ID: 1108559454

View in Genome Browser
Species Human (GRCh38)
Location 13:51628189-51628211
Sequence CCTGAGGGGCGGCTCAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108559454_1108559473 29 Left 1108559454 13:51628189-51628211 CCTGCGCTGAGCCGCCCCTCAGG 0: 1
1: 0
2: 4
3: 24
4: 155
Right 1108559473 13:51628241-51628263 AGTGCCCAAAGTTTCAGAGGGGG 0: 2
1: 6
2: 19
3: 57
4: 228
1108559454_1108559470 26 Left 1108559454 13:51628189-51628211 CCTGCGCTGAGCCGCCCCTCAGG 0: 1
1: 0
2: 4
3: 24
4: 155
Right 1108559470 13:51628238-51628260 CTCAGTGCCCAAAGTTTCAGAGG 0: 2
1: 0
2: 5
3: 32
4: 226
1108559454_1108559472 28 Left 1108559454 13:51628189-51628211 CCTGCGCTGAGCCGCCCCTCAGG 0: 1
1: 0
2: 4
3: 24
4: 155
Right 1108559472 13:51628240-51628262 CAGTGCCCAAAGTTTCAGAGGGG 0: 3
1: 2
2: 13
3: 40
4: 198
1108559454_1108559471 27 Left 1108559454 13:51628189-51628211 CCTGCGCTGAGCCGCCCCTCAGG 0: 1
1: 0
2: 4
3: 24
4: 155
Right 1108559471 13:51628239-51628261 TCAGTGCCCAAAGTTTCAGAGGG 0: 4
1: 2
2: 9
3: 41
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108559454 Original CRISPR CCTGAGGGGCGGCTCAGCGC AGG (reversed) Intronic
900191677 1:1354728-1354750 CCGGGGGGGCGGCTCCGCGTGGG + Exonic
901768136 1:11516742-11516764 CCAGAGGGGCTACTCAGCCCAGG - Intronic
901875700 1:12165948-12165970 CCTGAGGGGCTGCTGAGACCAGG - Intergenic
902896653 1:19484703-19484725 CCTGATGAGAGGCTCAGGGCGGG + Intronic
903950662 1:26994236-26994258 CCTGAGCGGCGGCGTGGCGCAGG + Exonic
904197168 1:28794484-28794506 CCAGAGGGGCAGCTCAGCTCTGG - Intergenic
904358037 1:29954166-29954188 CCTGAAGGGCAGCTCAGCACAGG - Intergenic
905202149 1:36322595-36322617 CCCGGGGCCCGGCTCAGCGCCGG - Exonic
909449898 1:75786191-75786213 CCTGAGAGGCGCATCTGCGCAGG + Exonic
912448053 1:109752251-109752273 CCTGAGGGGAATCTCAGGGCTGG - Intronic
915815524 1:158961762-158961784 CCTGAGTGGTGGCTCTGCCCAGG - Intronic
920920402 1:210293204-210293226 CCGGCGGGGAGGCTCAGCCCAGG + Intergenic
922767903 1:228165651-228165673 CCTGAGGGGCGGAGCAGCGCCGG - Intergenic
923007994 1:230067352-230067374 CTCGGGGGGCGGCTCTGCGCTGG + Exonic
923986397 1:239387069-239387091 ACTGAAGGGCGGCTCCGGGCAGG + Intronic
924950160 1:248874658-248874680 CTAGAGGGGCGGGTCAGGGCCGG + Intergenic
1067042949 10:42966485-42966507 GCTGAGGGTCGGCTCTGAGCAGG - Intergenic
1069906262 10:71734366-71734388 CCTCAGGTGCGGCCCATCGCTGG + Intronic
1070148489 10:73791494-73791516 CCTCAGGGGAGACTCACCGCTGG - Exonic
1071563018 10:86657731-86657753 CCTGAGGCGTGGCCCAGCGCAGG - Intronic
1073497931 10:103911288-103911310 ACAGAGGGGCTGCTCAGAGCAGG + Intronic
1074308850 10:112303775-112303797 CCTGCGTGGGGGCTCAGCTCTGG - Exonic
1075634197 10:124019276-124019298 CCTGAGGGCGGTCTCAGGGCTGG - Intronic
1075735863 10:124664277-124664299 CCTGAAGGGAGGTTCAGAGCTGG + Intronic
1075858911 10:125656872-125656894 GCTGGGGGGCAGCTCAGTGCTGG - Intronic
1076574268 10:131453540-131453562 CCTGAGGGGAGGCCCAGAGCAGG + Intergenic
1076826403 10:132971814-132971836 CCTGGGGGGAGGTTCAGAGCAGG + Intergenic
1077145181 11:1041391-1041413 CCTGAGGCTGGGCTCAGCCCAGG + Intergenic
1077443780 11:2580848-2580870 CTTGAGGAGCAGCCCAGCGCAGG - Intronic
1078466675 11:11555175-11555197 CCTGATGGGCTGCTCAGGGCGGG + Intronic
1081534843 11:43989154-43989176 TGTGTGGGGAGGCTCAGCGCTGG + Intergenic
1083259432 11:61515206-61515228 ACTGAGGGGAGGCTCAGCCCCGG + Intergenic
1083808498 11:65088842-65088864 CCTGATGGTAGGCTCAGGGCAGG - Exonic
1085266731 11:75241832-75241854 CCCGCGGGGCGGCGCAGCGCAGG - Exonic
1092609093 12:10153466-10153488 CCTGTGGTGTGGCCCAGCGCGGG + Intergenic
1096215301 12:49795053-49795075 TCTGTGCGGCGGTTCAGCGCTGG + Exonic
1096515378 12:52152530-52152552 CCTGAGGGTGGGCGCGGCGCGGG + Intergenic
1101827421 12:108231313-108231335 GCTGAGGGAAGGCTCAGAGCAGG - Intronic
1102046550 12:109833309-109833331 CGGGAGGGGCGGCTCAGCCGAGG - Intronic
1102136922 12:110583123-110583145 CCTGAGGAGCGCCCCAGCGGCGG - Exonic
1103800389 12:123533852-123533874 CCTGAGGGGCGGCAGAGCGCGGG + Intergenic
1104637192 12:130445215-130445237 CGTGAGGGGCAGCTCAGCTTCGG + Exonic
1104896006 12:132163893-132163915 CCTCATGGGTGGCTCAGCCCTGG + Intergenic
1104961506 12:132490387-132490409 CGCGGGGGGCGGCTCAGCCCCGG - Exonic
1106344048 13:28858924-28858946 CCTGAGTGGCAGCTCAGTTCAGG - Intronic
1108559454 13:51628189-51628211 CCTGAGGGGCGGCTCAGCGCAGG - Intronic
1112368300 13:98773985-98774007 GCTGCGGGGCAGCTCAGTGCTGG - Intergenic
1114696565 14:24632074-24632096 CCTGAGGGGCTGCACAGCTCTGG + Exonic
1115798740 14:36968663-36968685 CCTGAGCTGCAGCTCAGCGTTGG + Intronic
1118019398 14:61695602-61695624 CCTGAGGAGAGGCTCGGAGCCGG + Intronic
1118206526 14:63728141-63728163 CCTGAGGGGCCGGGCCGCGCGGG + Intergenic
1118320563 14:64749870-64749892 CCTGAGGAGCAGCTCAGGCCTGG + Exonic
1118809535 14:69262700-69262722 CCTGACGGGGGGGTCAGTGCTGG - Intronic
1119474116 14:74917353-74917375 CCTGAGGGAAGGCCCCGCGCTGG - Intronic
1121101468 14:91253223-91253245 CCTGAGGGGCCGCGCAGATCTGG + Intronic
1121437081 14:93927288-93927310 CCTGAGGGGCCCCCCAGCTCCGG + Intronic
1122966066 14:105126612-105126634 CCTGAGGGGCTGCTCGGCCAGGG + Intergenic
1125275087 15:37980354-37980376 CCTGAGTGGTGGCTCTGCCCAGG + Intergenic
1125577335 15:40764554-40764576 CCTGCGGAGCGGCTCTGTGCAGG - Intronic
1128217668 15:65945472-65945494 CCTGAGGAGGGGCTCAGCCCTGG + Intronic
1128633906 15:69290882-69290904 GCTGTGGGGCAGCTCAGGGCAGG - Intergenic
1131179409 15:90229793-90229815 CCTGTGGGGCGGCTCTGAGGTGG + Intergenic
1132585694 16:705083-705105 CCTGAGGGGCGGCCCTCCCCGGG - Intronic
1136567676 16:31079914-31079936 GCTGAAGGGCCGCTCAGAGCTGG - Exonic
1138180712 16:54938535-54938557 CCCGAGAGGCCGCCCAGCGCTGG - Intergenic
1141615376 16:85206909-85206931 CCAGAGGGGTGGGCCAGCGCCGG + Intergenic
1142848082 17:2691732-2691754 CCGGAGGGGCCGCTCCGCCCCGG + Intronic
1143633161 17:8150244-8150266 CCTGAGTGCCAGCTCAGAGCAGG - Exonic
1144786877 17:17836944-17836966 CCTCAGAGGCGGCCCGGCGCCGG + Exonic
1145282574 17:21478478-21478500 CATGAGGGGCGGCACAGGTCAGG - Intergenic
1146059047 17:29594924-29594946 CCTGGGGGCTGGCTCAGCGTGGG - Intronic
1147477019 17:40721809-40721831 TCTGGGGGGCGGCTCTGCCCGGG - Intergenic
1147557513 17:41488843-41488865 CCTGGGGTGTGGCTCAGGGCTGG - Intronic
1148991611 17:51671247-51671269 CCTGAGGGACAGCTCAGGGCAGG - Intronic
1150447454 17:65238137-65238159 CCTGAAGGGCTGCCCAGGGCAGG - Intergenic
1151620533 17:75242284-75242306 CCTGAAGGGCAGCGCAGCCCCGG + Intronic
1152245557 17:79183076-79183098 CCTGCGCGGCGGCCGAGCGCGGG - Intronic
1152413557 17:80144140-80144162 CCTGGGGTGCGGCGCAGGGCTGG - Intronic
1154151438 18:11909062-11909084 CCGGAGGGGCAGCGCGGCGCGGG - Exonic
1155227033 18:23737890-23737912 CCAGAGGGACCGCTCAGCGGAGG + Intronic
1157204625 18:45687773-45687795 CCTTAGGGGCGGCCCAGGCCGGG + Intergenic
1160453598 18:78980679-78980701 CCTGGGGGGCGGCGCGGCGGCGG - Intronic
1160869405 19:1270185-1270207 CCTGGGGGGCACCTCAGGGCAGG - Intronic
1161301251 19:3544160-3544182 CCTGCGGGGGGGCTCTGGGCAGG - Intronic
1161591786 19:5132243-5132265 CATGATGGGCGGTTCAGGGCTGG + Intronic
1162927825 19:13938864-13938886 CCTGAGAGGTGGCACAGCCCAGG - Intronic
1162954341 19:14090093-14090115 CCGGCGGGGTGGCTCCGCGCCGG + Exonic
1163154570 19:15432790-15432812 CCTGAGGGGCGGGGCGGAGCGGG - Intronic
1163386702 19:17004475-17004497 CCTGGGGGGCTGCTCAGGGAAGG - Intronic
1163464786 19:17460997-17461019 CCTGAGGGGCCTCTAAGGGCGGG + Intergenic
1165446835 19:35861214-35861236 CCTGCGGGGCGGCGCCGCGGAGG + Exonic
1165862329 19:38915797-38915819 CCAGAGAGGCAGCTCAGCGCCGG - Intronic
925291741 2:2752523-2752545 CCTGAGGGGCGGCCCAGGACAGG - Intergenic
925411577 2:3642854-3642876 CGTGAGGGACGGCTCAGGGAGGG - Intronic
926035211 2:9630816-9630838 CCTCAGGGACGGCTCCGGGCGGG - Intronic
926319451 2:11738697-11738719 CCTGAGGGCCTGCCCAGCTCAGG + Intronic
927267137 2:21163268-21163290 CCTCAGGGGAGGCTCTGCCCAGG - Intergenic
929447350 2:42011705-42011727 CCTAAGGGGCAACTCAGGGCTGG + Intergenic
936188922 2:110324814-110324836 CCTGAGGGGCAGGGCAGTGCTGG - Intergenic
937245180 2:120487961-120487983 CCTGAGGTGCCGGCCAGCGCGGG - Intergenic
941225254 2:162839503-162839525 CCCGAGGCGCGGCTCAGCGCTGG - Intergenic
941995982 2:171602457-171602479 CCTGAGGAGGGTCTCAGCCCCGG + Intergenic
945057710 2:205882753-205882775 CCTGAGGGTCGGCCCAGCCCAGG + Intergenic
948764499 2:240212499-240212521 CCTCAGGGGCGGCCCACCCCAGG - Intergenic
948982328 2:241500745-241500767 CCTGGGCGGCGGCTCAGCACTGG - Exonic
1171418435 20:24999735-24999757 CCTGAGAGGCAGCTCTGGGCTGG + Intergenic
1174475962 20:50795517-50795539 CCTGAGGCGCCGCTCGGCCCGGG - Intronic
1175284535 20:57829106-57829128 CCTGAGGGGCAGGGCAGGGCAGG + Intergenic
1175426437 20:58870349-58870371 CCTGAGTGGTGGCTGAGGGCAGG + Intronic
1175732815 20:61365562-61365584 CCTGAGGGTGGGCTCAGTGTGGG + Intronic
1175946850 20:62562889-62562911 CCTGAGGGGCAGCACAGGACTGG + Intronic
1179660484 21:42871426-42871448 CCTGTGGAGGGGCTCAGAGCAGG + Intronic
1181557082 22:23677394-23677416 CCTGATGAGCAGCTCAGAGCAGG + Intergenic
1181697294 22:24600146-24600168 CCTGATGAGCAGCTCAGAGCAGG - Intronic
1182639340 22:31754039-31754061 GCTTAGGGGCGGAACAGCGCGGG + Intronic
1183092905 22:35535652-35535674 CCTGAGGGGCTGCTCATCTCTGG - Intergenic
1183882106 22:40841697-40841719 CTTGAGGGGAGGCTGAGCCCAGG - Intronic
1184090432 22:42290285-42290307 CCTGAGAAGCGGCCCAGCACAGG + Intronic
1184513010 22:44943989-44944011 CCTGAGGGAAGGAACAGCGCTGG + Intronic
1185181737 22:49367500-49367522 CCAGAGGCGTGGCTCAGCCCTGG + Intergenic
1185419806 22:50728964-50728986 CCTGAGGTGGGCCTCAGCACAGG - Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
954368897 3:50160108-50160130 CCCCAGGGGCTGCTCAGGGCAGG - Intronic
954444786 3:50540801-50540823 CCTGAGGGATGGCTCTGGGCTGG + Intergenic
955489038 3:59464112-59464134 CCTGAGGGTCTGCACACCGCTGG + Intergenic
968008088 3:195256416-195256438 CCTGAGGTGCGGCCCTGCACAGG + Intronic
968154417 3:196367671-196367693 CCTGAGGGGCAGCTCTGGGAGGG - Intronic
968489645 4:883175-883197 CCTGAGGGGCTGCAGAGCGTGGG - Intronic
972817171 4:42657115-42657137 GCGGAGGGGCGGCTCGGCGAGGG + Intergenic
979517971 4:121632934-121632956 CCTGATGAGTGGCTCAGCGCAGG - Intergenic
979779480 4:124632532-124632554 CCTGAGGGGCAGCTGAGGCCGGG - Intergenic
989537582 5:42582111-42582133 ACTAAGGGGTGGTTCAGCGCAGG + Intronic
989565083 5:42894037-42894059 CAGGAGTGGCGGCTCAGCACAGG - Intergenic
989565775 5:42899386-42899408 CAGGAGTGGCGGCTCAGCACAGG + Intergenic
989573827 5:42971058-42971080 CAGGAGTGGCGGCTCAGCACAGG - Intergenic
997690723 5:135825882-135825904 CCTCAGGGGCTGCCCAGGGCTGG + Intergenic
1001529997 5:172454702-172454724 CCGGCGCGGCGGCTCAGCACCGG - Intergenic
1002346515 5:178551745-178551767 CCTGAGGGGGTGCTCAGGGCAGG - Intronic
1002525374 5:179812710-179812732 CAGGAGTGGCGGCTCAGCACAGG + Intronic
1002991688 6:2245027-2245049 CCTGAGGGGCAGGTGAGAGCGGG + Intronic
1003187907 6:3849196-3849218 CCTGTGGGGCGGGCCAGCGCGGG - Intergenic
1004169904 6:13287753-13287775 CCTGAAAGGCAGCTCAGCTCAGG - Exonic
1004515462 6:16318797-16318819 CCTGTGGGGAGGCTCAGGGATGG + Intronic
1007779855 6:44246539-44246561 GCTGAGGGGCAGCTCAGCGTAGG - Intronic
1017810682 6:157981674-157981696 CCTGCGGGGAGCCTCAGCCCCGG + Intergenic
1018299536 6:162386586-162386608 CCTGAGGGCCAGCCCAGTGCTGG - Intronic
1018845186 6:167551153-167551175 CCTGGGGGACGGCGCAGAGCGGG - Intergenic
1018912127 6:168107427-168107449 CCTGAGGGGATGCTCAGATCAGG - Intergenic
1019149418 6:169994205-169994227 CCTGAGTGGTGGCTCAGCCCAGG + Intergenic
1027232713 7:76281892-76281914 CCTGGAGGGTAGCTCAGCGCGGG - Intronic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1035729401 8:1843846-1843868 CCTGAGCGGCCGCTCAGAGGAGG - Intronic
1037818728 8:22125403-22125425 CCTGACAGCCGGCTCAGCACAGG - Exonic
1038612833 8:29070646-29070668 CCTGTGCGGCGGCGCAGCACAGG - Exonic
1040469678 8:47726902-47726924 ACTGAGGGCCGGCTCAGCTGTGG + Intronic
1040661644 8:49582468-49582490 CCTCAGGGGAGGCTCTGCTCAGG + Intergenic
1047495089 8:125403567-125403589 CCTAAGGGGCCGCTCAGGGCTGG + Intergenic
1049054199 8:140222123-140222145 CCTGAGGAGCGGCTCAGCAGAGG - Intronic
1049183052 8:141232990-141233012 GCAGAGGTGCCGCTCAGCGCTGG - Intronic
1049230351 8:141478528-141478550 CCGGTGGGGCGGCTCTGGGCTGG + Intergenic
1049389707 8:142361408-142361430 CCTGGTTGGCGGCTCAGCCCTGG - Intronic
1049662543 8:143826192-143826214 TCTGAGGGGCGGCACAGCAGAGG + Intronic
1050151582 9:2622864-2622886 CCGGAGAGGCGGCCCCGCGCCGG - Intronic
1052996364 9:34553557-34553579 CCTAAGGGGAGGCTCAGCTGGGG - Intronic
1055649931 9:78397305-78397327 TCTGAGGGGAGGCTCAGGGCTGG - Intergenic
1057274146 9:93667346-93667368 GCCCAGGGGCGGCTCAGCACTGG - Intronic
1057438200 9:95062030-95062052 CCAGAGGGGAGGATCAGAGCAGG + Intronic
1060551511 9:124487680-124487702 CCTCGGGGGCGGCTCCGCCCTGG - Intronic
1061413657 9:130433955-130433977 ACTGAGGGGCGGATCAGACCTGG - Exonic
1061909685 9:133716099-133716121 CCTGGAGGGCGAGTCAGCGCTGG - Intronic
1062028248 9:134350397-134350419 CCTGGGTGGTGGCTCAGAGCTGG + Intronic
1062405372 9:136393734-136393756 CCGGGCGGGCGGCTAAGCGCAGG - Intronic
1185482876 X:460653-460675 CCTGAAGCGTGGCTCAGCCCTGG - Intergenic
1186506873 X:10100673-10100695 CCCGAGGGGCTGCTCAGTGCAGG - Intronic
1193462830 X:81810816-81810838 CCTGTGGGGAGGCTCAGCGCTGG + Intergenic
1198346783 X:135767538-135767560 CCTGAGGGGGGACTCTGCCCTGG - Intronic
1198348689 X:135784822-135784844 CCTGAGGGGGGACTCTGCCCTGG - Intergenic
1198350594 X:135802096-135802118 CCTGAGGGGGGACTCTGCCCTGG - Intronic
1198352501 X:135819359-135819381 CCTGAGGGGGGACTCTGCCCTGG - Intronic
1198354410 X:135836627-135836649 CCTGAGGGGGGACTCTGCCCTGG - Intronic
1198356320 X:135853885-135853907 CCTGAGGGGGGACTCTGCCCTGG - Intronic
1198358234 X:135871159-135871181 CCTGAGGGGGGACTCTGCCCTGG - Intergenic
1198360147 X:135888433-135888455 CCTGAGGGGGGACTCTGCCCTGG - Intronic
1200117967 X:153777405-153777427 CCTGAGAGGAGGCTCAGCCAGGG + Intronic