ID: 1108558998

View in Genome Browser
Species Human (GRCh38)
Location 13:51624836-51624858
Sequence GGACGTTCCTGCCTTTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108558998_1108559000 -8 Left 1108558998 13:51624836-51624858 CCAGTGCAAAGGCAGGAACGTCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1108559000 13:51624851-51624873 GAACGTCCCTGGTTTTCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
1108558998_1108559005 9 Left 1108558998 13:51624836-51624858 CCAGTGCAAAGGCAGGAACGTCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1108559005 13:51624868-51624890 AGCAGGCCAGTGTGTCTGGGAGG 0: 1
1: 0
2: 5
3: 42
4: 328
1108558998_1108559004 6 Left 1108558998 13:51624836-51624858 CCAGTGCAAAGGCAGGAACGTCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1108559004 13:51624865-51624887 TTCAGCAGGCCAGTGTGTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 219
1108558998_1108559007 23 Left 1108558998 13:51624836-51624858 CCAGTGCAAAGGCAGGAACGTCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1108559007 13:51624882-51624904 TCTGGGAGGAAGTGAGAGAAAGG 0: 1
1: 0
2: 9
3: 85
4: 774
1108558998_1108559003 5 Left 1108558998 13:51624836-51624858 CCAGTGCAAAGGCAGGAACGTCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1108559003 13:51624864-51624886 TTTCAGCAGGCCAGTGTGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108558998 Original CRISPR GGACGTTCCTGCCTTTGCAC TGG (reversed) Intronic
901931097 1:12596378-12596400 GGAGGTGCCTGCCTTTGCTCTGG + Intronic
902924982 1:19690079-19690101 GGACTTTCCTGCCTTTGGGTAGG + Intronic
904698709 1:32345629-32345651 TCTCCTTCCTGCCTTTGCACAGG + Intergenic
906705863 1:47894951-47894973 GGAGGCTCCTGCCCTTGTACTGG - Intronic
911757314 1:101573925-101573947 GGAGGTGCCTGACATTGCACTGG - Intergenic
912562113 1:110558406-110558428 TGACGTCCTTGCCTTTGCACAGG + Intergenic
913291414 1:117275927-117275949 AGACCTTCCTGCCAGTGCACGGG + Intergenic
915853584 1:159354754-159354776 GGACATTCCTCTTTTTGCACAGG + Intergenic
918344083 1:183591067-183591089 GGACTTTCCTGCCTTTGGGTAGG + Intronic
919304337 1:195810832-195810854 GTGCTTTTCTGCCTTTGCACAGG - Intergenic
924149593 1:241115212-241115234 GGCCATTCCCACCTTTGCACTGG + Intronic
1063304143 10:4880938-4880960 GGACTTTCCTGCCTTTGGGTAGG + Intergenic
1063811433 10:9713387-9713409 AGACATCCCTGCCTTTGCCCTGG - Intergenic
1065168697 10:23006691-23006713 GGATGTTCTTGCCTTTGGGCAGG - Intronic
1066434545 10:35384926-35384948 GGAAGTTCCTGCCTGTGCTCAGG + Intronic
1071754607 10:88522887-88522909 GCACTTTGCTGCCTTTGCTCTGG - Intronic
1073494666 10:103880208-103880230 GGACTTTCCTGCCTTTGGGTAGG - Intergenic
1076311031 10:129507588-129507610 GGACGTTCCTCCCCCAGCACCGG - Intronic
1076943372 10:133625475-133625497 GGACGTTCCAGGGCTTGCACTGG - Exonic
1084411450 11:69008488-69008510 GGAGGTCCCTCCCTTTGCAACGG - Intronic
1089270729 11:117299926-117299948 GGATGTTCCCTCCCTTGCACAGG - Intronic
1090075815 11:123579445-123579467 GGCCGTTCCTGGCTGTGGACAGG + Intronic
1094729134 12:33154566-33154588 GGAAGTGCCTGACTTTGCTCAGG - Intergenic
1096467107 12:51852719-51852741 GGAGGCTTCTGCCTTTGGACAGG - Intergenic
1104840971 12:131825467-131825489 GAACGCTCCGGTCTTTGCACGGG - Intergenic
1105002921 12:132702797-132702819 GGGCCTTCCTGCATTAGCACCGG + Intronic
1106933913 13:34697128-34697150 GAACTTTCCTGCCTTTGCGTAGG - Intergenic
1107039934 13:35937663-35937685 GGAAGTTCCTTTCTTGGCACTGG - Intronic
1108167600 13:47709535-47709557 GGGCGTGCCTGCCTGAGCACTGG + Intergenic
1108558998 13:51624836-51624858 GGACGTTCCTGCCTTTGCACTGG - Intronic
1113781726 13:112981122-112981144 AGACGTCCCTTCCTGTGCACTGG + Intronic
1119223784 14:72928929-72928951 GGTCGGTCCAGCCTTAGCACGGG - Intronic
1119755114 14:77112020-77112042 GATCGTTCCAGCCTTTGCATGGG + Intronic
1120853207 14:89189300-89189322 GGAAGTCCCTGCCTTTGGAGTGG - Intronic
1124709722 15:31997637-31997659 GGCCGTCCCTGCGTCTGCACTGG + Intergenic
1125573853 15:40741577-40741599 GGACCATCATGCCTATGCACTGG + Intronic
1127290112 15:57562488-57562510 AGACGTTCATGCCTTCCCACAGG - Intergenic
1132710805 16:1266213-1266235 CGACGTTCCTGTCTCTGCACAGG - Intergenic
1133704164 16:8337440-8337462 GAATCTGCCTGCCTTTGCACTGG - Intergenic
1142302427 16:89266458-89266480 GGACAACCCTGCCTTTGCTCAGG + Intergenic
1146393141 17:32441491-32441513 GGATTTTCCTTCCTTTGCCCTGG + Intergenic
1151921097 17:77156149-77156171 GGAGGTTCCTCTCTGTGCACTGG + Intronic
1151952794 17:77364465-77364487 GAACGTCGGTGCCTTTGCACTGG + Intronic
1152473370 17:80502733-80502755 GGACGCTCCAGCCTTTGCCTTGG - Intergenic
1158165528 18:54535402-54535424 GGACGTGCCTGCATTTGTAGTGG - Intergenic
1158488494 18:57889324-57889346 GGACATTCCTGCCTTTGGGTAGG - Intergenic
1160432531 18:78821691-78821713 GGAGTTTCCTGCCTCGGCACTGG - Intergenic
1164170134 19:22717557-22717579 TGACTTTCCTGCCTTGGCCCAGG - Intergenic
925683117 2:6444126-6444148 AGACTTTCCTGCCTTTGAATAGG - Intergenic
926277095 2:11412416-11412438 GGAAGGTCCTGCCTGGGCACTGG - Intergenic
927464948 2:23329811-23329833 AGACTTCCCTGCCCTTGCACTGG - Intergenic
932625394 2:73292552-73292574 GGACGCTGCTGCCTCTGGACCGG + Exonic
933756951 2:85647176-85647198 GGACATTCCTGGCTGGGCACAGG - Intronic
934040567 2:88124648-88124670 TGAAGTTGCTTCCTTTGCACAGG + Intronic
945369809 2:209003252-209003274 GGACTTTCCCACCTTTGAACAGG + Intergenic
1168996458 20:2136838-2136860 GGTCGTCCATGCCTTTTCACTGG + Intronic
1172961173 20:38801025-38801047 AGACTTTCCTGCCTGTGGACAGG + Intergenic
1180251792 21:46595021-46595043 GGACATCACTGCCTTTGCCCAGG - Intergenic
1181593847 22:23901382-23901404 GAGCGTTCTTGGCTTTGCACAGG + Intergenic
1183109962 22:35641729-35641751 GAACTTTCCTGCCTTTGGATAGG + Intergenic
949834599 3:8254299-8254321 GGCCCTTCTTGCCTTTGCATAGG - Intergenic
951096078 3:18632924-18632946 GGGCTTTCTTGCCTTAGCACAGG + Intergenic
953830747 3:46295633-46295655 GGACGTTCATTACATTGCACTGG + Intergenic
957270060 3:78018535-78018557 GGATGTTCCAGCCTTTGCATTGG - Intergenic
958449855 3:94259703-94259725 GGACTTTCCTGCCTTTGGGTAGG + Intergenic
960612997 3:119571940-119571962 GGGCTTTCCAGCCTTTGCTCTGG - Intergenic
961082891 3:124041693-124041715 GGTCCTTCCTGCCTTTTCTCTGG + Intergenic
963091210 3:141485885-141485907 GGGCTGTCCAGCCTTTGCACAGG + Intergenic
963251043 3:143103871-143103893 GGACTTTCCTGCCTTTGTGTAGG + Intergenic
970148844 4:13067972-13067994 GGACTTTCCTGCTTTTACCCTGG - Intergenic
975887758 4:78985419-78985441 GTCTGTTCCTGCCTTTGCAGAGG + Intergenic
982131632 4:152233957-152233979 GGACTTTCCTGCCCTTGACCTGG + Intergenic
985410165 4:189675429-189675451 GGATATTCGTGCCTTTGCATGGG + Intergenic
985825075 5:2185601-2185623 GGACTTTCCTTCCTCTGCCCCGG - Intergenic
986111080 5:4718467-4718489 GGAGGTTCTTGGCTTTGCTCAGG + Intergenic
987042527 5:14076559-14076581 GGACTTTCCTTCTTTTGCAAGGG + Intergenic
995871555 5:116748764-116748786 GGAGTTTCCTGTCTTGGCACAGG + Intergenic
995980911 5:118103161-118103183 GGACTTTCCTCTCTCTGCACGGG - Intergenic
1002045568 5:176539917-176539939 CCACCTTCCTGCCTTTGCTCAGG + Intergenic
1003136466 6:3438357-3438379 CGAGGTGCCTGCCTTGGCACAGG + Intronic
1006540623 6:34737027-34737049 GGACTTTCCTGCCTTTGGGTAGG + Intergenic
1009612739 6:65967251-65967273 GGAACTTCCTCCCTCTGCACAGG + Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1017661821 6:156682444-156682466 GGAGGTTCCTGATTTTGCCCTGG - Intergenic
1019125660 6:169838737-169838759 GGACGTTCCTGCCCTTGTTTCGG - Intergenic
1022876236 7:34533573-34533595 GGAAGTGGCTGCCTTTGCAGAGG - Intergenic
1026967832 7:74451597-74451619 GGGTGTTCCTGCCGCTGCACAGG + Intergenic
1028917226 7:96272543-96272565 GACCGTTCCTGCCTTTGACCTGG - Intronic
1031488553 7:122359811-122359833 GGACTTTTCTACCTTTGCATGGG - Intronic
1044846577 8:96387838-96387860 GGACAGTCCTGCCTTTACATAGG + Intergenic
1047053910 8:121143460-121143482 GGACATACCTACCTTTACACAGG - Intergenic
1049193287 8:141300971-141300993 GGATGCTCCTGTGTTTGCACGGG - Intronic
1049758109 8:144319766-144319788 GGAGGTTCCTGTCCTTGCAGAGG - Intronic
1050623333 9:7477563-7477585 GGACGTTTCTGCATTTGGACTGG - Intergenic
1050920085 9:11189200-11189222 GCACGTTCTTGGCTTTGCTCAGG + Intergenic
1051553449 9:18356155-18356177 GGATGTTCCTGCCTTTGGGTAGG - Intergenic
1051994681 9:23200860-23200882 GAGCCTTCCGGCCTTTGCACTGG + Intergenic
1052131661 9:24855801-24855823 GGAGGTTCCTGGCTTTGTTCAGG - Intergenic
1056634469 9:88320315-88320337 GGACTTCCCTCCCTTTGCATTGG + Intergenic
1060913707 9:127371039-127371061 GGAAGGTGCTGCCCTTGCACTGG - Intronic
1061316528 9:129799739-129799761 GGACTTTCCTGCCTTAGGCCAGG + Intergenic
1203672592 Un_KI270755v1:30051-30073 GGATATTCGTGCCTTTGCATGGG - Intergenic
1188964182 X:36530510-36530532 GGAGATTCCAGCCTTTGCAATGG - Intergenic
1189205904 X:39238593-39238615 GGAAGTTCCTGGCCCTGCACTGG - Intergenic
1191867172 X:65713503-65713525 TCCCATTCCTGCCTTTGCACAGG + Intronic
1201321311 Y:12700915-12700937 GGACCTTCCTGCCTTTGGGAAGG - Intergenic
1201732861 Y:17224150-17224172 TGAAGTTCCTCCCTTTGCACAGG + Intergenic