
1179140028 21:38717270-38717292 CACTTCCCTATTAGTTTTCTTGG - Intergenic
1179775027 21:43656625-43656647 ACCTCCCCATTTAGTATTCTGGG + Exonic
1180248500 21:46564083-46564105 CAGTTCCTATGTAGGATTTTGGG + Intronic
1180368319 22:11960101-11960123 CACCTCCCAGTTAGGCTGCTCGG - Intergenic
1183421803 22:37715997-37716019 CACTGGCCATTTGGGACTCTGGG + Intronic
1184445202 22:44543010-44543032 CACTTCACCTTTAGGAGCCTCGG + Intergenic
1184655544 22:45940247-45940269 CACTTCACAATTAGGACACTGGG + Intronic
949339219 3:3010352-3010374 CACTGCCAGTTTAGGATTCAGGG + Intronic
949380348 3:3438182-3438204 CTCTACCCTTTTAGGATTTTTGG - Intergenic
951402805 3:22255066-22255088 AACTTTCCATTTAGTATTTTTGG + Intronic
951745401 3:25972266-25972288 CACTTCCCACTTGTGTTTCTTGG + Intergenic
952104236 3:30050836-30050858 CGCTTCCCAGTTAGGCTACTCGG - Intergenic
955703377 3:61704267-61704289 TACCTACCATTTAGGATTGTTGG + Intronic
955914730 3:63895347-63895369 CACTGCCCATGTAGCATTGTAGG + Intronic
956358126 3:68416403-68416425 CCCAGACCATTTAGGATTCTTGG - Intronic
957101773 3:75837177-75837199 TACCTCCCATTTAGGCTGCTTGG + Intergenic
957475704 3:80721166-80721188 CACCTCCGATTCAAGATTCTGGG + Intergenic
959845372 3:111026492-111026514 CACTTCAGATTTCGGATTTTTGG + Intergenic
965962289 3:174442324-174442346 CCCTTTCCATTAAGAATTCTTGG - Intronic
967037165 3:185656508-185656530 GACTTCTCATTTGGAATTCTGGG + Intronic
968011022 3:195275885-195275907 CACTACCCTTTTTGGATTCAGGG - Exonic
970564946 4:17322961-17322983 CATTTCAGATTTTGGATTCTCGG - Intergenic
971009156 4:22412428-22412450 CATTTTGGATTTAGGATTCTTGG - Intronic
971185913 4:24375846-24375868 CAGTTCCCACTTAGGAGTTTGGG - Intergenic
973218805 4:47702046-47702068 AATTTCTCATTTAGGTTTCTTGG + Intronic
973733810 4:53850213-53850235 CACTGCCCCATTAGGCTTCTGGG + Intronic
974708289 4:65552497-65552519 CAAATCTCATTTAGGATTCAAGG + Intronic
975309240 4:72884158-72884180 CACATCCCAGTTAGGCTACTCGG + Intergenic
976717686 4:88140169-88140191 GTCTTCCCATTTAGGTTTTTAGG - Intronic
977241340 4:94574019-94574041 CATTTCAGATTTTGGATTCTTGG + Intronic
979734668 4:124068530-124068552 CACTTCTCTTTTATGATTATAGG - Intergenic
980530844 4:134051487-134051509 CACTGCCAATTGAGCATTCTGGG + Intergenic
981888639 4:149710330-149710352 CACTATACATTTAGAATTCTAGG - Intergenic
982694388 4:158582767-158582789 CATTTCCCATATTGGTTTCTGGG - Intronic
984608124 4:181807895-181807917 CACTTCCCCTAGAGGATTATGGG - Intergenic
985190950 4:187372209-187372231 CACTTCACATTTCAGATTTTTGG + Intergenic
985880952 5:2638837-2638859 CACTTCCCATGCAGGGCTCTGGG - Intergenic
985937057 5:3105680-3105702 CACTTCCCATCTAGGACCCTAGG - Intergenic
986932990 5:12850924-12850946 CACATCCCATTAATGAGTCTGGG + Intergenic
987394897 5:17413682-17413704 CACTTTCCATTCAGGTTTCAGGG + Intergenic
988385854 5:30564160-30564182 CACTTACCATTCAGGTTGCTAGG + Intergenic
988694618 5:33608688-33608710 CACTTACCATTCAGGCTCCTTGG - Intronic
988999189 5:36743441-36743463 CACTTCCCATATATTATTTTAGG + Intergenic
991042961 5:62194486-62194508 CTTTTCCCATTATGGATTCTTGG + Intergenic
991091981 5:62702365-62702387 CACTTCCCAGGCAGGATGCTGGG - Intergenic
991640887 5:68751139-68751161 CACATCACATTCAGCATTCTAGG - Intergenic
993616739 5:90122397-90122419 CACTTCTCATTTGGAACTCTAGG + Intergenic
994245991 5:97477078-97477100 CAGTTCCAATTTAGGACTTTAGG + Intergenic
994826344 5:104717927-104717949 TACTTCCCAGTTAGGCTGCTCGG - Intergenic
995021482 5:107371987-107372009 CACTTGGCATTTTGGATCCTTGG - Intergenic
995499497 5:112789259-112789281 CACTTCACAATTTGGATTTTTGG - Intronic
996801624 5:127409762-127409784 CACTTCCCATGTTGGAATCGAGG + Intronic
997921779 5:137986925-137986947 CACTTCAGATTTTGGATTTTTGG + Intronic
998119346 5:139562644-139562666 CCCTTCCCAGTTAAGAGTCTCGG - Intronic
998240930 5:140443741-140443763 AATTTCCCCTTGAGGATTCTTGG + Intronic
999356535 5:150939345-150939367 CCTTTCCCATTTAGGAGTCTTGG - Intergenic
1000270853 5:159681634-159681656 TTCTTCCCTTCTAGGATTCTGGG + Intergenic
1003742558 6:8959744-8959766 TATTTCCCATTTAGGAACCTGGG - Intergenic
1006763985 6:36488673-36488695 CACTTCAAATTTCGGATTTTTGG + Exonic
1006993783 6:38238891-38238913 CTCTTCCCTTTTAGAATTCAGGG - Intronic
1008086854 6:47254375-47254397 AATTTCCCATTTAGTATTTTCGG + Intronic
1008379565 6:50826074-50826096 CACTTCCGAGTTAGGAAGCTGGG + Intronic
1008808760 6:55466130-55466152 CACTTCCCATAGAGGCTTGTAGG - Intronic
1010126178 6:72434573-72434595 CAATTGCCATTTAGGATTGTTGG - Intergenic
1011750456 6:90449859-90449881 CCCTTCCCCATTAGGATCCTTGG - Intergenic
1012455055 6:99394328-99394350 CAGTCCCCATCTCGGATTCTGGG + Intergenic
1012677727 6:102137975-102137997 CTCTTCCCTGTTAGGCTTCTGGG + Intergenic
1012729261 6:102860045-102860067 CATTTTCCATTTAGGAGACTAGG + Intergenic
1014139185 6:117920583-117920605 CTCCTCCCATCTAGCATTCTTGG - Intronic
1014986531 6:128017955-128017977 CACTTCCCATTTTGGAAGCCTGG - Intronic
1015904609 6:138103974-138103996 TACTTCCCAGTTTGGATTCAAGG + Intronic
1015991572 6:138950012-138950034 CATTTCCCCTTTAGGACTTTTGG + Intronic
1016950039 6:149570508-149570530 CACTTCCCAACTAGGAGCCTAGG - Intronic
1018228965 6:161657267-161657289 CACTTCTCATGTAGATTTCTGGG + Intronic
1018344679 6:162888252-162888274 CACTTCCCATCCTGGAGTCTTGG + Intronic
1020666011 7:11044993-11045015 CACTTCAGATTTTGGATTTTTGG + Intronic
1021940788 7:25677211-25677233 CACTTCTCAATGAGGATTCCAGG + Intergenic
1023387693 7:39676586-39676608 CATTTCACATTTTGGATTTTTGG + Intronic
1023958590 7:44908044-44908066 CATTTCCGATTTTGGATTTTTGG + Intergenic
1025965122 7:66262501-66262523 CATCTCCCATTTGGGGTTCTGGG - Intronic
1027276875 7:76566628-76566650 TGCTTCCCATTTAGGCTGCTCGG + Intergenic
1030457070 7:109789490-109789512 CTTTTCCCATTTTGTATTCTTGG + Intergenic
1033572328 7:142642949-142642971 CAGTTCCCATTTGGGATAATAGG + Intergenic
1035486303 7:159228882-159228904 CCATCCCCATTTAGAATTCTGGG + Intergenic
1038718514 8:30012678-30012700 CACTTTCCTTGTAGGTTTCTTGG + Intergenic
1039610973 8:38919108-38919130 CACCTCCAATCCAGGATTCTAGG - Intronic
1041315860 8:56561801-56561823 CTTTCCCCATTTAGTATTCTTGG + Intergenic
1044159307 8:88893366-88893388 CACTTCTCATCTATTATTCTAGG + Intergenic
1044789117 8:95828431-95828453 AACTTCCCATTTATATTTCTAGG + Intergenic
1045020893 8:98043540-98043562 CACTTCCCATCTGGAATTCTGGG - Intronic
1046582480 8:116110577-116110599 CTATTCCCATTTAGGGTTGTGGG - Intergenic
1047810277 8:128401140-128401162 CATTTCAAATTTAGGATTTTTGG + Intergenic
1048471847 8:134711364-134711386 CATTTCCGATTTCGGATTTTTGG + Intronic
1048596179 8:135868781-135868803 CACTTGCCATTTGGGATTCTAGG + Intergenic
1050274226 9:3979997-3980019 GACTTGCCGTTTAGGAGTCTGGG + Intronic
1050622040 9:7464137-7464159 CACTTCACCTTTAGGAGTGTAGG - Intergenic
1052767581 9:32657376-32657398 CCCTTCCCACTTTGGCTTCTGGG + Intergenic
1052837047 9:33258710-33258732 CATTTCCCTATTAGGATTGTTGG - Intronic
1052884848 9:33635002-33635024 CAGTTCCCATTTGGGATAATAGG + Intergenic
1056487564 9:87074372-87074394 TATTTCCCATTTAGGATCATCGG + Intergenic
1058094455 9:100843706-100843728 CTGTTCCCATGAAGGATTCTTGG + Intergenic
1058387541 9:104456147-104456169 CACTTCCCTTTTATTATTTTAGG + Intergenic
1060200192 9:121647946-121647968 CAATTCCCATCCAGGTTTCTGGG - Intronic
1186995944 X:15122600-15122622 TTCTTCCCATTTGGGATTCTTGG - Intergenic
1187059790 X:15775434-15775456 AACTTGCCATTTATGATTCCAGG + Intronic
1195574224 X:106431653-106431675 CACTTCCCATTTTTGATTCCAGG - Intergenic
1195623479 X:106983137-106983159 CACTTCCGATTTTAGATTTTTGG + Intronic
1196887641 X:120263031-120263053 CACTTCCCTTTGAGGATGCTGGG + Intronic
1197815360 X:130493060-130493082 CACTCTCCATTTAAGACTCTAGG + Intergenic
1199013135 X:142780248-142780270 CACTTCCCATTTCTCATTTTAGG - Intergenic
1199879591 X:151962730-151962752 CACATTGCCTTTAGGATTCTAGG - Intronic