ID: 1108567958

View in Genome Browser
Species Human (GRCh38)
Location 13:51719920-51719942
Sequence CACCATGAGCATGAGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108567958_1108567961 -4 Left 1108567958 13:51719920-51719942 CCAGGGTCCTCATGCTCATGGTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1108567961 13:51719939-51719961 GGTGAATCCTTGCTGATGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 112
1108567958_1108567963 21 Left 1108567958 13:51719920-51719942 CCAGGGTCCTCATGCTCATGGTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1108567963 13:51719964-51719986 ATGCTCACAGCTGCCCGACTAGG 0: 1
1: 0
2: 0
3: 9
4: 107
1108567958_1108567960 -5 Left 1108567958 13:51719920-51719942 CCAGGGTCCTCATGCTCATGGTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1108567960 13:51719938-51719960 TGGTGAATCCTTGCTGATGCTGG 0: 1
1: 0
2: 2
3: 12
4: 124
1108567958_1108567964 27 Left 1108567958 13:51719920-51719942 CCAGGGTCCTCATGCTCATGGTG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1108567964 13:51719970-51719992 ACAGCTGCCCGACTAGGCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108567958 Original CRISPR CACCATGAGCATGAGGACCC TGG (reversed) Intronic
902555496 1:17244368-17244390 CACCATGGGCACCAGGACACAGG + Exonic
902850840 1:19154952-19154974 CACCATCAGCAGGACAACCCTGG - Exonic
906078547 1:43069030-43069052 GGCCATGAGCAGGGGGACCCTGG - Intergenic
906144249 1:43550493-43550515 AACCAGGAGGATGAGGACCGCGG - Intronic
907445706 1:54506492-54506514 CACCATGGACATGAAGAGCCTGG + Intergenic
911527460 1:99004432-99004454 TACCACGAGCACGGGGACCCCGG + Exonic
917927172 1:179798933-179798955 CACCCTGAGTGTGAGGACTCTGG + Intronic
918772526 1:188580234-188580256 TACAATGAGCATGGGGAACCAGG + Intergenic
920415208 1:205794978-205795000 CACGAGGAGGAAGAGGACCCGGG + Exonic
921130292 1:212214047-212214069 CATTATGAGCCTGAGGAGCCTGG - Intergenic
921163649 1:212490777-212490799 CCCCATGAACAACAGGACCCTGG - Intergenic
922452880 1:225750913-225750935 CTCCATGGGCATGTGGAGCCTGG - Intergenic
924479682 1:244417306-244417328 CACCATGAGCATGTACAGCCGGG - Intronic
924803568 1:247345326-247345348 CACCATGGGCATGGGGATTCTGG - Intergenic
1063914925 10:10871729-10871751 CACCAGCAGCACGAGGACCCAGG + Intergenic
1065309456 10:24400426-24400448 TTCCATCAGCATGGGGACCCTGG - Intronic
1065340015 10:24695924-24695946 GACCCTGAGCTGGAGGACCCAGG + Intronic
1066236509 10:33490138-33490160 CACCCTGACCATTAGGAGCCAGG - Intergenic
1066258829 10:33708796-33708818 CACCATCAGCATGAACACGCAGG + Intergenic
1066457071 10:35581684-35581706 CACCATGAGAAGGTGGCCCCTGG - Intergenic
1067474734 10:46557657-46557679 CACTATGAGGCTGAGGACCTGGG + Intergenic
1068673059 10:59743470-59743492 CACCATGAGGAACAGGAACCAGG + Intergenic
1070720319 10:78752463-78752485 GACCATGACCAGGAGGAGCCGGG + Intergenic
1070897324 10:79995983-79996005 CTCCATCAGCCTGAGAACCCAGG + Intergenic
1071600209 10:86955315-86955337 CAGCCTGAGCATTAGGACTCCGG - Intronic
1072550246 10:96471769-96471791 GACCATGGGCATCAGGACCTTGG - Intronic
1072727533 10:97823832-97823854 CACCAGGAGCAAGAGGCCACTGG + Intergenic
1073443923 10:103569820-103569842 CACCCTGTGCATGAGCCCCCGGG - Intronic
1074007586 10:109443802-109443824 GACTCTGAGCATAAGGACCCAGG - Intergenic
1074223598 10:111462085-111462107 GACCACAAGCATGGGGACCCTGG - Intergenic
1075574639 10:123569814-123569836 CACCCTGAGCATGGAGCCCCCGG - Intergenic
1075671174 10:124265037-124265059 CACCATGACAGTGAGGTCCCCGG + Intergenic
1076451795 10:130561420-130561442 CACCCTGAGAATGGGGTCCCAGG - Intergenic
1077137760 11:1009650-1009672 AAACAGGAGAATGAGGACCCTGG - Intronic
1077197948 11:1290807-1290829 CCCCCGGAGCATGATGACCCGGG + Intronic
1077234847 11:1476006-1476028 CAACCTGAGCACGAGCACCCTGG + Intronic
1078762021 11:14259338-14259360 CGGCATGGGCATGAGGTCCCGGG + Exonic
1084319583 11:68365959-68365981 CACCAAGTGCCTGAGGACCAAGG - Intronic
1084615181 11:70231114-70231136 CACCAGGAGCATGAGGGACCAGG + Intergenic
1085018387 11:73189978-73190000 CACCATGAGAACCAGGAACCAGG - Intergenic
1089177227 11:116557641-116557663 CACCATGCACCTGAGGAGCCTGG + Intergenic
1091356310 11:134940639-134940661 CAGCAAGAGCATGAGGGTCCTGG - Intergenic
1095970867 12:47901300-47901322 CATCTGGACCATGAGGACCCAGG + Intronic
1099251324 12:80258672-80258694 CTCCATGAGGATGAGAACCATGG - Intronic
1101802331 12:108033324-108033346 AACCAAGAGCATCAGGCCCCAGG - Intergenic
1102278668 12:111601093-111601115 GAGCATGGGCATGAGGATCCTGG + Intergenic
1104163013 12:126198979-126199001 CACCCTGAGAGTGAGGACCTGGG - Intergenic
1105281493 13:18965185-18965207 CACCTTGAGCATGTGGTACCAGG + Intergenic
1108567958 13:51719920-51719942 CACCATGAGCATGAGGACCCTGG - Intronic
1118336986 14:64861905-64861927 CACAATGAGGATGAAGAGCCAGG - Intronic
1122064968 14:99166521-99166543 CACCAGGAAAATGAGGACCAGGG - Intergenic
1123125256 14:105941491-105941513 CACCATCAACAGGAGGACACAGG - Intergenic
1125203779 15:37127842-37127864 CAAAATGAGCATGAGGTCCAAGG - Intergenic
1127831730 15:62756980-62757002 CACCAGGATCATGGGGAACCTGG - Intronic
1128390567 15:67179910-67179932 CAACTTGACCATGAGGTCCCAGG - Intronic
1128660560 15:69497890-69497912 CCCCATCAGCATGAGGCCCCAGG + Intergenic
1129180126 15:73868935-73868957 CACCCTCAGGATGAGGACGCTGG + Intergenic
1129824157 15:78623741-78623763 CACCATCACAATCAGGACCCAGG - Intergenic
1129887186 15:79046894-79046916 CAGCATGCGCAAGAGGAACCAGG - Exonic
1130062194 15:80578105-80578127 CCCCATGAACATGAGCACCCAGG - Intronic
1131068326 15:89448386-89448408 CATGATGGGCATGAGGACCCAGG - Intergenic
1134368435 16:13600962-13600984 CACCATGAGGACAAGGACCATGG - Intergenic
1136188894 16:28603931-28603953 CACCAGGAGCATGAGGGGGCAGG - Intergenic
1139921222 16:70461666-70461688 CCCCATCAGCTTGAGGAGCCTGG + Intronic
1141486449 16:84343365-84343387 TACGAAGACCATGAGGACCCCGG - Intergenic
1141946947 16:87317181-87317203 CACCATCATCATGAGGCCACTGG - Exonic
1142218099 16:88839695-88839717 CACCATGTGCGGGAGGAGCCTGG + Intronic
1142236248 16:88923955-88923977 CACCCTCAGCATGAGATCCCAGG - Intronic
1144067654 17:11639080-11639102 CAGCAGGAGGAAGAGGACCCTGG - Intronic
1144072871 17:11690065-11690087 CACTATGAGGATGAGGTCCGGGG + Exonic
1147689783 17:42308124-42308146 CACCAGCAGCAGGAGGACCAAGG - Intronic
1150361087 17:64534707-64534729 AATGATGAGAATGAGGACCCGGG + Exonic
1150601663 17:66656190-66656212 CACCATGAGCATGGATACCAGGG - Intronic
1151460326 17:74250352-74250374 CACAAGGTGCATGGGGACCCTGG + Exonic
1151552483 17:74830104-74830126 GAACATGAGCATCAGGGCCCTGG + Intronic
1151808077 17:76419144-76419166 GACCATGAGCATGAGCCACCAGG - Intronic
1152018971 17:77770629-77770651 CACCATGGGCTTGAGAATCCTGG - Intergenic
1152720130 17:81919448-81919470 CACCAGGAGAGTGAGGCCCCTGG - Exonic
1153811959 18:8759911-8759933 CCCCATGAGCATGAGCCCCTGGG - Intronic
1162259820 19:9523515-9523537 CACCATTATCTTGAGGTCCCAGG + Intergenic
1162879484 19:13647536-13647558 CACCATTAGCATGAGAGCCAAGG + Intergenic
1165075084 19:33276060-33276082 CACCCTGATCAGGGGGACCCAGG - Intergenic
1165408403 19:35643951-35643973 GACCAAGGGGATGAGGACCCAGG + Intronic
1166718625 19:44985017-44985039 CCCCATGATCATGAGGAACTGGG + Intronic
1166750842 19:45163385-45163407 AACCAGGAGCATGAGGGCCACGG + Intronic
1167741245 19:51326119-51326141 GACCCTGAGAATGAGGATCCAGG - Intronic
925127657 2:1471867-1471889 CACCATGAACATCAGGATCATGG - Intronic
925127663 2:1471898-1471920 CACCATGAGCATCAGGATCATGG - Intronic
925127706 2:1472305-1472327 CACCATGAGCATTTGGATCAAGG - Intronic
925722413 2:6841916-6841938 CGGCATGAGCATGAAGAACCAGG + Intronic
927018353 2:18991869-18991891 TGCCATGAGCATATGGACCCTGG + Intergenic
927173088 2:20386853-20386875 CACCATCAGCAGGAGGATGCTGG - Intergenic
932327179 2:70871112-70871134 CACCAGGAGGATCAGGAGCCAGG - Intergenic
934772197 2:96914137-96914159 CCCCATGAGTATGAGCTCCCTGG - Intronic
935267980 2:101410831-101410853 CACAATGAGCATGAGGCCCTGGG - Intronic
936971676 2:118182563-118182585 CACCATGCTCATGAGGAGTCAGG + Intergenic
944973198 2:205017637-205017659 CTAGATGAGCATGAGAACCCTGG - Intronic
947858631 2:233342305-233342327 CACCCTCAGCCTGAGGACCCAGG + Exonic
948150968 2:235744399-235744421 GGCCAGGAGCATGAGGACCGCGG + Intronic
1168831486 20:847459-847481 CTCCTTCAGCATGGGGACCCTGG - Intronic
1169760763 20:9091055-9091077 CACCAAGACCCTGGGGACCCTGG - Intronic
1171210942 20:23316529-23316551 AACCCTGAGCCAGAGGACCCCGG + Intergenic
1173793153 20:45841068-45841090 CACCAGGAGCTGGAAGACCCTGG + Exonic
1173819022 20:46008943-46008965 CACCAGGAGCACCAGGACCAGGG - Exonic
1174453466 20:50633759-50633781 CACACTGAGCAGGAGGACCTGGG - Intronic
1175175269 20:57108041-57108063 CTCCATGAGGACGAGGACGCGGG - Intergenic
1179478384 21:41662343-41662365 CACCATGAGCCTGGGAGCCCTGG - Intergenic
1179838396 21:44053153-44053175 CACCATAAGCATGGTGACCATGG - Intronic
1181467689 22:23118903-23118925 CACCAAGGGCAGGAGGACCCAGG + Intronic
1181805820 22:25373909-25373931 CACCAAGTGCCTGAGGACCAAGG + Intronic
1181971967 22:26697611-26697633 CACCATGAGACTGGGGTCCCTGG + Intergenic
1183521539 22:38298580-38298602 CACCATGGGCAGCAGGGCCCAGG - Intronic
1184067255 22:42127861-42127883 GATCATGAGCAGGAGGCCCCAGG + Exonic
1184069978 22:42141553-42141575 GATCATGAGCAGGAGGCCCCAGG + Intergenic
1184071729 22:42151163-42151185 GATCATGAGCAGGAGGCCCCAGG + Intergenic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
952759216 3:36899029-36899051 CCCCATGAGCCTGAGTCCCCAGG + Intronic
953646630 3:44761584-44761606 TACCATGAGCAAGCGGAACCAGG - Exonic
954328672 3:49877536-49877558 CTTCAGGAGCATGGGGACCCTGG - Intergenic
954400345 3:50316334-50316356 CACCATGGCCATGAGCACCTGGG + Intergenic
960417074 3:117397856-117397878 CATCCAGAGCATGCGGACCCTGG - Intergenic
964641421 3:158913601-158913623 CAGCATGAGCATGGGGTACCAGG + Intergenic
967436636 3:189455244-189455266 CACCCTGAGCATGAGGACCAGGG - Intergenic
968130303 3:196189208-196189230 TAGCAGGAGCATGAGGACCAAGG + Intergenic
968460230 4:721082-721104 ACCCATGAGGCTGAGGACCCTGG + Intronic
969498896 4:7541275-7541297 CACCCTGAGCTTGAGCACCATGG - Intronic
970892762 4:21066762-21066784 CACCATGGGCAAAAGGACTCTGG + Intronic
971820912 4:31553955-31553977 CAACATGGGCATAAGGACACGGG - Intergenic
972309382 4:37865893-37865915 TACCTTGAGCATGAGCACCATGG - Intergenic
972783953 4:42310234-42310256 CAGCATGAGACTAAGGACCCTGG - Intergenic
977130225 4:93226786-93226808 CACAAAGAGCATGAAGACTCAGG - Intronic
977910024 4:102523621-102523643 CACCACCAGCATGAGCAGCCTGG + Intronic
983076018 4:163328556-163328578 CAACAGGTGAATGAGGACCCTGG + Intronic
985274144 4:188221213-188221235 AACCATGAGAATGTGGATCCAGG + Intergenic
985671750 5:1210359-1210381 CACTCTGAGCAGGAGGTCCCAGG - Intronic
986222021 5:5776500-5776522 GCCCAGGAGGATGAGGACCCAGG + Intergenic
988693508 5:33596097-33596119 GACCATGAGCATGTGGGCTCAGG - Intronic
989639343 5:43568019-43568041 CAGCATGAGCATGAAGTACCAGG - Intergenic
993570604 5:89534152-89534174 GACCCTGAGAAGGAGGACCCTGG - Intergenic
993671561 5:90766788-90766810 CAGCATGAGCCTGAGAACCTTGG + Intronic
993870818 5:93252293-93252315 CACCATCACCATGAGAACACAGG - Intergenic
996795153 5:127337773-127337795 AAACGTGATCATGAGGACCCAGG + Intronic
999079228 5:148827280-148827302 CACCATCAGAATGATCACCCGGG - Exonic
999295546 5:150457582-150457604 CAGGTTGAGCTTGAGGACCCAGG - Intergenic
1001890301 5:175332870-175332892 CACCATTAGCCTCAGGACTCAGG + Intergenic
1002047963 5:176552689-176552711 CATCATGATCATGAGGAGGCAGG + Intronic
1002971526 6:2027110-2027132 CTCCATGAAGAAGAGGACCCTGG + Intronic
1003879937 6:10470897-10470919 CCCCATGGGAATGAGGACCAGGG - Intergenic
1004276866 6:14244346-14244368 CAGAATGAGGATTAGGACCCAGG + Intergenic
1004482395 6:16033310-16033332 CAACATGAGGAAGAGGCCCCAGG + Intergenic
1006742656 6:36320488-36320510 CTCCTTGTGCCTGAGGACCCAGG - Intronic
1011254585 6:85407485-85407507 CACCATGGGCAGGAGAACACAGG - Intergenic
1014048112 6:116917643-116917665 CACCATGAGGAGGAGAAACCAGG - Intronic
1014198638 6:118585246-118585268 CAGCATGAGCATGGAGAACCAGG - Intronic
1014667657 6:124259308-124259330 AACCATGAGGATGAGGGGCCTGG + Intronic
1014830415 6:126096596-126096618 CACCATGGGCATTAGGGCACTGG + Intergenic
1017746880 6:157455196-157455218 CTGCATGGGCAGGAGGACCCAGG + Intronic
1018945808 6:168346071-168346093 AGCTATGAGCATGAGGAGCCAGG + Intergenic
1018987655 6:168649830-168649852 CACCCTGGGCATAAGGACACGGG + Intronic
1019186438 6:170223327-170223349 CTCCATGGGCATGGGGACCAGGG - Intergenic
1019704111 7:2489385-2489407 CCCCATGAGCCAGAGGACACTGG + Intergenic
1024150833 7:46569702-46569724 CATCATGAGGATGTGGACCTGGG + Intergenic
1025281344 7:57628039-57628061 CACCTGGAGCATGATGTCCCAGG - Intergenic
1025303385 7:57837468-57837490 CACCTGGAGCATGATGTCCCAGG + Intergenic
1026899314 7:74028219-74028241 CAGCAGGAGCAGGAGGACTCCGG - Exonic
1027269667 7:76512676-76512698 CACCAGCAGCCTGAGGACCCAGG - Intronic
1027320377 7:77006570-77006592 CACCAGCAGCCTGAGGACCCAGG - Intergenic
1033556886 7:142495869-142495891 CACCCTGAGTTAGAGGACCCTGG - Intergenic
1038318499 8:26508093-26508115 CACTATGTGCATGAGGTCCAGGG + Exonic
1039262516 8:35787385-35787407 CATCATGAGAATGATGACCATGG - Intronic
1039550533 8:38439988-38440010 CTCCATGAGCATGATGTCTCAGG + Intronic
1039947433 8:42142083-42142105 CACCATGGGAATGAAGACCGAGG + Intergenic
1047834205 8:128670376-128670398 TACTATGAGAATGAGGATCCGGG - Intergenic
1050577407 9:7011653-7011675 TACCATGAGCATGGGAACCAGGG - Intronic
1056389948 9:86131729-86131751 CTCCATGACCATCAGGAACCTGG - Intergenic
1056839353 9:89986118-89986140 CACCATGACCATTAGCACCCTGG - Intergenic
1058082982 9:100718777-100718799 CACCATGTGCATGAGGAAACTGG + Intergenic
1060009227 9:120028785-120028807 CACCATCCACATGAGAACCCAGG + Intergenic
1062115408 9:134805747-134805769 CCCCATGGGCATGGGGGCCCTGG + Intronic
1062290040 9:135790322-135790344 CAGCCTCAGCATGAGGCCCCTGG + Intronic
1062714990 9:138005157-138005179 TGCCATGAGCATGAGGAGGCAGG - Intronic
1187365164 X:18660818-18660840 CACAAGGGGCTTGAGGACCCAGG + Intronic
1190539178 X:51459488-51459510 CAGCATGAGCATGGAGAACCAGG - Intergenic
1191598115 X:62970170-62970192 CCCTATGAGCATGAGGTCCAGGG - Intergenic
1191995348 X:67089336-67089358 CACCATGATCACTAGCACCCAGG - Intergenic
1192052977 X:67744171-67744193 CACCAAGATCTTCAGGACCCTGG + Intergenic
1195967263 X:110439859-110439881 CAGCATGAGCATGAGTAAGCCGG + Intronic
1196275790 X:113763919-113763941 TTCCATGAGCATGAGCAGCCTGG - Intergenic
1198521990 X:137462214-137462236 GACCTTGAGCCAGAGGACCCAGG + Intergenic
1201292424 Y:12433786-12433808 CCCAAAGAGCAAGAGGACCCTGG - Intergenic
1201337297 Y:12894679-12894701 CACCATGGGCATGAAGACCCAGG - Intergenic