ID: 1108568947

View in Genome Browser
Species Human (GRCh38)
Location 13:51730447-51730469
Sequence CGTAAAGAGAAGGGGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108568947 Original CRISPR CGTAAAGAGAAGGGGATCCA GGG (reversed) Intronic
900011518 1:114741-114763 CTTAAATAGGAGGGGAGCCATGG - Intergenic
900027621 1:291305-291327 CTTAAATAGGAGGGGAGCCATGG - Intergenic
900041579 1:470747-470769 CTTAAATAGGAGGGGAGCCATGG - Intergenic
900063013 1:705724-705746 CTTAAATAGGAGGGGAGCCATGG - Intergenic
902886525 1:19408628-19408650 CATCAACAGAAGGGTATCCATGG + Intronic
903604529 1:24566039-24566061 AGGAAGGAGAAGGGGAACCAAGG - Intronic
906693524 1:47809052-47809074 CGTGCAGAGGAGGGGATCCTGGG - Intronic
907367352 1:53973382-53973404 CTTAAAGAGAATGGGAGACAAGG + Intergenic
907640930 1:56189686-56189708 AGAAAAGAGAAGGGGAGACAGGG - Intergenic
910696183 1:90018455-90018477 CATATAGAGAAAGGGATCAAAGG - Intronic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
917442069 1:175077150-175077172 GGTGAAGAGAAGGGCATCCTGGG + Intronic
917698642 1:177556573-177556595 GGTAAAGAGCAGGGGAGCAAAGG + Intergenic
920954810 1:210608913-210608935 CGGAAGGCGAAGGGGATGCAAGG + Intronic
921623648 1:217354206-217354228 TGGAAGGAGAAGGGGAACCAAGG - Intergenic
922259958 1:223930749-223930771 CTTAAATAGGAGGGGAGCCATGG - Intergenic
924341122 1:243033308-243033330 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1063028310 10:2205287-2205309 TGTAAAGAGAAGCAGATCCTTGG - Intergenic
1063028371 10:2206066-2206088 TGTAAAGAGAAGCAGATCCTTGG + Intergenic
1064181561 10:13120905-13120927 CGGAAAGCGAAGGGGAAGCAAGG + Intronic
1066043253 10:31573802-31573824 TGTAAAGGGCAGGGGTTCCACGG + Intergenic
1066735348 10:38472099-38472121 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1068068625 10:52167226-52167248 CATGAAGAGAAAGGGATCAAGGG + Intronic
1070826447 10:79393027-79393049 AGTAAGGAGAAGGAGAACCAGGG - Intronic
1072593248 10:96846833-96846855 CCTAAGGAGAAGGGGACCAAAGG - Intronic
1076967853 11:106975-106997 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1077353329 11:2103145-2103167 AGGAGAGAGAAGGGGATGCAGGG - Intergenic
1077587848 11:3467920-3467942 CTTTAAGATAAGGGGATACAAGG - Intergenic
1077818138 11:5708267-5708289 CTTAAAGGTAAGGGGATTCAGGG + Exonic
1077880114 11:6342528-6342550 CATAAAGAGAAGGGGACCGGAGG - Intergenic
1078690608 11:13576437-13576459 AGAAAAGATAAGGGAATCCAGGG + Intergenic
1081315693 11:41626465-41626487 CGTAAGGTGAAGGGGAAGCAAGG + Intergenic
1084243549 11:67839573-67839595 CTTTAAGATAAGGGGATACAAGG - Intergenic
1084415429 11:69029694-69029716 CTTATAGAGAAGGGGATTCAAGG + Intergenic
1089053962 11:115569654-115569676 CTGAAAGTGATGGGGATCCATGG + Intergenic
1090376680 11:126294419-126294441 AGTGAAGAGATGGGAATCCAGGG + Exonic
1094297566 12:28925577-28925599 GGTAAAGACAAGGTAATCCAAGG + Intergenic
1094731728 12:33184391-33184413 AGTAAACAGAAGGGGACTCAAGG - Intergenic
1095342604 12:41109454-41109476 CTTAATGAGAAGTGGATGCAGGG - Intergenic
1096024615 12:48350516-48350538 AGTGAAGAGAAAGGGAGCCACGG + Exonic
1099245718 12:80191054-80191076 GGTAAAGAGAAGGTGGTCTAAGG - Intergenic
1099457436 12:82880818-82880840 TGAAAAGAGAAGTGGATGCAGGG + Intronic
1099961018 12:89396996-89397018 TGTCAAGAGAAGGGGAGGCAAGG + Intergenic
1108114528 13:47112284-47112306 CCCAAAGAGAACAGGATCCATGG - Intergenic
1108568947 13:51730447-51730469 CGTAAAGAGAAGGGGATCCAGGG - Intronic
1108771624 13:53708981-53709003 GATAAAGAAAAGGGGATACAAGG + Intergenic
1111231705 13:85353045-85353067 CGTCAAGGGAAGGGGTTCCATGG - Intergenic
1112193997 13:97207057-97207079 AGGAAAGGGAAGGGGATCCAAGG - Intergenic
1114265251 14:21069829-21069851 CGTTGAGAGAAGAGGATCCCGGG + Intronic
1115420775 14:33192529-33192551 CATAAGAAGAAGGGGTTCCAAGG - Intronic
1121976225 14:98406409-98406431 CATATAGGGAAGAGGATCCAGGG + Intergenic
1124495062 15:30181320-30181342 ACTCAAGAGAAGGGGAGCCAGGG + Intergenic
1124748507 15:32357325-32357347 ACTCAAGAGAAGGGGAGCCAGGG - Intergenic
1126680848 15:51200844-51200866 CGTGAAGAGAAGAGGACCAAAGG + Intergenic
1130284047 15:82540786-82540808 CGAGAAAAGAAGGCGATCCAGGG + Intronic
1131361451 15:91794507-91794529 TGTAAAGCGAAGGGGAAGCAAGG - Intergenic
1131936018 15:97505884-97505906 GGTAAAGGGAAGGGAATCTAAGG - Intergenic
1138713978 16:59000706-59000728 GATAAAGAGAAAGGGATCAAGGG - Intergenic
1139016321 16:62693218-62693240 CTGAAAGAGAAGGGGTTTCATGG - Intergenic
1139519061 16:67469569-67469591 TGTAAAGAGAAGTGGCTTCATGG + Intronic
1139847728 16:69932601-69932623 CCTTAAGAGGAGGGGATCCCAGG - Intronic
1142452827 16:90192164-90192186 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1146402534 17:32511150-32511172 CGTGAAGAGAAGGGGAGGAAAGG - Intronic
1146791333 17:35752465-35752487 CGAAAGGAGATGGGCATCCAAGG - Exonic
1152262548 17:79274875-79274897 CGTAGAGAGAAGGGGATTTGGGG - Intronic
1154122855 18:11665558-11665580 AGTAAAGAGAATGGGCTCGAAGG + Intergenic
1157710578 18:49847202-49847224 CGGAAAGAGAAGGATTTCCAGGG - Exonic
1158873201 18:61708890-61708912 GGTAAAGAGGAGGGGATGAAGGG - Intergenic
1159577460 18:70197175-70197197 AGTAGAGAGAGAGGGATCCAGGG - Intronic
1160644658 19:176598-176620 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1162561631 19:11421000-11421022 GGTAAAGGGAAGGGGAGCCAGGG - Intronic
1166543821 19:43622714-43622736 GGTAGAGAGAAGGGGAGCCCAGG + Exonic
1167041833 19:47027320-47027342 GGCAGAGAGAGGGGGATCCAGGG - Intronic
1167041868 19:47027410-47027432 CGCAGAGAGAGGGGGACCCAGGG - Intronic
1167745917 19:51351811-51351833 CGGAGAGAGATGGGGATCCCAGG - Intronic
927229973 2:20812322-20812344 CATATAGAGAAGGGAATCCAGGG - Intronic
927289503 2:21392046-21392068 TGCAAAGATATGGGGATCCAGGG - Intergenic
927791249 2:26011482-26011504 CCTTAAGAGAAGGGAAACCAAGG + Intergenic
928469870 2:31563527-31563549 GGTACAGGGAAGGGGATCCCAGG + Intronic
931264251 2:60646540-60646562 AGTAAAGAGAAGGGTGTCCATGG + Intergenic
933761279 2:85673911-85673933 CGTAAAGAAAAGGGAATTCGAGG - Intergenic
936050131 2:109216278-109216300 CTTAAAGGGAAGGGGATTAAAGG + Intronic
936583381 2:113727186-113727208 CGTAAGGTGAAGGGGAAGCAAGG - Intronic
942045490 2:172097112-172097134 GGCAAAGAGAAGGGGTTGCAAGG - Intergenic
943317290 2:186405802-186405824 CTTAAAGAGAAGAGGATTCCTGG - Intergenic
946162092 2:217841533-217841555 CAGGAAGAGAGGGGGATCCAAGG + Intronic
947832007 2:233148167-233148189 GGGCAAGACAAGGGGATCCAGGG + Intronic
949084267 2:242136825-242136847 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1175255952 20:57647324-57647346 CTTTGAGAGAAGGGGATCCCAGG + Intergenic
1176280850 20:64309309-64309331 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1177106173 21:16958247-16958269 CGTAAAGAGAACTGGCTGCATGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179143956 21:38751534-38751556 CGGAAGGAGAAGGGGAAGCAAGG - Intergenic
1182475112 22:30572991-30573013 CATTAAGGGAAGGGGATGCATGG + Intronic
1184987660 22:48146468-48146490 CATTAAGAGAAGGGGTTCCTGGG - Intergenic
952405275 3:32999585-32999607 CATCCAGGGAAGGGGATCCAGGG - Intronic
954941327 3:54375759-54375781 CAGAAAAAGAATGGGATCCAGGG + Intronic
955094291 3:55782002-55782024 TGTAGAGAGAAGGGGATCTGAGG + Intronic
955985742 3:64572583-64572605 ACTAAAGAGAATGGGATCCCTGG + Intronic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
956776870 3:72572419-72572441 AGACAGGAGAAGGGGATCCAGGG - Intergenic
960357816 3:116675165-116675187 TGAAAAGAGAAGGTGATCCATGG + Intronic
965404990 3:168256943-168256965 CAGAAAGTGAAGGGGAACCAAGG + Intergenic
968255583 3:197267342-197267364 CCAAAAGAGAAAAGGATCCAAGG - Intronic
968293862 3:197558490-197558512 GGGAAAGAGAATGGCATCCAAGG - Intronic
968880278 4:3295011-3295033 TGCAAAGAGGAGGGAATCCAGGG + Intronic
969750990 4:9110785-9110807 CTTTAAGATAAGGGGATACAAGG + Intergenic
972549554 4:40117170-40117192 CGGAAAGAGAAGAGAATGCATGG - Intronic
974929858 4:68349750-68349772 CGGAAACCGAAGGGGAGCCATGG - Exonic
976703670 4:87999374-87999396 CGGAAGGAGAAGGGGAAGCAAGG + Intergenic
976868710 4:89764027-89764049 CAGAAACAGATGGGGATCCAAGG + Intronic
979261702 4:118655063-118655085 CTTAAATAGGAGGGGAGCCATGG + Intergenic
979762283 4:124421068-124421090 CGTAAAGAGAATCGGAAGCAAGG + Intergenic
989639234 5:43567100-43567122 AGTAAGGAGAAGGGGATGAAGGG - Intergenic
989781453 5:45269878-45269900 CGTACAAAGAACGGGAGCCAAGG - Intronic
991622673 5:68561624-68561646 CGTAGAGAGAGGGGTCTCCAAGG - Intergenic
1002732266 5:181348182-181348204 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1002752272 6:125923-125945 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1005886015 6:30098328-30098350 TGTCAAGAGATGGAGATCCACGG - Intergenic
1011653599 6:89529794-89529816 GGGAGAGAGAAGGGGAACCAGGG + Intronic
1013466140 6:110418614-110418636 AGGAAAGAGAAGGGGGTTCATGG + Intergenic
1017556809 6:155580462-155580484 CATAAAGAGAAGAGAATTCAGGG + Intergenic
1019236518 6:170620497-170620519 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1022425336 7:30263435-30263457 CGTAAAGAGAAGGGAAGGGAAGG - Intergenic
1027542144 7:79480118-79480140 CATAAAGAGAAAGAGATGCATGG - Intergenic
1028064375 7:86363774-86363796 AGTAAAAATTAGGGGATCCAGGG + Intergenic
1029409877 7:100402228-100402250 TGTAAAGAGAAGAAGATCCAGGG - Intronic
1029529915 7:101118503-101118525 GGTAAAGAGAAGTGGATGGAGGG + Intergenic
1032611628 7:133421426-133421448 CGTAAAGAGATTAGAATCCAAGG + Intronic
1035511253 8:186111-186133 CTTAAATAGGAGGGGAGCCATGG - Intergenic
1035606994 8:936257-936279 AAGAAAGAGAAGGGGACCCAAGG + Intergenic
1036374194 8:8186186-8186208 CTTTAAGATAAGGGGATACAAGG + Intergenic
1037776288 8:21838120-21838142 CATAAATAGAAGTGGATTCAGGG - Intergenic
1038198247 8:25387770-25387792 CGTAAAGAGAAGGGGTGCGAAGG - Intronic
1039669169 8:39577238-39577260 CAGAAAGACAAGGGGCTCCAAGG + Intergenic
1045917463 8:107489669-107489691 TGTAAAGAGAAGATAATCCATGG + Intronic
1046293559 8:112193662-112193684 TGAAAAGAGAAGGGGATGGAGGG + Intergenic
1047872148 8:129095920-129095942 TGGAAAGAGAAGGGGAAGCAAGG - Intergenic
1049393224 8:142382652-142382674 CATAAGGAGGAGGGGACCCATGG + Intronic
1052340273 9:27358108-27358130 CATAAAGAGAAAGGGATAAAGGG + Intronic
1053043015 9:34890718-34890740 CATAAAAACAAGGGAATCCAGGG - Intergenic
1060318851 9:122536577-122536599 TGTAAAGAAAAGGGAAGCCAGGG - Intergenic
1062756668 9:138300508-138300530 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1187231219 X:17425161-17425183 TTTGAAGAGAAGGGAATCCAAGG - Intronic
1188717357 X:33476648-33476670 GGTGAAGAGGAGGGGGTCCAAGG - Intergenic
1189699881 X:43707343-43707365 CATAGAGAAAAGGGCATCCACGG + Intronic
1190291738 X:48997552-48997574 GGTAGAGAGAAGGGAATACAGGG + Intronic
1191062224 X:56310682-56310704 GGTGAAGAGCAGGGGATCGAGGG + Intergenic
1192277801 X:69651006-69651028 TGTAAAGGCAGGGGGATCCATGG + Intronic
1193851230 X:86539265-86539287 CAGAAAGTGAAGGGGAACCAAGG - Intronic
1195271323 X:103233800-103233822 AGTAAAGGTAATGGGATCCAAGG + Intergenic
1199867263 X:151863480-151863502 GGTAAAGAGAAGGGTCTCCATGG + Intergenic
1199989861 X:152980920-152980942 AGTAAAGAGAAGAGGACCCAGGG + Intergenic
1202383790 Y:24303527-24303549 CTTAAATAGGAGGGGAGCCATGG + Intergenic
1202486993 Y:25366593-25366615 CTTAAATAGGAGGGGAGCCATGG - Intergenic