ID: 1108566378

View in Genome Browser
Species Human (GRCh38)
Location 13:51702484-51702506
Sequence ATAAGCTTCTTAAAGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108566378 Original CRISPR ATAAGCTTCTTAAAGGGGGC TGG Intronic
902532790 1:17101255-17101277 ATAAGCGTCTATAAGGAGGCAGG - Intronic
909093647 1:71259050-71259072 ATTAGCTTCTTAAAAGGTTCAGG + Intergenic
911345231 1:96688844-96688866 ATATGCTCCTTACAGGGGGGTGG - Intergenic
911704800 1:100998883-100998905 GCAAACTTCTGAAAGGGGGCAGG + Intronic
913552395 1:119928363-119928385 CTTAGATACTTAAAGGGGGCAGG - Intronic
922256185 1:223894794-223894816 ATCAGGTTCTTAAAAGGGTCTGG - Intergenic
924008231 1:239635809-239635831 CTAAGCCTCTTGCAGGGGGCAGG - Intronic
924233996 1:241985421-241985443 ATAAGAATCTAAAAGTGGGCGGG - Intergenic
924352889 1:243135500-243135522 AAAAATTTCTTAAAGGTGGCCGG - Intronic
924676931 1:246188656-246188678 ATATGCTTCTTTAAGAGGTCTGG + Intronic
1065834080 10:29641109-29641131 TTAAATTTGTTAAAGGGGGCTGG + Intronic
1068727401 10:60318732-60318754 ATAATGTTTTGAAAGGGGGCAGG - Intronic
1069623634 10:69853119-69853141 AGATGCTTTTTAGAGGGGGCAGG - Intronic
1070437769 10:76410604-76410626 TAAAGCTTCTTGATGGGGGCTGG - Intronic
1075880164 10:125844227-125844249 ATAAGCATCTTAAACAGAGCAGG + Intronic
1079659340 11:23019841-23019863 AGAATCTTCTTTAATGGGGCTGG + Intergenic
1087012167 11:93524613-93524635 ATAAGCTACTTCCAGGGGCCTGG - Intronic
1092807398 12:12237047-12237069 ATAGGCTTCTGGATGGGGGCTGG - Intronic
1092962044 12:13605669-13605691 CTAGGCTTCTTAAAGCGGACAGG - Intronic
1095249784 12:39964889-39964911 CTAAGGTTCTCAAAGGTGGCTGG - Intronic
1095452483 12:42347482-42347504 ATAATCTTTTTGAAAGGGGCGGG + Intronic
1096795636 12:54075944-54075966 GTCAGCTTCTCAAAGGGGTCTGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099134720 12:78881802-78881824 ATCAGCTTCTCAAAGAGAGCTGG - Intronic
1102152004 12:110695110-110695132 ATAAGCATTGAAAAGGGGGCTGG + Intronic
1102947381 12:117001350-117001372 AAAAGCTTCTAGAAGAGGGCAGG - Intronic
1107887490 13:44885855-44885877 ATAAGCAGCTTAAAGTGGCCAGG - Intergenic
1107965870 13:45597795-45597817 ATAAGCTCCTTAAAGATGGGTGG + Intronic
1108566378 13:51702484-51702506 ATAAGCTTCTTAAAGGGGGCTGG + Intronic
1110763100 13:79252337-79252359 ATGAGCATCATAAAGGGGTCAGG + Intergenic
1113147366 13:107222191-107222213 ATAAGCTTCTTAATTGGAGGCGG - Intronic
1113596718 13:111538965-111538987 AGAAGCCTCTCAAAGGTGGCCGG - Intergenic
1114189474 14:20429770-20429792 ATAAGCTTCTAGGAGTGGGCAGG - Intronic
1117501470 14:56356824-56356846 CTGGGCTCCTTAAAGGGGGCGGG + Intergenic
1122156360 14:99752735-99752757 ATCACTTCCTTAAAGGGGGCTGG - Intronic
1126077462 15:44925659-44925681 AGAAACTTCTTAATGGTGGCTGG - Intergenic
1126081253 15:44964863-44964885 AGAAACTTCTTAATGGTGGCTGG + Intronic
1127532206 15:59854461-59854483 ATAAGGTTTTTAAATGGGCCCGG - Intergenic
1127697449 15:61464510-61464532 ATCTGCTTCTTACAGGGGCCTGG - Intergenic
1128183068 15:65621874-65621896 ATAAGCTTCTTAGAGGAGGTGGG + Intronic
1128644484 15:69365402-69365424 ATAAAATTCATAAAGGAGGCTGG - Intronic
1128772029 15:70289988-70290010 ATAAGCTTCGGAATGGGGGGAGG + Intergenic
1129705655 15:77792629-77792651 ATAAGGTTGGAAAAGGGGGCAGG - Intronic
1129775744 15:78235183-78235205 AGAAGCATGTTAAGGGGGGCGGG + Intronic
1130926007 15:88386419-88386441 ATCAGCTTCTTAATGGAGTCTGG - Intergenic
1131407561 15:92177700-92177722 ATAGGTTTCTGAAAGGAGGCAGG + Intergenic
1132071674 15:98783110-98783132 ATAATTTTTTTAATGGGGGCAGG - Intronic
1140732588 16:77870213-77870235 ATAGGCTTCTTATAGAGGACTGG - Intronic
1141089889 16:81122937-81122959 ATCAGCATTTTAAAGGGGGAAGG + Intergenic
1141644416 16:85359577-85359599 GTAAGCTGCTTGAAGAGGGCTGG + Intergenic
1144296339 17:13878570-13878592 ATAAGCTTGTTAATCGGGGCTGG - Intergenic
1145747010 17:27327667-27327689 AAAAGCTTGTTAAAGGTGGATGG + Intergenic
1148723430 17:49771520-49771542 ATAAGCTTCCTAAGGAGAGCAGG + Intronic
1158395257 18:57074599-57074621 ACAACCTAATTAAAGGGGGCAGG - Intergenic
1159438142 18:68444677-68444699 ATAGGCTTGTGAAAGGGGGTGGG + Intergenic
927163639 2:20294590-20294612 ATCAGATTATAAAAGGGGGCAGG + Intronic
927591557 2:24361375-24361397 AGAAGCTTCTTCAAGGGGAAAGG + Intergenic
928615126 2:33030358-33030380 AAGAGCTTCATAAATGGGGCAGG - Intronic
929200081 2:39226017-39226039 TTAAGTTTCTTTAAGGGGTCTGG - Intronic
930165600 2:48200903-48200925 ATAACATTCTTAAAGGGGTGGGG - Intergenic
936589756 2:113792438-113792460 ATATGTTTGTTAAACGGGGCTGG - Intergenic
940878217 2:158920103-158920125 ATAAAATTGTTAAAGGGGGCTGG - Intergenic
940966929 2:159848542-159848564 ATAAGCTTTTTAATGGTTGCTGG - Intronic
943760297 2:191600800-191600822 ATAAGATTCTCAAAGGGATCTGG - Intergenic
944031762 2:195242868-195242890 ATATGCTTATTAAAGGAGTCAGG + Intergenic
944066533 2:195624915-195624937 GTAAACTTCTAAAAGGGGCCGGG + Intronic
944889997 2:204107681-204107703 ATCAGGTTCTTAAAGAGGTCTGG + Intergenic
1169554705 20:6736850-6736872 ATAAGCTTTTTCAAGGGGAGTGG - Intergenic
1171113268 20:22503060-22503082 ATAAGCATTTTATAGGGGACAGG + Intergenic
1173566391 20:44041331-44041353 AGAAGCATGGTAAAGGGGGCGGG + Intronic
1175039386 20:56032519-56032541 ATACACTTCTAAAAGGGGGTGGG + Intergenic
1176991548 21:15503258-15503280 ATAAGCTTCTCAAATCGGGGAGG + Intergenic
1178827662 21:36030174-36030196 ATAAACTGCTTGAAGGTGGCGGG + Intergenic
1179352595 21:40626722-40626744 ATAAGCTTCTTAAAGGCAGAGGG + Intronic
1182879527 22:33721686-33721708 AAAAGCTTATTAAATGGTGCAGG + Intronic
1183700946 22:39450629-39450651 ATCAGATTCTCAAAGGGAGCAGG - Intergenic
955022299 3:55132952-55132974 TTAAACTTGTTAAAGGGGCCAGG - Intergenic
957768764 3:84660405-84660427 AAAACATTCTTAAAGGGGGTGGG - Intergenic
961700333 3:128739211-128739233 ATAAAAGTCTTAAAGCGGGCCGG + Intronic
963941935 3:151104377-151104399 AGAAGTTTTTTAAAGGAGGCTGG - Intronic
969439952 4:7211184-7211206 AAAAGCTTCTCAGAGGTGGCGGG + Intronic
972229250 4:37051889-37051911 ATAAGCTTCCTAAAGGTGGCTGG + Intergenic
974078611 4:57190760-57190782 ATGAGCTACTTAGAGGGCGCAGG + Intergenic
978777340 4:112516687-112516709 ATGAGCTGCTGAAAGGGAGCGGG - Intergenic
979239742 4:118437648-118437670 ATCAGGTTCTTAAAAGGGTCTGG + Intergenic
979249058 4:118545025-118545047 AAAAATTTCTTAAAGGTGGCCGG + Intergenic
982715125 4:158798557-158798579 GTAAACTTCATAAAGGTGGCAGG + Intronic
984508719 4:180653601-180653623 AGAAGCTTCATGAAGGAGGCAGG + Intergenic
986619542 5:9658048-9658070 CTCAGCTTCTGAAAGGTGGCGGG - Intronic
986848357 5:11781423-11781445 ATAAGCTTCCTAAAGGGCGGAGG - Intronic
988288718 5:29256724-29256746 TTATGCTTCTTAAACGGGGTAGG - Intergenic
988556961 5:32245330-32245352 AAAAAATCCTTAAAGGGGGCTGG - Intronic
990166920 5:53004564-53004586 AAGAGCTTCTGGAAGGGGGCTGG - Intronic
991606607 5:68408488-68408510 ACCAGCTTATTGAAGGGGGCGGG - Intergenic
992216115 5:74526229-74526251 ATAAGATTCTCAAAGGAGTCTGG + Intergenic
993255860 5:85589074-85589096 AAGATCTTCTTAAAGAGGGCTGG - Intergenic
995057040 5:107771302-107771324 ATAATGTACTTTAAGGGGGCTGG + Intergenic
1001094240 5:168763745-168763767 ATAAGCTTATTGATGGGGCCAGG + Intronic
1003908382 6:10722553-10722575 AGAAGCATCTTAAAGGGGGATGG - Intergenic
1005813158 6:29531281-29531303 AGAAGCTTCTTAGAGGAGGAGGG - Intergenic
1008534304 6:52495356-52495378 GCAAGCTTCTTGAAAGGGGCTGG - Exonic
1011378083 6:86712255-86712277 CTAAGCTTCTTAGAGGAGGATGG + Intergenic
1012648598 6:101722017-101722039 ATAACCTCATTAAAGGGGGAAGG + Intronic
1013421223 6:109968730-109968752 AAAAGGTTCTGGAAGGGGGCAGG - Intergenic
1015149625 6:130022135-130022157 GTAAGCTTCTTAACTGGGGATGG + Intronic
1017881249 6:158564151-158564173 AGAAACTTCTCAAAGGGAGCAGG - Intronic
1018274572 6:162117149-162117171 AAAAGCTTCTTAAAGTGGGAAGG + Intronic
1020689863 7:11340522-11340544 AAAAGCTACCTAAAGGGGCCAGG - Intergenic
1020711131 7:11606442-11606464 ATAAGCCTCATAAAGGGGCTAGG - Intronic
1021859950 7:24896354-24896376 ATCAGCTTCTCAAAGGTGGGTGG - Intronic
1024607325 7:51032637-51032659 ACAAGCTACACAAAGGGGGCTGG + Intronic
1026745502 7:73008292-73008314 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1026749154 7:73036232-73036254 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1026752802 7:73064377-73064399 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1026756453 7:73092503-73092525 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1026931115 7:74223549-74223571 ATGAGCTTCCTAATGGGTGCTGG - Intronic
1027031614 7:74892966-74892988 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1027090952 7:75300919-75300941 ATAAAACTCTTAAAGTGGGCTGG - Intergenic
1027094597 7:75328891-75328913 ATAAAACTCTTAAAGTGGGCTGG - Intergenic
1027098238 7:75356818-75356840 ATAAAACTCTTAAAGTGGGCTGG - Intergenic
1027324744 7:77038789-77038811 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1029399350 7:100333718-100333740 ATAAAACTCTTAAAGCGGGCCGG - Intergenic
1030312042 7:108078731-108078753 AAAAGCTTTTTAAAGGTGTCAGG + Intronic
1030535341 7:110759401-110759423 ATAAATTTCTGAAAGGAGGCTGG + Intronic
1031581393 7:123478924-123478946 AGAAGCTCCTTAAAGGGATCTGG + Intronic
1031947400 7:127856574-127856596 ATTAGCTTCATAAAGGGAGGTGG + Intronic
1035834006 8:2728466-2728488 TTACAGTTCTTAAAGGGGGCGGG - Intergenic
1038251006 8:25904210-25904232 ACCAGATTCTTAAAGGGGTCTGG + Intronic
1038974504 8:32678280-32678302 ATAAGCTACTTAAAAAGGACAGG + Intronic
1043963104 8:86440524-86440546 ATAAGGTTCTTACAAGGGGCTGG - Intronic
1046557346 8:115791006-115791028 CTCAGCTTCTGAAATGGGGCAGG + Intronic
1047852577 8:128874571-128874593 GGAGGCTTCTTAAACGGGGCGGG - Intergenic
1052830015 9:33207406-33207428 CTGAGGTCCTTAAAGGGGGCAGG + Intergenic
1057581361 9:96290285-96290307 ATAAGCTTCTGGAAGGGCGGAGG + Intronic
1059152969 9:111965905-111965927 ATAAACAACTTAAAGGTGGCCGG + Intergenic
1059368104 9:113802735-113802757 ATAAAACTCTTAAAAGGGGCTGG + Intergenic
1060263760 9:122097353-122097375 ATCTGCTTCTTCAAGAGGGCAGG + Intergenic
1060368296 9:123042904-123042926 AAAAGCTTCTTGAATGGGGTGGG + Intronic
1060757086 9:126222235-126222257 CTCAGCTTTTTAAAGGGGGTTGG - Intergenic
1061938189 9:133870235-133870257 AGAAGTTTCTTCTAGGGGGCCGG + Intronic
1189917951 X:45875552-45875574 AAAAGCTTCTCATAGGAGGCAGG + Intergenic
1193238590 X:79139168-79139190 ATCAGATTCTTAAAGGAGTCTGG - Intergenic
1197209495 X:123817174-123817196 AGAAGGTTCTTATTGGGGGCTGG + Intergenic
1198512928 X:137372445-137372467 AGAAGCTTCTTAGAGGAGGTAGG - Intergenic
1202387483 Y:24339478-24339500 ATCAGGTTCTTAAAAGGGTCTGG + Intergenic
1202483303 Y:25330650-25330672 ATCAGGTTCTTAAAAGGGTCTGG - Intergenic