ID: 1108558698

View in Genome Browser
Species Human (GRCh38)
Location 13:51621784-51621806
Sequence CTGGTTCTGGAGCAGCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108558695_1108558698 21 Left 1108558695 13:51621740-51621762 CCTAAATGGCAGTCAGCATCAGA 0: 1
1: 0
2: 1
3: 12
4: 203
Right 1108558698 13:51621784-51621806 CTGGTTCTGGAGCAGCCATGTGG 0: 1
1: 0
2: 1
3: 41
4: 296
1108558694_1108558698 28 Left 1108558694 13:51621733-51621755 CCTCAGGCCTAAATGGCAGTCAG 0: 1
1: 0
2: 1
3: 4
4: 120
Right 1108558698 13:51621784-51621806 CTGGTTCTGGAGCAGCCATGTGG 0: 1
1: 0
2: 1
3: 41
4: 296
1108558693_1108558698 29 Left 1108558693 13:51621732-51621754 CCCTCAGGCCTAAATGGCAGTCA 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1108558698 13:51621784-51621806 CTGGTTCTGGAGCAGCCATGTGG 0: 1
1: 0
2: 1
3: 41
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108558698 Original CRISPR CTGGTTCTGGAGCAGCCATG TGG Intronic
900120409 1:1046448-1046470 CTGGCTCAGGAGGAGCCCTGGGG - Exonic
900310042 1:2029220-2029242 CTCCTTCTGGATCAGCCAGGCGG + Exonic
900913721 1:5620031-5620053 CTTGTTCTGCAGCAGCCAGAGGG - Intergenic
901979624 1:13023840-13023862 CTGGCTCTGCTGCAGCCCTGTGG + Intronic
902002457 1:13205098-13205120 CTGGCTCTGCTGCAGCCCTGTGG - Intergenic
902630088 1:17699605-17699627 CTGGTGCTGGAGCTGGCATCTGG + Intergenic
903028224 1:20444532-20444554 CTGGTTCAGGAGCCTCCCTGGGG - Intergenic
903368336 1:22818464-22818486 ATGGTTCTGGAGCTGCCAGAGGG - Intronic
905529994 1:38670409-38670431 AAGGTGATGGAGCAGCCATGGGG - Intergenic
907243806 1:53094690-53094712 CTGGGTCTGCATCAGCCAGGCGG - Intronic
907945132 1:59129060-59129082 CTAGTTGGGGAGCAGCCATGGGG - Intergenic
908444260 1:64186992-64187014 CTGATTCTGGGTCGGCCATGTGG + Intergenic
908450768 1:64252324-64252346 CTGGCTCTGGAGAGGCCAGGTGG + Intronic
909257951 1:73448320-73448342 CTGGAGCTGGAGCAGCTAGGAGG + Intergenic
911643095 1:100309710-100309732 CTAGTGCTGGAGCACCCAAGAGG + Intergenic
912385350 1:109268663-109268685 ATAGTGCTGGAGCAGCCAGGCGG - Exonic
912634115 1:111275360-111275382 CTAGTTCTGAAGAGGCCATGAGG - Intergenic
912680551 1:111726422-111726444 CTGGGACTGGAGCAGCAGTGAGG - Exonic
912961664 1:114201456-114201478 CTGGTTCAGTAGCAGCAATGGGG + Intergenic
913053192 1:115134680-115134702 CTGGATCTGCAGCAGCCCTCAGG - Intergenic
919795391 1:201318612-201318634 CAGGTTCCAGAGCAGCCCTGGGG - Exonic
920215138 1:204357633-204357655 CTGGTCTTGGCGCACCCATGGGG - Intronic
920764458 1:208818372-208818394 CTGGTGTTGGAGAAACCATGAGG - Intergenic
920794047 1:209121287-209121309 ATGGTTCTGGAGAAGGGATGTGG - Intergenic
921188075 1:212686662-212686684 CTGGTCCTGGAGCTCCCAGGAGG + Exonic
921283621 1:213589977-213589999 GTGTGTCTGGAGCAGCAATGAGG + Intergenic
922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG + Intronic
924771723 1:247085696-247085718 GTGGTCCAGGAGCAGCCAAGGGG - Intergenic
924775878 1:247114287-247114309 GTGGTCCAGGAGCAGCCAAGGGG + Intergenic
1063376395 10:5557163-5557185 CTGGTGCTGGAGGAGGCCTGAGG + Intergenic
1063858180 10:10278587-10278609 GCAGTTCTGGTGCAGCCATGTGG - Intergenic
1064218822 10:13422057-13422079 TTGGTTCTGCAGAAGCCAGGAGG - Intergenic
1065320315 10:24503010-24503032 AGGATCCTGGAGCAGCCATGGGG + Intronic
1066371584 10:34822240-34822262 CTGGTTCTGGAGAACCTATTGGG - Intergenic
1066996653 10:42570409-42570431 CTGGATCTGGAGTTGCCAAGAGG - Intergenic
1067287034 10:44914320-44914342 CTCCCTCTGGAGCAGTCATGTGG + Intronic
1070580082 10:77712384-77712406 CTGGTTAAGTGGCAGCCATGGGG + Intergenic
1070717913 10:78735850-78735872 CTGGTGCTGTAGCAGCCATATGG - Intergenic
1071066171 10:81638875-81638897 CTGGTTTTGTAACACCCATGTGG - Intergenic
1072699154 10:97627546-97627568 CTGGCTCTGTCCCAGCCATGAGG + Intronic
1075076693 10:119356661-119356683 ATGGTTCTGGGGCACACATGGGG - Intronic
1075217792 10:120553776-120553798 CTGGAGCTGGAGTGGCCATGAGG + Intronic
1075511401 10:123075227-123075249 ATGGTTGTGGAGCTGCCATACGG - Intergenic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1075929583 10:126284373-126284395 CCGTATCTGTAGCAGCCATGTGG + Intronic
1076348754 10:129800143-129800165 CTGGGCCTGGAGCAGCCGTGGGG - Intergenic
1076630275 10:131848257-131848279 CTGATGCTGCAGCCGCCATGAGG + Intergenic
1076816402 10:132917103-132917125 CTGGCTCTGGTTCTGCCATGTGG + Intronic
1076834951 10:133016373-133016395 CAGGTCCTGCAGCTGCCATGGGG - Intergenic
1077259031 11:1605628-1605650 CTCTTTCTGGTCCAGCCATGGGG + Intergenic
1078507265 11:11961578-11961600 TTGGCTCTGGGGCAGCCATCTGG - Intergenic
1081534139 11:43985113-43985135 CAGGTACTGGTGCAGCCAGGAGG - Intergenic
1081792636 11:45799158-45799180 CTGGGTCTGGGGCAGCAATGTGG - Intergenic
1081865540 11:46357694-46357716 CTGGTGGAGGAGCAGGCATGTGG + Intronic
1082260692 11:50074567-50074589 TTGGGCCTGCAGCAGCCATGAGG + Intergenic
1083126261 11:60569086-60569108 CTGTTTCTGGGGGAGCCATGAGG + Intergenic
1083934672 11:65864027-65864049 CTGATCCTGGAGCAGCCACAGGG - Intronic
1084909880 11:72379855-72379877 CTAGTTCTGGGGCAGGAATGGGG + Intronic
1085041024 11:73326350-73326372 CTGGTTCTGGAGAGGTCAGGTGG + Intronic
1085265172 11:75233484-75233506 CTGGTGCTCTAGCAGCCATTTGG + Intergenic
1085296819 11:75436070-75436092 CAGGGTCTGGAGTTGCCATGAGG - Intronic
1088143041 11:106640829-106640851 CTGGTTCTCAAGTACCCATGAGG - Intergenic
1090076779 11:123584655-123584677 CTGGTGCTGGGGCAGCCTGGGGG + Intronic
1090387472 11:126365244-126365266 CTGGTTGTGCACCAGCCCTGAGG + Intronic
1090390038 11:126382442-126382464 CTGGTTGTGCACCAGCCCTGAGG + Intronic
1091879565 12:3966000-3966022 CTCGTTCTGGGGCAGCCTTCAGG - Intergenic
1093007301 12:14064420-14064442 CTGGTTACTGAGCAACCATGAGG - Intergenic
1094145742 12:27226706-27226728 TTGGTTCTGGATCTGTCATGGGG - Intergenic
1094813632 12:34164211-34164233 CTGGTTCTGAACCAGCAATGAGG - Intergenic
1095103282 12:38204298-38204320 CTGGTTCTGAACCAGCAATGAGG + Intergenic
1096170166 12:49462327-49462349 CTGGTACTGAAGCAGCCAGCCGG - Intronic
1096245418 12:49982355-49982377 CTGGTTCTGGAGCAGCAGGCTGG + Intronic
1096815871 12:54201480-54201502 CTGGTCCTGGAGCCCCCTTGTGG + Intergenic
1097382852 12:58916256-58916278 CTGCTTCTGGATCAGAAATGAGG - Intronic
1101238749 12:102816425-102816447 TTAGTTGTGTAGCAGCCATGGGG + Intergenic
1101902177 12:108798945-108798967 GCGGAGCTGGAGCAGCCATGTGG - Intronic
1104982740 12:132581551-132581573 CTGGTTCCTCAGCAGCCTTGTGG + Intronic
1106860653 13:33904007-33904029 CTGGTACTGAAACAGCCTTGTGG - Intronic
1107708887 13:43133253-43133275 CTGTTTCTCCAGCAGACATGGGG - Intergenic
1108558698 13:51621784-51621806 CTGGTTCTGGAGCAGCCATGTGG + Intronic
1108832829 13:54500334-54500356 CTGGTGCTGGGACAGGCATGGGG - Intergenic
1109808068 13:67470523-67470545 CTGATTCTTGAGCCTCCATGTGG + Intergenic
1112384523 13:98926236-98926258 CTGGTTCTTAAAAAGCCATGTGG + Intronic
1112458039 13:99579434-99579456 CTGGGTTTTGAGAAGCCATGGGG + Intergenic
1116919939 14:50561194-50561216 CTAGGTCTGGAGCAGCAAGGCGG - Intronic
1117335485 14:54754033-54754055 TTCTTTCTGGAGCAGCCTTGAGG + Intronic
1117998399 14:61499857-61499879 CTGGTTCTGGACCACCTATAAGG + Intronic
1119153292 14:72385695-72385717 CTGGCTCTGAAGCCCCCATGGGG + Intronic
1121914516 14:97824525-97824547 CTGGTACTGGAGCAGGCACAGGG - Intergenic
1122937162 14:104965620-104965642 CTGGGTCTGGGGCAGGGATGGGG - Intronic
1122982577 14:105198316-105198338 CAGGTTCTGGCCCAGCCATGGGG + Intergenic
1123112536 14:105880052-105880074 CTGGGGCTGGAGGAGCCCTGGGG + Intergenic
1123946040 15:25239368-25239390 GTGGTCCTGGTGCAGCCCTGGGG + Intergenic
1127176824 15:56367077-56367099 CTGGTTCTGGTGCATCCTTAGGG + Intronic
1127294819 15:57599878-57599900 CTGCTTCAGGAGCAGCAAGGGGG - Intronic
1127693000 15:61415819-61415841 CTGGAGCTGGAGCAGCTGTGAGG + Intergenic
1128099617 15:64988279-64988301 CAGGTTCTGTTGAAGCCATGAGG - Intronic
1129150500 15:73684825-73684847 CCGGGTCTGGAGCGGGCATGGGG + Intronic
1129172541 15:73817020-73817042 CTGGGTCTGGGGCCTCCATGGGG + Intergenic
1130103552 15:80912245-80912267 CTGTATCTGGAGCAGCCACGTGG + Intronic
1130227860 15:82073377-82073399 CTGGGTCTGCAGCTGCCATTTGG + Intergenic
1134013323 16:10871241-10871263 CTGGTTCTGACTCAGCCTTGAGG + Intergenic
1134058265 16:11183422-11183444 TTGGTTCTGAATCACCCATGGGG + Intergenic
1135037391 16:19089608-19089630 CTGCTGCAGGAGTAGCCATGTGG - Intergenic
1135350349 16:21724145-21724167 CTGGTTCTTGAACAGTCAAGTGG + Intronic
1135863006 16:26074511-26074533 CTGGAGCTGGAGCATCCATCTGG + Intronic
1137604789 16:49780281-49780303 CTGGCTCTGCACCAGCCTTGGGG - Intronic
1137820335 16:51438467-51438489 CTGGTTATGTAACAGCCATAAGG - Intergenic
1140513964 16:75529183-75529205 CTGGATCTGGTGCTGCCACGAGG - Exonic
1141996480 16:87639359-87639381 CAGGGTCTGGTGGAGCCATGAGG - Intronic
1142182177 16:88676639-88676661 TTGGGACTGGAGCAGCCAAGTGG + Intergenic
1142308938 16:89300924-89300946 CTTGTCCTGGGGCAGCCACGAGG - Intronic
1142479316 17:208463-208485 CTGGGTCTGGCCCAGTCATGGGG + Intergenic
1144750160 17:17642877-17642899 CTGCTTCTGGAGGAGCCCAGTGG - Intergenic
1144951038 17:18993585-18993607 CAGGTTCTGGGGCAGGCTTGAGG - Intronic
1145720966 17:27072454-27072476 CTGGATCTGGATTAACCATGTGG + Intergenic
1145800070 17:27677032-27677054 CTGGGTCTGGGGCAGCCTAGGGG + Intergenic
1146745425 17:35324408-35324430 CTGATTCTTGGGCAGCCACGTGG + Intergenic
1146763295 17:35496612-35496634 CTGGTTGTGGGGCAGCGCTGGGG - Intronic
1146944877 17:36866804-36866826 TCAGTTCTGGAGCAGCCCTGGGG + Intergenic
1147660127 17:42112930-42112952 CTGGATCAGGAGCAGCCTGGAGG + Intergenic
1148201767 17:45754024-45754046 TTGCTCCTGGAGCAGCCATAGGG + Intergenic
1148505284 17:48122249-48122271 CTGGTTATAAAGCAGACATGTGG + Exonic
1150886725 17:69095261-69095283 CTGGCTTTGAGGCAGCCATGAGG - Intronic
1150987933 17:70220457-70220479 CTGGTTCTGCGGCAACCGTGAGG + Intergenic
1151342523 17:73481108-73481130 TTGGTTCTGGAGCAGGCACTGGG + Intronic
1151411526 17:73933439-73933461 GTGGTTCTGGACCACCCAAGGGG + Intergenic
1152556443 17:81055426-81055448 CTGCTGCTGGGGCAGCCATGGGG - Intronic
1152890956 17:82881441-82881463 CTGATGCTGGAGCAGCCAGCGGG + Intronic
1153623273 18:6999757-6999779 CTTGTTCTGGAACAGTAATGAGG + Intronic
1156321505 18:36029417-36029439 CTGGTCCCGAAGCAGACATGGGG - Intronic
1156447013 18:37244631-37244653 CTGTTTCAAGAACAGCCATGAGG + Exonic
1156997469 18:43485105-43485127 CTGATTCCGGGTCAGCCATGTGG + Intergenic
1157287860 18:46389602-46389624 CTGGGTTTGGAGAAGCGATGAGG - Intronic
1157846912 18:51012639-51012661 CTGGTTCACGGGCAGACATGTGG - Intronic
1159142572 18:64415349-64415371 CTGGTTTTGAAGCAGCCACCAGG + Intergenic
1159673686 18:71254248-71254270 CTGGTACTGGAGCCCCCCTGGGG + Intergenic
1159928659 18:74291294-74291316 GTGGTGCTGGAGCAGCCTTCCGG - Intronic
1160185210 18:76671110-76671132 GTGGTTCTGGAGCTGAGATGGGG + Intergenic
1160774722 19:850145-850167 CTGGTTCTGGTGTGGCCATTTGG - Intergenic
1161081996 19:2315909-2315931 CTGGTGCTGGGGCAGAGATGAGG + Intronic
1161267514 19:3371286-3371308 CTGAATCTGCAGCAGCCCTGAGG - Intronic
1161856214 19:6767354-6767376 CTGGTTCTGGATCTGCCCTGGGG + Intronic
1163109418 19:15150405-15150427 CTGGTACAGGAGCAGCAAGGAGG + Intergenic
1163223642 19:15939577-15939599 CTGGGTCTGGAGGGGCCAGGAGG - Intergenic
1164847093 19:31441683-31441705 GTGGGTCTGGAGCATCCATGTGG + Intergenic
1165404716 19:35622595-35622617 CTGGATCTGCAGCAGCTCTGAGG - Exonic
1165749838 19:38253076-38253098 CGGGTTCTGGAGCATTAATGTGG + Intronic
1166181810 19:41114153-41114175 CTGGTTTTGGGGTAGTCATGGGG - Intergenic
1166770100 19:45276585-45276607 CTGGCTCTGGGCCAGGCATGTGG + Intronic
1166852319 19:45766713-45766735 CTGGTCCCGGAGCAGCCACCTGG + Exonic
1167471495 19:49678366-49678388 TTGGTTCTCGTGCAGCCATGTGG + Intronic
1168562995 19:57398781-57398803 CTGGTGCTGGAGAAGGCATGAGG - Exonic
925165532 2:1713557-1713579 CTGGTGCTGGAGCGGCCAGTGGG - Intronic
925318900 2:2946821-2946843 CTGATTCTGGAGCAACCAGAAGG + Intergenic
926960891 2:18357382-18357404 GTGGCCCTGGAGCAGCCATCAGG - Intronic
927708980 2:25313707-25313729 CTGGTGATGGAGCAGGCATTTGG - Intronic
928394102 2:30930997-30931019 GTGGCTCTGCAGGAGCCATGTGG - Intronic
930511010 2:52345596-52345618 CTGGTTCTGGAGACGCAAGGGGG - Intergenic
931058600 2:58501372-58501394 CTAGTTTTGGAGCTCCCATGAGG - Intergenic
931139881 2:59445657-59445679 CCTGTTCAGGAGCAGCCAGGAGG - Intergenic
932469557 2:71944982-71945004 CTGTTGATGGAGCAGCGATGGGG + Intergenic
932586934 2:73036324-73036346 CTGGTGCTGGGGGAGCCAGGAGG + Intronic
932862071 2:75304830-75304852 CTGGCTCTGGAGCAGACTTTTGG - Intergenic
932862083 2:75304912-75304934 CTGGCTCTGGAGCAGACTTTTGG - Intergenic
933090668 2:78112013-78112035 CTGCTTCTGGGCCAGCCACGTGG - Intergenic
935172328 2:100620170-100620192 CTGGTTCTTCAGCTGCAATGGGG - Intergenic
936810686 2:116397358-116397380 CTGATTCTTGAGCAACAATGAGG - Intergenic
936954685 2:118012988-118013010 AAGGTTCTGGAGCAGGCATTGGG - Intronic
937954380 2:127412465-127412487 CTGTTTCTGGGGTTGCCATGTGG + Intergenic
938308544 2:130270007-130270029 CTTGTTCTGCAGCACCCATGTGG + Intergenic
938446786 2:131386829-131386851 CTTGTTCTGCAGCACCCATGTGG - Intergenic
938982499 2:136539868-136539890 ATGGTTCTGGAGGCACCATGTGG + Intergenic
939057320 2:137381136-137381158 CCGATTCTGGGTCAGCCATGTGG + Intronic
939087549 2:137739653-137739675 CTGGTAATGCAGCAGCCATTAGG + Intergenic
940668679 2:156640196-156640218 CTGGTGAAGGAGCAGCCCTGGGG + Intergenic
941416139 2:165224025-165224047 CTGCTTCTGGGGAGGCCATGGGG + Intergenic
942695597 2:178639723-178639745 CTGTTACTGGGGCAGCGATGGGG + Exonic
944911331 2:204313387-204313409 CTGGCTCTGGAGTAGTGATGTGG - Intergenic
946137173 2:217656928-217656950 CTGCTTCTGCAGCAGCCTTCAGG - Intronic
946254781 2:218434566-218434588 CTGGACCTGGAACAGCCGTGTGG - Exonic
946879128 2:224160013-224160035 CAGGAACTGGAGCAGCCATTTGG + Intergenic
946946619 2:224828643-224828665 TTGGCTCATGAGCAGCCATGGGG + Intronic
947582510 2:231330449-231330471 GTGGTGTTGGAGGAGCCATGTGG - Intronic
947602965 2:231465525-231465547 CTGGTTCTGTAGGAACAATGAGG - Intronic
947663500 2:231887935-231887957 CTGACGCTGGAGTAGCCATGAGG - Intergenic
947774695 2:232697951-232697973 CTGGGTCTGGACCAGGCCTGAGG + Intronic
948598128 2:239093413-239093435 CTGGCTCTGGAGGAGACATGAGG + Intronic
948722769 2:239911927-239911949 CTGAATCTGGAACAGCCCTGGGG + Intronic
948901400 2:240958496-240958518 CTGGCACAGGGGCAGCCATGTGG + Intronic
948987327 2:241533411-241533433 CCAGGTCTGGAGCAGCCCTGGGG - Intergenic
1169841890 20:9947868-9947890 CTGGGTCTTGAGTATCCATGTGG + Intergenic
1170443196 20:16399106-16399128 CTGGTTCTGGAGAGGTGATGAGG + Intronic
1170683012 20:18543714-18543736 CTAGGTCTGGATCAGCCCTGGGG - Intronic
1172883469 20:38216513-38216535 CTGGGTCTGGGCCAGCCATGGGG + Intronic
1175372886 20:58504394-58504416 ATGGTTCCTAAGCAGCCATGAGG + Intronic
1175402584 20:58708879-58708901 GTGGTTCTGGAGGAGCCGTGTGG + Intronic
1175618603 20:60424290-60424312 CAGGGTCTGGTGCAGCCAGGAGG + Intergenic
1175963488 20:62648550-62648572 CTCATTCTGGAGCAGCCGTCAGG + Intronic
1176028155 20:62996770-62996792 CACCTTCTGGAACAGCCATGAGG + Intergenic
1176063381 20:63181989-63182011 CTGGCTCTGTGGCAGCCCTGGGG - Intergenic
1176113136 20:63419529-63419551 GAGGTTCTGGAGGAGCCAGGGGG - Intronic
1176264822 20:64203649-64203671 CTGGCTCAACAGCAGCCATGGGG - Intronic
1178029291 21:28505891-28505913 CTGGAGCTGGAGCAGCCTGGAGG + Intergenic
1179175953 21:39008384-39008406 CTGGTTCTGCTGCAGCCAGCTGG - Intergenic
1180800647 22:18630392-18630414 CTGCTCCTGGAGGGGCCATGTGG - Intergenic
1180850921 22:19019742-19019764 CTGGTTCTGGCCCAGCAAAGAGG + Intergenic
1180851879 22:19025949-19025971 CTGCTCCTGGAGGGGCCATGTGG - Intergenic
1181221072 22:21364870-21364892 CTGCTCCTGGAGGGGCCATGTGG + Intergenic
1181358453 22:22316696-22316718 CTGGAGCTGAATCAGCCATGAGG + Intergenic
1181822979 22:25490139-25490161 CTGGTGCTGCAGCAGCCATCAGG + Intergenic
1184416218 22:44353187-44353209 CTGGTTTTGGAGAACCCAGGTGG + Intergenic
1184956007 22:47886317-47886339 CTGGGTGAGGGGCAGCCATGAGG + Intergenic
949870475 3:8583717-8583739 CTGCTTCTGGACCAGCCCTGGGG + Intergenic
949881445 3:8664095-8664117 CTGGGTTTGCAGCAGCCTTGGGG - Intronic
950474719 3:13208172-13208194 CTAGATCTGGAGCAGCCACTTGG + Intergenic
950719796 3:14874885-14874907 CTGGTCCTGGGGAAGCCAGGGGG + Intronic
952881537 3:37989057-37989079 CTGGCTCCGGAGCAGGCAGGAGG + Intronic
953002588 3:38949286-38949308 CAGGCTCTAGAGCAGTCATGTGG + Intronic
953018926 3:39101538-39101560 CTGCTTCTGCTGCAGGCATGTGG + Intronic
953253736 3:41268894-41268916 CTGGCTCTGTAGCAGCTGTGTGG - Intronic
954289726 3:49643238-49643260 CTGGGTCTGCAGCAGCCATGGGG + Intronic
956705809 3:71998121-71998143 CTGGAGCTGGAGCAGCCATTTGG - Intergenic
957759688 3:84539126-84539148 CTGGTGCTGGAGCAGCTTGGGGG - Intergenic
958659232 3:97043864-97043886 CAGGGTCTGGGGCAGCCCTGGGG - Intronic
960311050 3:116116915-116116937 CTGGTTCTGGAGGGTCCAGGTGG - Intronic
960673235 3:120171667-120171689 CTGATGCTGGAACAGCCAAGTGG - Intronic
962090591 3:132240436-132240458 TTGGTTCTGGAGCAGGGATCTGG - Intronic
962343222 3:134602211-134602233 ATGGTTCTGCAGTGGCCATGTGG + Intronic
964743503 3:159990225-159990247 CTGGGTCTGGAGTGGCCACGGGG - Exonic
967951113 3:194841429-194841451 CTGGTAATGTAGGAGCCATGGGG + Intergenic
968446192 4:653513-653535 GTGGTTCTGGAGCAGCCGGGCGG + Intronic
968574186 4:1357342-1357364 CTGGGGCTGGGGCAGCCAGGTGG + Intronic
968703390 4:2067120-2067142 CTTGTGCTGAAGCTGCCATGTGG + Exonic
968772046 4:2513610-2513632 CTTGTCCCAGAGCAGCCATGGGG - Intronic
969349290 4:6588988-6589010 GTGGAGCTGGGGCAGCCATGTGG + Intronic
970068742 4:12130168-12130190 CTGGTGCTGGAACAGTCCTGGGG - Intergenic
970705094 4:18791779-18791801 CTGGAACTGAAGCAGCCATTTGG + Intergenic
971292631 4:25359057-25359079 GTGATTCTGGGTCAGCCATGTGG + Intronic
972066610 4:34953539-34953561 CTGGTGCTAGAGCAGCCAGCTGG + Intergenic
972226639 4:37020758-37020780 CTAGTTTTGGTGCAGCCATGAGG + Intergenic
975827860 4:78338688-78338710 CTTGTTCTGGAGCAGGGAAGAGG + Intronic
975919072 4:79361897-79361919 CTAATTCTGGAGTAGCCATTTGG + Intergenic
976198051 4:82552137-82552159 CTGGTTCTGGTGCAGGCTTCAGG - Intronic
976305832 4:83558557-83558579 CTGGTGTTGAAGCGGCCATGTGG + Intronic
979560435 4:122095840-122095862 ATGATTTTGGAGCAGCCATGAGG + Intergenic
980343729 4:131584477-131584499 CTGATTCCGGGTCAGCCATGTGG - Intergenic
981952333 4:150423694-150423716 CTGGTGCTGGAGCTGCTGTGCGG - Intronic
982083341 4:151811041-151811063 TTGGTTTTGGAGCAACCATGAGG - Intergenic
986232305 5:5877520-5877542 CTGGTTCTGTGCCAGGCATGTGG - Intergenic
987693336 5:21296831-21296853 CTAGATCTGGGGCAGCCATGGGG + Intergenic
991746938 5:69752721-69752743 CTAGATCTGGGGCAGCCATGGGG - Intergenic
991750767 5:69802521-69802543 CTAGATCTGGGGCAGCCATGGGG + Intergenic
991798540 5:70332663-70332685 CTAGATCTGGGGCAGCCATGGGG - Intergenic
991826315 5:70628033-70628055 CTAGATCTGGGGCAGCCATGGGG - Intergenic
991830056 5:70677418-70677440 CTAGATCTGGGGCAGCCATGGGG + Intergenic
991890871 5:71331986-71332008 CTAGATCTGGGGCAGCCATGGGG - Intergenic
992729036 5:79639683-79639705 GTGGTTCTAGAGCAGGTATGAGG + Intronic
994090227 5:95803166-95803188 CTGGTTTGGGAGCAGGCAAGAGG + Intronic
994760057 5:103841034-103841056 CTGGACCTGAAGCAGCCATGTGG - Intergenic
996191764 5:120552666-120552688 TTGGTTGTGGAGCATCCTTGTGG + Intronic
997009434 5:129859374-129859396 CAGGTTCAGGAGCTTCCATGTGG - Intergenic
998902213 5:146868299-146868321 AAGGTTCTGGTGCAGCCAAGAGG - Intronic
999276311 5:150332872-150332894 GTGGTTCTGGAGCTGCCAACAGG + Intronic
999414997 5:151387280-151387302 CAGGCTCTGGAGGACCCATGGGG + Intergenic
1000103780 5:158039536-158039558 CTGGTGCAGAATCAGCCATGAGG + Intergenic
1000505422 5:162110932-162110954 CTGGGCCTAGAGCAGCCATGGGG + Intronic
1000626241 5:163542510-163542532 CTTGTTCTGGAGAAGACTTGAGG + Intergenic
1001397867 5:171429602-171429624 CTGCTGCTGGAGGAGCCAGGTGG + Intronic
1001555318 5:172632968-172632990 CGGGGTCAGGAGCAGCCAAGTGG - Intergenic
1002495207 5:179607031-179607053 CTGATTCTTGACCAGCCCTGGGG - Intronic
1003312200 6:4979302-4979324 CTGGTTCTTGAACAGACAGGAGG + Intergenic
1003461795 6:6335710-6335732 CTGGAGCTAAAGCAGCCATGTGG + Intergenic
1003502663 6:6715157-6715179 GAGGTTCAGGAGCAGCCCTGTGG - Intergenic
1004750929 6:18561145-18561167 CTCTTTCTGCAGCAGCCATCTGG - Intergenic
1006333068 6:33405901-33405923 CTGGTTGAGGAACAGCCAGGAGG - Intronic
1006603623 6:35241846-35241868 CTCGGGCTGGAGCAGCCCTGGGG - Exonic
1008101994 6:47401653-47401675 CTGGTTGTGGTGAAGCAATGGGG - Intergenic
1009651446 6:66481454-66481476 CTGATTCCGGAGTAACCATGTGG - Intergenic
1009804176 6:68580895-68580917 GTGGTTCTGGATCAACCATTAGG + Intergenic
1010247893 6:73678948-73678970 CTGGAGCTGGAGCAGCCATCTGG - Intergenic
1010896322 6:81368952-81368974 CTGGTTCTGGATTAGCAATCTGG + Intergenic
1011355857 6:86472784-86472806 CTGGGTCTCAAGTAGCCATGTGG - Intergenic
1011739155 6:90342189-90342211 GTGGTTCTTGTCCAGCCATGTGG + Intergenic
1012436223 6:99217873-99217895 CTAGTTCTGCAACAGCCAAGGGG - Intergenic
1015813895 6:137187783-137187805 CTGACTCTTGAGTAGCCATGTGG - Intergenic
1015970985 6:138742124-138742146 CTGATGCTGGGCCAGCCATGTGG + Intergenic
1016624244 6:146146938-146146960 CTGGAGGTGTAGCAGCCATGTGG - Intronic
1018117405 6:160600790-160600812 TTGGTTCTGGGTCTGCCATGTGG - Intronic
1018359699 6:163054891-163054913 CTGGTTCTGAGACAGCCAGGGGG - Intronic
1018636564 6:165865029-165865051 CTGGTTCTTGAGCTTCCAGGTGG - Intronic
1019575484 7:1735608-1735630 CTGGGTCTGGGGGAGCCATGAGG + Intronic
1020568177 7:9823042-9823064 CTGGGTCTGCAGCAGCGATTTGG + Intergenic
1021181356 7:17509229-17509251 TTGGCCCTGAAGCAGCCATGGGG - Intergenic
1021240700 7:18197126-18197148 CTGGTTCTGCAGTAGCCTTCTGG + Intronic
1021405462 7:20262465-20262487 ATGGATCTTCAGCAGCCATGTGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022888078 7:34667219-34667241 CTGGGGCTAGAGCAGCCCTGTGG - Intronic
1024659073 7:51476044-51476066 CTGGGTCTGGATCAGTCCTGGGG + Intergenic
1028401377 7:90429296-90429318 CTGGTTCTGTCCCAGACATGTGG - Intronic
1028843847 7:95458386-95458408 CTGGTTTTGGAGCTGCCCAGTGG - Intergenic
1029404830 7:100368411-100368433 CTGATGCTGGGGCAGCCTTGTGG - Intronic
1029490434 7:100867508-100867530 CTGCTTCGGGGGCAGCCAGGTGG - Exonic
1030221362 7:107102456-107102478 CTGTCTATGGAGCAGCCATTTGG + Intronic
1032741841 7:134747667-134747689 CTGGCCCTGGGGCAGCCACGGGG - Intronic
1033818591 7:145106233-145106255 ATGCTTCTGGAGTAGCCAGGGGG + Intergenic
1033908570 7:146237141-146237163 CTGCTTCTGGTACAGCTATGTGG - Intronic
1035447900 7:158955569-158955591 GTGGTTCTGGCGCTGCCTTGTGG + Intronic
1036124138 8:6047684-6047706 CTGGGTCCTGAGCAGTCATGGGG + Intergenic
1037119579 8:15266968-15266990 CTGGTTCTGGGGCAGACCTGAGG - Intergenic
1037881110 8:22573944-22573966 CTGCCTCTGGAGCAGCCCTTGGG - Intronic
1038395907 8:27245277-27245299 ATGGCTCTGAAGCAGGCATGTGG - Intronic
1039102604 8:33957388-33957410 CAGGCTCTGGAGAATCCATGAGG - Intergenic
1045042805 8:98242999-98243021 GTGGTTCTGTAGGAGTCATGGGG + Intronic
1047777240 8:128082769-128082791 CTGGATGTGCAGCAGCCATCTGG + Intergenic
1048588449 8:135798075-135798097 CTGGAGCTGGGGCAGGCATGTGG + Intergenic
1048649039 8:136453976-136453998 ATGGTTCTGAGGCAGCCAGGTGG + Intergenic
1049065179 8:140307838-140307860 CTGGAGCTGCAGCAGCCATCTGG + Intronic
1049634730 8:143681496-143681518 CTGGGTCTCAAGTAGCCATGTGG + Intergenic
1051918014 9:22230520-22230542 CTGGCTCTGGAGAGGCCAGGTGG + Intergenic
1052234078 9:26188984-26189006 CTGGTTTTGGAGTAAGCATGGGG - Intergenic
1056065105 9:82925409-82925431 CTGCATGAGGAGCAGCCATGTGG + Intergenic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1057972159 9:99568617-99568639 CTTCTTCTGGGGCAACCATGTGG - Intergenic
1058212395 9:102185563-102185585 CTGGAGGTGGACCAGCCATGAGG - Intergenic
1058535026 9:105950108-105950130 CAGGTACTGCAGCAGCCCTGTGG - Intergenic
1060192440 9:121601489-121601511 CTGGTTCTGGAACAACCCTTGGG + Intronic
1186780385 X:12906105-12906127 CAGGTGCTGGAGGAGGCATGGGG + Intergenic
1188124189 X:26347687-26347709 CAGGTTTTGGAGCAGCTCTGTGG + Intergenic
1188830040 X:34885237-34885259 CTGGTTCTGGAGAAGCTCTGGGG - Intergenic
1189353953 X:40297675-40297697 CTGACTCTGGACCAGCCCTGAGG - Intergenic
1192163881 X:68810878-68810900 CTGGTTCTGCAGCAGCCTGCGGG + Intergenic
1192329104 X:70159959-70159981 CTGGATCTGGACCAGCCCTCCGG - Intronic
1195207356 X:102615771-102615793 CTGGTGCTGGAGCACTCTTGCGG + Intergenic
1195217696 X:102716222-102716244 CTGGTTCTGGGACAGAGATGAGG + Exonic
1195771771 X:108358920-108358942 GTGCTTCTGGAGCAGGCATGAGG + Intronic
1196549081 X:116999737-116999759 CTGGTCCTGCAACAGCAATGTGG - Intergenic
1200070866 X:153528511-153528533 CTGGTTCTGGGAGAGCCAGGAGG - Intronic
1200551027 Y:4578376-4578398 CTGGGTCTGCAGCAGCCCTTTGG + Intergenic