ID: 1108559258

View in Genome Browser
Species Human (GRCh38)
Location 13:51627071-51627093
Sequence TACCTGGTCCAGCCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108559258_1108559266 30 Left 1108559258 13:51627071-51627093 CCAGCCTGTGGCTGGACCAGGTA 0: 1
1: 0
2: 3
3: 20
4: 206
Right 1108559266 13:51627124-51627146 GTGTCCAGATGAGGGGAACATGG 0: 1
1: 5
2: 9
3: 45
4: 257
1108559258_1108559262 21 Left 1108559258 13:51627071-51627093 CCAGCCTGTGGCTGGACCAGGTA 0: 1
1: 0
2: 3
3: 20
4: 206
Right 1108559262 13:51627115-51627137 CAGGCACCTGTGTCCAGATGAGG 0: 1
1: 0
2: 1
3: 36
4: 298
1108559258_1108559261 2 Left 1108559258 13:51627071-51627093 CCAGCCTGTGGCTGGACCAGGTA 0: 1
1: 0
2: 3
3: 20
4: 206
Right 1108559261 13:51627096-51627118 CTGCATGCAGCTTCTGCTGCAGG 0: 1
1: 7
2: 24
3: 88
4: 473
1108559258_1108559264 23 Left 1108559258 13:51627071-51627093 CCAGCCTGTGGCTGGACCAGGTA 0: 1
1: 0
2: 3
3: 20
4: 206
Right 1108559264 13:51627117-51627139 GGCACCTGTGTCCAGATGAGGGG 0: 1
1: 0
2: 6
3: 36
4: 261
1108559258_1108559263 22 Left 1108559258 13:51627071-51627093 CCAGCCTGTGGCTGGACCAGGTA 0: 1
1: 0
2: 3
3: 20
4: 206
Right 1108559263 13:51627116-51627138 AGGCACCTGTGTCCAGATGAGGG 0: 1
1: 0
2: 1
3: 31
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108559258 Original CRISPR TACCTGGTCCAGCCACAGGC TGG (reversed) Intronic
900176928 1:1295104-1295126 AGCCTGGGCCAGCCACAGACGGG - Intronic
900435930 1:2631316-2631338 TCCCTGACCCACCCACAGGCAGG - Intronic
901766886 1:11506771-11506793 TACCAGGTATACCCACAGGCAGG - Intronic
901814266 1:11785037-11785059 TTCCGGGCCCAGCCCCAGGCTGG - Intronic
902790897 1:18767211-18767233 TTCCTGGTGCAGCCACTGCCTGG - Intergenic
902806263 1:18863155-18863177 TTCCTGGTACAGCCACAAGAAGG + Intronic
902807496 1:18870124-18870146 TTCCTGGTACAGCCACAAGAAGG - Intronic
902987980 1:20167107-20167129 GGCCTGGGACAGCCACAGGCAGG - Intronic
903831708 1:26179162-26179184 TACCTTGTCCAGGCACAGGCCGG + Intronic
904206822 1:28860961-28860983 CATCTGGTCCAGCCCCAGGAGGG - Intronic
904265558 1:29316795-29316817 TCCCTGGACCAGTCACAGGTTGG + Intronic
904272126 1:29356908-29356930 TACCTGGTCCATCCTAAGACAGG - Intergenic
904480002 1:30787676-30787698 TATTTGGTCCTGCCACAGGCAGG - Intergenic
905629216 1:39509640-39509662 AACCTGGTCCAGCCAAGGGCAGG - Intronic
905668540 1:39776543-39776565 GACCTGGTCCGGCCATGGGCAGG + Intronic
906532477 1:46531678-46531700 CACCTGGACGAACCACAGGCCGG + Intergenic
907153066 1:52306776-52306798 CACCTGGTCCAGCTGCAGCCTGG + Intronic
910127552 1:83860715-83860737 TGCCTGGGACAGCCAAAGGCCGG + Intergenic
911179690 1:94849413-94849435 CACCTGGGTCGGCCACAGGCAGG - Intronic
916980705 1:170133815-170133837 TACCCAGTCCAGCTACTGGCAGG + Intergenic
920387119 1:205576994-205577016 TCCCAGGCTCAGCCACAGGCAGG - Intronic
921606683 1:217164514-217164536 TACGTTGTCCAGCCATGGGCTGG - Intergenic
1062908789 10:1199095-1199117 TGCCTGATTCTGCCACAGGCAGG + Intronic
1065611533 10:27475996-27476018 CACCTGGGCCTGCCTCAGGCTGG - Intergenic
1066048424 10:31614304-31614326 CAGCTCCTCCAGCCACAGGCTGG + Intergenic
1066400263 10:35069240-35069262 TAACTGGCCCAGCCACCAGCTGG + Intronic
1068781434 10:60922738-60922760 TACCTGGTCCATCCTCAGCAAGG - Intronic
1069631075 10:69897349-69897371 TCCCTGGGGAAGCCACAGGCTGG - Intronic
1070243688 10:74709693-74709715 TAAATTATCCAGCCACAGGCTGG + Intergenic
1071069046 10:81670144-81670166 TGCCTAGCCCAGCCACGGGCTGG + Intergenic
1071845909 10:89520917-89520939 TACGTGTTCCAGGCACTGGCTGG - Intronic
1072426384 10:95334316-95334338 CTCCTGCTCCAGCCACAGGAGGG + Intronic
1074289093 10:112124902-112124924 TCCCAGGTCCATCCATAGGCAGG + Intergenic
1074886344 10:117696710-117696732 TCCCTGGTCCAGCCCCATGGTGG - Intergenic
1075144478 10:119872206-119872228 GCCCTGGCCCTGCCACAGGCTGG + Intronic
1075611098 10:123855433-123855455 TGCAGGGCCCAGCCACAGGCAGG + Intronic
1076320685 10:129579333-129579355 GGCCTGGCCCAGCCACAGGTAGG - Intronic
1076611703 10:131730081-131730103 CTCCTGGGCCTGCCACAGGCTGG + Intergenic
1076848558 10:133081953-133081975 TGCCGGGTGCAGCCACTGGCTGG + Intronic
1077098552 11:810421-810443 TGCCTGATCCGGCCACATGCTGG + Intronic
1077113513 11:872540-872562 GGCCTGGCCCAGCCACAGGAGGG - Intronic
1078406707 11:11076074-11076096 TGGCTGGGCCAGCCGCAGGCAGG + Intergenic
1079121930 11:17692148-17692170 CACCTGTTCCATCCACATGCTGG + Intergenic
1080230118 11:30011393-30011415 GACCTGGCCCAGCAACAGGGGGG - Exonic
1081749647 11:45500783-45500805 TGCCTGGTGCATCCACAGGTTGG + Intergenic
1081771589 11:45653475-45653497 TACCTGGCCCAGCCCCATGATGG - Intronic
1081997985 11:47377117-47377139 TCACTTGGCCAGCCACAGGCAGG - Intronic
1084314576 11:68337692-68337714 TGCCTGGTCCACCCATAGTCAGG + Intronic
1084314595 11:68337778-68337800 TGCCTGGTCCACCAACAGCCAGG + Intronic
1084564923 11:69923281-69923303 GACCTGCTCCAGTCACTGGCGGG + Intergenic
1084800527 11:71540603-71540625 TTTCTGGTCCAGCCACAGGGTGG - Intronic
1085447657 11:76611257-76611279 TGCCTGATCCAGCCTCAGGCTGG - Intergenic
1085937098 11:81159883-81159905 TACCTAGGCCTCCCACAGGCGGG + Intergenic
1086037863 11:82438712-82438734 CACCTTGTGCAGCCTCAGGCAGG - Intergenic
1087407773 11:97751725-97751747 CATCTGATCCAGCCACAGGCTGG - Intergenic
1087652733 11:100887343-100887365 TACATGAACCAGCCACAGGAGGG - Intronic
1089291837 11:117441919-117441941 GACCTGGTTTTGCCACAGGCTGG + Intronic
1089556084 11:119316634-119316656 TGCCTTTTCCAGCAACAGGCGGG + Intronic
1092440752 12:8499814-8499836 TACCTGTAGCAGCCACAGGAGGG + Intergenic
1096990202 12:55795246-55795268 CACCTGGCCCAGCCAAAGGTAGG + Intronic
1100391913 12:94150848-94150870 TGCCTGGTTCAGCCCCAGGGTGG - Intronic
1101583963 12:106068074-106068096 GACCTGGTCCAGCCACATTATGG + Intronic
1103096493 12:118136534-118136556 TGCCTGGCCACGCCACAGGCCGG - Intronic
1104638644 12:130453300-130453322 GGCCTGCCCCAGCCACAGGCTGG + Intronic
1107644444 13:42479423-42479445 TTCCAGGTCCTTCCACAGGCCGG - Intergenic
1108559258 13:51627071-51627093 TACCTGGTCCAGCCACAGGCTGG - Intronic
1112644849 13:101318370-101318392 TGCCTGGTCTAGCCACAGCAGGG - Intronic
1113666432 13:112144705-112144727 CACCTGGTCCAGATCCAGGCAGG - Intergenic
1113880107 13:113620152-113620174 CATCTGCTCCACCCACAGGCCGG - Intronic
1114344625 14:21781735-21781757 TGCCTGGTCCAGCTTCAGCCTGG + Intergenic
1116507215 14:45698927-45698949 TACCTGGTCAAGCTGCATGCAGG + Intergenic
1117875907 14:60249658-60249680 TACCCGGAGCAGCCGCAGGCGGG - Intronic
1118445043 14:65843123-65843145 TACCTGGTCCAGCCAAGGACTGG + Intergenic
1118722508 14:68604437-68604459 TGGCTGGTGCAGCCACTGGCGGG - Intronic
1121020155 14:90575094-90575116 TACCAGGTCAAGCCCCAGGGAGG - Intronic
1122118083 14:99537508-99537530 CCACTGGCCCAGCCACAGGCAGG + Intronic
1122835074 14:104426886-104426908 TGCCTGGTACAGTCACCGGCGGG - Intergenic
1202937928 14_KI270725v1_random:109199-109221 TACCTGGGCCAGCCACACTGAGG + Intergenic
1124225469 15:27889788-27889810 TAACTGGTCCATGGACAGGCTGG + Intronic
1125506725 15:40271661-40271683 TCCCTGCTGCAGGCACAGGCAGG + Intronic
1125758346 15:42081131-42081153 TACCTGGACCACACACAGACAGG + Exonic
1126170050 15:45687877-45687899 CACCTGGTCCTGCCTCAGCCAGG + Intronic
1127673131 15:61214693-61214715 TACCTGGTCCATCTCCAGTCTGG - Intronic
1127899449 15:63330172-63330194 TACCTCCCCAAGCCACAGGCTGG - Intronic
1128107520 15:65055603-65055625 TGCTTCCTCCAGCCACAGGCAGG - Intronic
1128760764 15:70214779-70214801 AACCTGGTCCTGCCACAGGGTGG + Intergenic
1130738054 15:86571063-86571085 TAGCCGGTCCAGCCACAGCTCGG - Intronic
1131048335 15:89330251-89330273 TTCCTGGTGCAGCCAGCGGCTGG - Exonic
1133565154 16:6986485-6986507 CACCACGTCCAGCCCCAGGCTGG + Intronic
1142143384 16:88482594-88482616 TACCTGCTGCAGCCTCAGGAAGG - Intronic
1142319225 16:89370369-89370391 TACCTGCCCCAGCCACACCCTGG + Intronic
1142418836 16:89957990-89958012 TGTCTGATCCAGCCTCAGGCAGG + Intronic
1142711651 17:1726894-1726916 TAGCTGGACCAGAGACAGGCCGG + Exonic
1143090158 17:4445272-4445294 TCCCTGATCCAGTCACAGCCAGG - Intronic
1144522924 17:15966372-15966394 TGGCCAGTCCAGCCACAGGCTGG - Intronic
1145265230 17:21376719-21376741 GCCCTGGTCCAGCCACGGGTCGG - Exonic
1146257531 17:31400330-31400352 AACGTGGTCCAGGCAGAGGCAGG + Intronic
1146946968 17:36880087-36880109 TCCCTTGTCCAGCCAAATGCGGG - Intergenic
1150227148 17:63530361-63530383 GACCAGGGCCAGGCACAGGCAGG + Exonic
1150267275 17:63839663-63839685 TACCTGGTCCTGCTGCAGGCAGG - Intronic
1151396589 17:73826990-73827012 TTCCAGGGCCAGCCCCAGGCTGG + Intergenic
1152356069 17:79808076-79808098 CTCCTGGTCCCGCCAAAGGCTGG - Intergenic
1152444942 17:80336993-80337015 TACCTGGGCCAGCCTCCGGACGG + Intronic
1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG + Intronic
1153547005 18:6218508-6218530 TACCTGGTCCTGTCCCAGCCTGG + Intronic
1154013432 18:10595269-10595291 TACGTTGTCCAGCCAGAGACAGG + Intergenic
1154346500 18:13547654-13547676 TGCCTGGTCCAGCCACAGCAAGG - Intronic
1155407201 18:25502004-25502026 CACATGTTGCAGCCACAGGCTGG + Intergenic
1157622742 18:49025714-49025736 TAACTGGTGCAGCCAGTGGCTGG + Intergenic
1158089931 18:53699055-53699077 TCCCTGGTGCAGTGACAGGCAGG + Intergenic
1161023261 19:2021744-2021766 CACCTGGCCCAGCCCCAGGCTGG + Intronic
1162328053 19:10010348-10010370 GACCTGGGCCAGCCGCGGGCCGG - Exonic
1163555131 19:17987703-17987725 TACCATGCCCAGCCCCAGGCAGG - Intronic
1165803677 19:38567666-38567688 AACCTGGGCCAGGCACAGGGCGG + Intronic
1166875762 19:45896351-45896373 TCCCTGGGCCAGCCACCAGCAGG + Intronic
1167145436 19:47678840-47678862 TCCCGGGTCCAGCCACTTGCAGG + Intronic
1167747101 19:51358269-51358291 TAACTGTTCCTCCCACAGGCAGG + Intronic
925129573 2:1484801-1484823 AGCCTGGTGCAGCCACAGCCCGG - Exonic
927473552 2:23395062-23395084 TCCTTGGTCCTGGCACAGGCTGG + Intronic
927553352 2:24017069-24017091 GGCATGGTCCAGGCACAGGCGGG - Intronic
928197981 2:29228721-29228743 TGCCTGGACCAGCCAGAGGCAGG - Intronic
930999740 2:57765466-57765488 AGCCTGGTCCAGACACAGGATGG - Intergenic
932215431 2:69963094-69963116 GACCTGGGCCATCCAGAGGCAGG - Intergenic
932398152 2:71462292-71462314 TGCCTGGCCCAGCCGCAGCCTGG - Intronic
933660733 2:84925487-84925509 TGCCTGGCCCACACACAGGCAGG + Intergenic
934117997 2:88813874-88813896 GAGGTGGTCCAGCCACAGGGTGG - Intergenic
935707151 2:105866795-105866817 TACTTGGTCCTGACACAGGCTGG + Intronic
936252118 2:110874974-110874996 TCCCTTGTCCTGCCACCGGCAGG + Intronic
937104438 2:119296657-119296679 TGCCTGCCCCAGACACAGGCAGG - Intergenic
937650709 2:124315985-124316007 TATATGGTCCATCCTCAGGCTGG - Intronic
937776194 2:125778653-125778675 TGCTTGGTCCAGTCAAAGGCAGG - Intergenic
938152437 2:128899200-128899222 TACCTGGCTCTGCCTCAGGCTGG + Intergenic
938422008 2:131153666-131153688 TACCTGGTGCAGACACACCCAGG + Intronic
941404918 2:165075487-165075509 TACCTGGTCTAGATACAGCCTGG + Intergenic
944870004 2:203900670-203900692 GAACTGGGCCTGCCACAGGCAGG - Intergenic
947717801 2:232350623-232350645 TCCTGGGTCCAGCCACAGGCTGG - Intergenic
947728909 2:232417477-232417499 TGCTGGGTCCAGCCGCAGGCTGG - Intergenic
947740872 2:232484304-232484326 TCCTGGGTCCAGCCACAGGTTGG - Intronic
948631557 2:239306292-239306314 TCCCTGGCCCATCCACAGGTGGG + Intronic
948704052 2:239778444-239778466 TTCCTGGTGCAGGAACAGGCAGG + Intronic
948795501 2:240400305-240400327 GTTCTGTTCCAGCCACAGGCAGG + Intergenic
1169379702 20:5096003-5096025 TTCCAGGCCCAGCCACATGCTGG + Intronic
1170099252 20:12680751-12680773 CAGCTGGGGCAGCCACAGGCCGG + Intergenic
1171018377 20:21562063-21562085 TGCCTGCTCCATCCTCAGGCAGG + Intergenic
1171141269 20:22745668-22745690 AACCTGGTCAATTCACAGGCAGG + Intergenic
1173430967 20:42986953-42986975 TACCTGGTCTAGCCTGATGCAGG - Intronic
1174047834 20:47746348-47746370 TATGAGGTCGAGCCACAGGCGGG + Intronic
1175782504 20:61691680-61691702 TACCCAGTCCAGTCACAGGATGG - Intronic
1176044841 20:63087190-63087212 AACCTGGTGCAGCCACAGCTGGG - Intergenic
1176585395 21:8579940-8579962 TACCTGGGCCAGCCACACTGAGG - Intergenic
1180268203 22:10556839-10556861 TACCTGGGCCAGCCACACTGAGG - Intergenic
1181016246 22:20070521-20070543 TGACTGGCCCAGCCACAGGGAGG + Intergenic
1181022142 22:20109221-20109243 TTCATGGTCCACCAACAGGCTGG - Intronic
1181261539 22:21601672-21601694 TGCCTGGCCCTGCCCCAGGCTGG - Intronic
1181516259 22:23415320-23415342 CACCTGCTCCAGCCACAGCCTGG + Intergenic
1182896714 22:33864964-33864986 TCCCTGGCCCACCCACAGGTTGG + Intronic
1184068318 22:42132831-42132853 TGCCTGCTCCAGCCGCAGTCTGG + Intergenic
1184147940 22:42622485-42622507 CAGCAGGTCCAGCCAGAGGCCGG + Intronic
1184596713 22:45518375-45518397 TCCCTGCTCCAGCCACATGCTGG - Intronic
1185037335 22:48486355-48486377 TGCCTGGTCCAGCCCCATCCCGG - Intergenic
1185232304 22:49690118-49690140 TCCCTGGTAGAGCCTCAGGCAGG - Intergenic
949437430 3:4044599-4044621 TAACTTGTTCAGCCTCAGGCTGG + Intronic
952898990 3:38097306-38097328 TTCCTGAGCCAGCCCCAGGCAGG - Intronic
954324784 3:49857612-49857634 TACCTGGGCCAGCCACCGCAAGG - Intergenic
954424513 3:50436320-50436342 TACCAGGTGCAGCCACAGTCTGG + Intronic
954876075 3:53803957-53803979 GACCTGGCCCAGCTCCAGGCTGG - Intronic
959000942 3:100963746-100963768 TACCTGCTCCATCCACAGTAGGG + Intronic
961825686 3:129597930-129597952 TACCTGGTCCAGCCACAGTGGGG + Intronic
968628361 4:1637967-1637989 TTCCTCGACTAGCCACAGGCAGG - Intronic
968913455 4:3487025-3487047 CACGTGGGCCAGCCCCAGGCGGG + Intronic
969494231 4:7516727-7516749 TTCCTGGTTCAGCTGCAGGCAGG - Intronic
974023540 4:56712174-56712196 TGCCTGGTCCAGCCACAGCCTGG + Intergenic
974680032 4:65148437-65148459 TAACTGGTCCAGCCAAGGGTGGG - Intergenic
976511011 4:85910115-85910137 CACCTGGTCTAGCCGCAGCCTGG - Intronic
982827706 4:160021445-160021467 TACATGGTCCACCCAAAGACAGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985690709 5:1310346-1310368 GACCAGGTCCAGCCTCAGGTGGG + Intergenic
991165596 5:63563105-63563127 TGCCCAGTCCAGCCACAGGCTGG + Intergenic
991206064 5:64051428-64051450 TGCCCACTCCAGCCACAGGCTGG + Intergenic
995724103 5:115166861-115166883 CACCTGTTCCAGCCACAGCAAGG + Intronic
997346492 5:133196153-133196175 AGCCTGGGCCAGCCCCAGGCAGG + Intergenic
997648134 5:135494668-135494690 GCCCTGGGCCAGCCACTGGCTGG + Intergenic
1001281029 5:170386592-170386614 TAGCTGGGCCGGGCACAGGCAGG + Intronic
1001592796 5:172877920-172877942 TACCCGGCCCAGCCCCAGGCTGG - Intronic
1002135564 5:177105614-177105636 TCCCAGGTCCAGGCACAGTCAGG + Intergenic
1003300872 6:4881963-4881985 TGCCTGCTCCAGCCTCTGGCAGG - Intronic
1003394201 6:5739417-5739439 TAACTGGTCAAACAACAGGCAGG - Intronic
1004954579 6:20715048-20715070 TAACTGCTCTTGCCACAGGCAGG - Intronic
1008789313 6:55210676-55210698 TTCCTTATCCAGCCACAGGAAGG - Intronic
1011502197 6:88002979-88003001 CATCTGGGCCAGCCACAGGTAGG - Intergenic
1013577433 6:111498387-111498409 TCCCTGGCACAGTCACAGGCTGG + Intergenic
1016329746 6:142944621-142944643 GACGTGGTGCAGCCACAGGAAGG - Intronic
1017056790 6:150443812-150443834 TGCCTGGTACAGTCACAGGATGG - Intergenic
1018620982 6:165729486-165729508 TACCTGCTCCTACCACAGGGGGG + Intronic
1019447449 7:1078773-1078795 TGCCTGCTCCAGACAGAGGCTGG + Intronic
1019965329 7:4494134-4494156 CACCGGGCCCAGCCGCAGGCAGG + Intergenic
1025165235 7:56706436-56706458 TTCCATCTCCAGCCACAGGCAGG + Intergenic
1025240532 7:57268379-57268401 TTCCATCTCCAGCCACAGGCAGG - Intergenic
1026403202 7:70037382-70037404 TAGCTGCTCTTGCCACAGGCAGG + Intronic
1026804953 7:73423874-73423896 TGGCTGGCCCAGCCGCAGGCGGG - Intergenic
1026878112 7:73891379-73891401 GACCTGGTCCAGCCGGAGGGTGG + Intergenic
1027593568 7:80144072-80144094 TACCTGGTCTAGCCCCAGTAAGG - Intronic
1030484385 7:110148298-110148320 TGCCTAGTCCAGCAACAGCCTGG - Intergenic
1031786697 7:126041678-126041700 CACCTGGTCCAGCTGCAGGGAGG + Intergenic
1031936430 7:127739828-127739850 TTCCTTGTCCAGACAGAGGCAGG - Intronic
1032089362 7:128903686-128903708 TCCCTGGTAGAGCCACAGGTAGG - Intronic
1032463658 7:132129890-132129912 GCCCTGCTCCAGCCACATGCAGG + Exonic
1032526179 7:132579686-132579708 AAGCTGGACCAGCCACGGGCAGG + Intronic
1032903478 7:136337540-136337562 AACCTGGTCAAGCCACTGGAAGG + Intergenic
1035617110 8:1010845-1010867 CTCTGGGTCCAGCCACAGGCAGG + Intergenic
1037614926 8:20510384-20510406 TTACTGGCCCAGCCACAGCCAGG - Intergenic
1042788781 8:72580374-72580396 TACCCAGTCTAGCCACAGCCTGG + Intronic
1047325705 8:123834037-123834059 TACCATGTCCAGCCACTGGTGGG + Intergenic
1048486005 8:134848087-134848109 TGCCTGGCCCATCCACAGGCTGG + Intergenic
1049310401 8:141931143-141931165 TACCTGCTCCAGCTGCAGTCTGG - Intergenic
1049783563 8:144439904-144439926 TAGCAGGAACAGCCACAGGCAGG - Intronic
1050110665 9:2212032-2212054 TACCTAGTCCAGTAACAGACTGG + Intergenic
1051371572 9:16363718-16363740 TGCCTGCTGCAGGCACAGGCAGG - Intergenic
1051896629 9:21995142-21995164 TACCTAGTCCGGCGCCAGGCCGG - Intronic
1052652883 9:31326037-31326059 TGCTTGGTCCAGCCATAGCCTGG - Intergenic
1060265382 9:122108929-122108951 CACCTGGCCCTGCCTCAGGCAGG + Intergenic
1060503588 9:124181201-124181223 TGCCTTTTCCATCCACAGGCAGG + Intergenic
1060819760 9:126654541-126654563 TACCTGCTCCAGCCCCTGGCTGG - Intronic
1061742535 9:132717368-132717390 TACATGGTCCAGTCCCAGCCTGG - Intergenic
1203615298 Un_KI270749v1:57463-57485 TACCTGGGCCAGCCACACTGAGG - Intergenic
1185700087 X:2224182-2224204 TACATGGTCAAGACACAGGTCGG - Intronic
1185811930 X:3118682-3118704 AACCCGCTCCAGCCAGAGGCAGG - Intergenic
1186223534 X:7374582-7374604 CATCTTGTCCAGCCACAGCCTGG - Intergenic
1189075082 X:37906105-37906127 CAGCTGGTCCAGCCTCAGGAGGG - Intronic
1199573360 X:149289851-149289873 TACCTGATCCAGTTGCAGGCAGG - Intergenic