ID: 1108570173

View in Genome Browser
Species Human (GRCh38)
Location 13:51741865-51741887
Sequence CCCAGCCCTCAGTAAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108570168_1108570173 21 Left 1108570168 13:51741821-51741843 CCTTAATTGAGTCCAGCAGGGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1108570173 13:51741865-51741887 CCCAGCCCTCAGTAAGGCACTGG 0: 1
1: 0
2: 1
3: 36
4: 343
1108570169_1108570173 9 Left 1108570169 13:51741833-51741855 CCAGCAGGGAGCTGCTTAGCACC 0: 1
1: 0
2: 2
3: 48
4: 194
Right 1108570173 13:51741865-51741887 CCCAGCCCTCAGTAAGGCACTGG 0: 1
1: 0
2: 1
3: 36
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108570173 Original CRISPR CCCAGCCCTCAGTAAGGCAC TGG Intronic
900871854 1:5310039-5310061 CCCAGCATTCATTAGGGCACAGG - Intergenic
901486261 1:9564634-9564656 CCCAGCACTTAGTAAGGCCAAGG + Intronic
901911549 1:12462860-12462882 CCATGCCCTCATGAAGGCACTGG + Intronic
901990173 1:13106286-13106308 CCCAGCCCTCTGGGAGGCAGAGG + Intergenic
903742254 1:25565082-25565104 CCCAGCCCTGGGTAAGCTACAGG - Intronic
904088568 1:27928619-27928641 CCCAGCCCTTTGTGAGGCAAAGG - Intergenic
905626164 1:39491744-39491766 CCCAGCCCTCAGAACAGCCCCGG + Exonic
906226932 1:44130067-44130089 TCCAGGCCTCAGGAAGGGACTGG + Exonic
906726515 1:48048418-48048440 CTCTGTCCTCAGTAGGGCACGGG + Intergenic
907410916 1:54282667-54282689 CCCAGCCCTGAGGAAGCCACAGG + Intronic
908927228 1:69270261-69270283 CCCACCCCTCCAGAAGGCACAGG - Intergenic
909490801 1:76224343-76224365 CCCAGCCCAGAGGAAGGTACTGG + Intronic
910078996 1:83316666-83316688 CCCAGCACTTTGTAAGGCAGAGG + Intergenic
911450561 1:98055005-98055027 CCCACCCCTCACTATGGAACTGG + Intergenic
915307484 1:154988900-154988922 CCCAGATCTCAGTAATGCAGGGG + Intronic
916597722 1:166261708-166261730 GCCAGCCCTCAAGAAGGCAGGGG - Intergenic
917091495 1:171358009-171358031 CCCAGCACTCAGAAAGGCAGAGG - Intergenic
917283910 1:173404880-173404902 CCCAGCACTTAGGAAGGCCCAGG - Intergenic
917792564 1:178508658-178508680 CCCACCCCTCAGGAAGGGGCTGG + Intergenic
918323005 1:183382750-183382772 CCCACCCATCAGTAAGGGGCAGG + Intronic
918851521 1:189696764-189696786 CCCAGCACTCTGTGAGGCAGAGG - Intergenic
919094141 1:193009783-193009805 ACCAGCCCTCAGGGAGCCACTGG + Intergenic
920038940 1:203083724-203083746 CCCACCCCCCAGCAAGGGACTGG - Exonic
920151399 1:203911471-203911493 CCCAGCCCTTTGAAAGGCAGAGG + Intergenic
920338485 1:205260336-205260358 CCCAGCCCAAAGCAGGGCACAGG - Intronic
922219890 1:223550419-223550441 CCCAGCCCACAGGAGGACACAGG - Intronic
922786698 1:228286459-228286481 CCCACCCCACAGTAAGCCAATGG - Intronic
922892766 1:229074291-229074313 CCCAGCCCACAGGAGGGCAGAGG + Intergenic
923642395 1:235778194-235778216 CCCAGCACTCTGGGAGGCACAGG - Intronic
924374364 1:243389924-243389946 CCCAGCACCAAGTCAGGCACTGG + Intronic
924589086 1:245386404-245386426 CCCGGCCCCCATCAAGGCACCGG - Intronic
924801407 1:247331679-247331701 CCCAGCGCTCAGGAAGGTGCGGG - Exonic
1062760322 10:12438-12460 CCACGCCCTCAGAAAGACACTGG + Intergenic
1064332137 10:14403855-14403877 ACCACCCCTCAGTATGGCTCTGG - Intronic
1064736067 10:18382990-18383012 CCTAGCCCACAGGATGGCACGGG + Intronic
1065800456 10:29346868-29346890 CCCAGGCATGAGTAGGGCACTGG - Intergenic
1066309910 10:34186242-34186264 CCCAGCACTCTGGAAGGCAGAGG + Intronic
1068517407 10:58041480-58041502 CCCAGCACTAAGATAGGCACTGG - Intergenic
1069503739 10:68977855-68977877 CCCAGCCCTTTGGGAGGCACAGG + Intronic
1069526866 10:69180302-69180324 CCGAGCCCACAATAGGGCACGGG - Exonic
1069557684 10:69408555-69408577 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1069622163 10:69844410-69844432 CCCAGCCCCCAGTAAGCCTGTGG + Intronic
1069882675 10:71603464-71603486 GCCAGCCCTCTGGGAGGCACAGG + Intronic
1071430337 10:85601937-85601959 TCCTGCCCTCAGAAAGGCCCAGG + Exonic
1072549297 10:96465250-96465272 GCCAGCCCCCAGGAAAGCACTGG - Intronic
1074142380 10:110685313-110685335 CCCACCACTCAGAAGGGCACAGG - Intronic
1074556003 10:114490917-114490939 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1074803265 10:117024059-117024081 ACCAGCCCTCATTAGGGCCCCGG - Intronic
1075091618 10:119447031-119447053 TGCAGCGCTCAGTAAGGCAGAGG + Intronic
1075554688 10:123421852-123421874 CTCTGCCTTCAGGAAGGCACTGG - Intergenic
1075875112 10:125799674-125799696 CCAAGCTCTCTGCAAGGCACAGG - Intronic
1076664171 10:132076772-132076794 GCCAGCCCTCAGTCAGACCCGGG - Intergenic
1077035417 11:492086-492108 CCCAGCTCTCAGGGAGGCAGAGG - Intergenic
1077164995 11:1130922-1130944 CCCACCCCTCAGGGAGCCACAGG + Intergenic
1079912792 11:26332000-26332022 CCCACCCCTCACTGTGGCACTGG + Exonic
1080662013 11:34304359-34304381 CCCAGCCCTTAGGGAGGCAGAGG - Intronic
1082002013 11:47398437-47398459 CCCAGCCCTCCTTCAGGCACCGG + Intergenic
1083254290 11:61486759-61486781 TCCAGCCCCCAGGAAGGCCCAGG - Intronic
1083351753 11:62034507-62034529 CTCTGCCCACAGTAAAGCACTGG - Intergenic
1083871750 11:65492634-65492656 CGCAGCCCCCAGGAAGGCATGGG + Intergenic
1083921886 11:65785872-65785894 CACAGCCCTTAGAAAGGCAGGGG + Intergenic
1084676337 11:70637615-70637637 CCCAGCGCTCAGGAAGGCCGGGG + Intronic
1085165941 11:74399075-74399097 TCAATCCCTCAGTAAGGTACAGG + Intergenic
1085391138 11:76182906-76182928 CCCAGCCCTGAGCAAGCCACTGG - Intergenic
1085763996 11:79266506-79266528 CCCATCCTTCTGAAAGGCACAGG + Intronic
1089114009 11:116079339-116079361 CCCAGCTCTCAGGGAGGCAAAGG + Intergenic
1089602482 11:119624227-119624249 CCCAGCCCTGCGTATGGCATGGG + Intronic
1092344118 12:7701327-7701349 CCCAGCTCTCAGGGAGGCACAGG + Intergenic
1093096918 12:14982288-14982310 CCCAGCACTTAGGAAGGCCCAGG - Intergenic
1094040618 12:26117488-26117510 CCCAGCCCACAGTAAGTCAGAGG + Intergenic
1094604094 12:31935789-31935811 CCCAGCACTTTGTAAGGCAGAGG - Intergenic
1095447191 12:42294136-42294158 CCCAGCCCTCTGAAAGGCCGAGG + Intronic
1095857328 12:46874611-46874633 CCCAGCCTTCATTAACCCACTGG + Intergenic
1096572037 12:52529018-52529040 CCCAGCCCTCAGGGATGCCCAGG - Intergenic
1097977857 12:65707628-65707650 CCCAGCTCTCAGGGAGGCAGAGG + Intergenic
1098702339 12:73645297-73645319 CCCAGGCCTCATTAAGGCCCTGG + Intergenic
1099778151 12:87160994-87161016 CCCACCACTCTGTAGGGCACAGG + Intergenic
1101119162 12:101561423-101561445 CCCAACCCTCTGGAAGGCAGAGG - Intergenic
1103540969 12:121666269-121666291 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1104717578 12:131026246-131026268 CCCAGCCCTCTGGAGGGCACCGG - Intronic
1104758050 12:131281148-131281170 CCCAGGCCTCAGAAGGGAACGGG - Intergenic
1104822824 12:131687933-131687955 CCCAGGCCTCAGGAGGGAACAGG + Intergenic
1104995725 12:132654321-132654343 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1105825088 13:24115329-24115351 CCCAGCCCACAGACTGGCACTGG + Intronic
1105919977 13:24954103-24954125 CCCACCCATCAGTCAAGCACAGG + Intergenic
1106700994 13:32228491-32228513 CTAAGCCCTGAGTCAGGCACCGG - Exonic
1107485720 13:40825532-40825554 CCCAACCATCAGTCAAGCACAGG + Intergenic
1107698435 13:43023307-43023329 CCCAGGCCGCCGTAAGGGACTGG - Exonic
1108384942 13:49890612-49890634 ACCAGCCCCCAGTAAGGCTGAGG - Intergenic
1108570173 13:51741865-51741887 CCCAGCCCTCAGTAAGGCACTGG + Intronic
1109126861 13:58528636-58528658 ACCAGCCCCCAGTAAGGCTGAGG - Intergenic
1110442223 13:75538318-75538340 CCCAGCCCTCAGTCTGGCTGCGG + Intronic
1111277433 13:85968209-85968231 CCCAACCCTCAGTTTGGTACAGG - Intergenic
1111936781 13:94566161-94566183 GCCAGCCCTAAGGAAGGCACAGG - Intergenic
1112698071 13:101972757-101972779 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1112848291 13:103671629-103671651 CCCAGCCCTTTGGGAGGCACAGG - Intergenic
1113949940 13:114066319-114066341 CCAAACCCTCAGTGAGGCCCTGG + Intronic
1113963095 13:114136224-114136246 CCCAGCCCTCTGAGAGGCACAGG + Intergenic
1116025394 14:39508391-39508413 CCCAGTCCCCAGAAAGGCCCAGG + Intergenic
1117255210 14:53970294-53970316 CCCAGCCTTGAGCAAGTCACAGG + Intergenic
1118351386 14:64974544-64974566 CCCAGCACTCAATAAAGCAGAGG + Intronic
1118371047 14:65137437-65137459 CCCAGCTCTCAGGGAGGCAGAGG - Intergenic
1118405835 14:65422756-65422778 CCCAGCACTCTGGAAGGCCCAGG - Intronic
1119613534 14:76083361-76083383 TCCAGGCCTCAGGGAGGCACAGG - Intronic
1119679093 14:76578504-76578526 CCCAGCTCTCAGGGAGGCAGAGG - Intergenic
1120780823 14:88483882-88483904 CCCAGCACTTAGAAAGGCAGAGG + Intronic
1121975201 14:98397016-98397038 CCCAGCTCACAGCAAGGCAAGGG + Intergenic
1122982557 14:105198221-105198243 CCCCTCCCTCAGCAAGCCACTGG + Intergenic
1123539049 15:21269228-21269250 CCCAGCACTTTGTAAGGCCCAGG + Intergenic
1123688736 15:22819400-22819422 CCTTGCCCTCAGTAAGTCACAGG - Intronic
1124720181 15:32104935-32104957 CTTAGCCCTCAGTAAGTGACTGG + Intronic
1125355279 15:38811229-38811251 CCCAGACACCAATAAGGCACAGG + Intergenic
1126040964 15:44590524-44590546 CCCAGCACTCAGGGAGGCAGAGG - Intronic
1126603015 15:50447851-50447873 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1126868251 15:52959605-52959627 CCCTGCCCTCCATAATGCACAGG + Intergenic
1127087112 15:55434580-55434602 CCCAGCTCTCAGGGAGGCAGAGG + Intronic
1128215212 15:65929980-65930002 CCCAGCCCTCAGGAAAGCAGTGG - Intronic
1129112220 15:73344076-73344098 CCCAGCCCGCAGTAAGAGTCAGG + Intronic
1129325506 15:74798420-74798442 CCCAGCACTCAGTCAGGTACAGG + Intronic
1129340404 15:74882202-74882224 CCCAGGCCTGAGCAAGGCCCGGG - Intergenic
1130653477 15:85775715-85775737 GCCAGCCCTCAGGAGGGGACAGG - Intronic
1131015004 15:89050743-89050765 CTCAGCCCTGAGGAAGGCAAGGG + Intergenic
1131433512 15:92405008-92405030 CCCAGCTCTTAGGGAGGCACAGG + Intronic
1132379628 15:101357745-101357767 CCCAGAGCTCACCAAGGCACTGG - Intronic
1132600071 16:769262-769284 CCCAGCCCTCCGCAGGGCCCGGG + Intergenic
1132792422 16:1699160-1699182 CCCAGCCATCTGGAAGGCACGGG - Exonic
1133260566 16:4547038-4547060 CCCAGCTCTTAGGAAGGCAGCGG - Intergenic
1134632589 16:15767570-15767592 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1134638933 16:15813740-15813762 CCCAGCTCTTAGGAAGGCACAGG + Intronic
1135105312 16:19644486-19644508 CCCAGCACTTAGGAAGGCAGAGG - Intronic
1135771444 16:25221218-25221240 CCCAGCCCCCAGGATGGCCCTGG - Intronic
1137794760 16:51206419-51206441 CCCAGCTCTCAGGGAGGCAGAGG + Intergenic
1138408089 16:56814884-56814906 CCCAGCCCTCAGGCAGTCCCTGG + Intronic
1139245830 16:65442600-65442622 CACAGCCCTTAGTAAGTGACTGG - Intergenic
1139825046 16:69750375-69750397 CCCAGCCCTTAGGAAGGCTGAGG + Intronic
1141563136 16:84883558-84883580 TCCAGCCCTCAGGCAGGCGCGGG - Intronic
1141569208 16:84924190-84924212 CCCAGCACTCAGGGAGGCAGAGG + Intergenic
1141958700 16:87390846-87390868 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1143221222 17:5263792-5263814 CCCAGCACTCTGAAAGGCCCAGG + Intergenic
1143661764 17:8328843-8328865 CCCAGCACTTTGTAAGGCCCAGG - Intergenic
1144937692 17:18913321-18913343 GCCACCCCTCTGGAAGGCACAGG - Intronic
1146071088 17:29682533-29682555 CCCAGCACTCAGGAAGGCAGAGG + Intronic
1147924941 17:43940464-43940486 CCTAGGCTGCAGTAAGGCACTGG + Intergenic
1148059636 17:44827057-44827079 CCCAGCACTCTGGAAGGCAGAGG + Intronic
1148131635 17:45265840-45265862 CCCAGCTCTTAGCAATGCACAGG - Intronic
1148496028 17:48054103-48054125 CCCATTCCTCAGGAAGGCAGTGG - Intronic
1148741808 17:49897364-49897386 CCCAGCCCTCAGGCAGGAACTGG + Intergenic
1148779123 17:50111823-50111845 CCCAGCCCTCAGTGTGGCCCAGG + Exonic
1148989266 17:51651276-51651298 GCCAGCCCTCTGCTAGGCACTGG - Intronic
1151785916 17:76275023-76275045 TCCAGCCCTCAGTGAGGACCCGG - Intronic
1151883152 17:76906633-76906655 CCCAGCACTGGGTAAGGGACAGG - Intronic
1152345852 17:79751173-79751195 CCCAGCACTTTGAAAGGCACAGG + Intergenic
1152460601 17:80440080-80440102 CCCAGCTCTCTGTCAGGCCCAGG - Intergenic
1152607291 17:81298539-81298561 CCCAGCTCTCAGGGAGGCAGAGG - Intergenic
1152953230 18:12792-12814 CCACGCCCTCAGAAAGACACTGG + Intergenic
1155394556 18:25373319-25373341 CCCTCACATCAGTAAGGCACTGG - Intergenic
1155542092 18:26879276-26879298 CCCATTCCTCAGTATGGCAAAGG - Intergenic
1155692977 18:28649729-28649751 CCCAGCCCTCAGGCGGGAACGGG - Intergenic
1156245948 18:35298268-35298290 CCCAGCACTCAGAAAGGCTGAGG - Intergenic
1157642866 18:49234941-49234963 AGCAGCCCTCAGGAAGGCAAGGG + Intronic
1158466133 18:57691482-57691504 CCCAGACTTCAGAAAGGGACTGG - Intronic
1159986611 18:74849326-74849348 CCCAGCACTCTGGGAGGCACAGG - Intronic
1160384659 18:78487930-78487952 CGCAGCCCTCAGTAAGGTCACGG - Intergenic
1160675452 19:388855-388877 CGCAGCCCTCAGAAGGGAACTGG + Intergenic
1162115585 19:8427392-8427414 CCCAGCACTCTGTTAGGCACTGG + Intronic
1162450022 19:10748958-10748980 GCCAGCCTTCAGCATGGCACTGG - Intronic
1163749371 19:19066400-19066422 AACAGCCATCAGTAAGGGACTGG - Intronic
1163930627 19:20387442-20387464 CCCAGCACTCAGGGAGGCAGAGG - Intergenic
1164854280 19:31509041-31509063 CCCAGCCCCCAGACAGGCCCTGG + Intergenic
1165002639 19:32777959-32777981 CCCAGCACTCTGAAAGGCAGAGG - Intronic
1165187713 19:34036343-34036365 CCCAACCTTCAGTAGGGCAGAGG + Intergenic
1165473677 19:36017494-36017516 CCCAGCTCTCAGTCAGACCCTGG - Intronic
1165736202 19:38177420-38177442 CCCAGCTCTCAGAGAGGCAGAGG + Intronic
1165903591 19:39179995-39180017 CCCAGCCCCCAGGGAGGCAGTGG + Intronic
1166069445 19:40378487-40378509 CACACCACTCAGTCAGGCACAGG - Intronic
1166201307 19:41239422-41239444 GGCAGCTCTCAGTAAGGCTCAGG - Intronic
1166523242 19:43495249-43495271 CCCGGCCCTCACTAAGGTATGGG - Exonic
1166978623 19:46619957-46619979 CCCTGCCCTCAGAGAGGCCCAGG - Intergenic
1167237800 19:48325619-48325641 CCCAGCCCTGAATAACGGACTGG - Intronic
1167325300 19:48820750-48820772 CCCAGCTCTCAGGGAGGCAGAGG + Intronic
1167708117 19:51093838-51093860 GCCAGCCCTCCATAAAGCACTGG - Intergenic
1167917928 19:52757231-52757253 CCCAGCACTTAGAAAGGCAAAGG + Intergenic
1167950860 19:53026599-53026621 CCCAGCTCTCAGGGAGGCAGAGG + Intergenic
1168103723 19:54154233-54154255 CCCAGCACTCAGCAGGGCAGGGG + Intronic
1168254647 19:55158728-55158750 CCCAGCCCCTAGTCAGCCACAGG + Exonic
927670576 2:25065635-25065657 CCCAGCCCTCAGGCCTGCACTGG - Intronic
928018439 2:27681168-27681190 CACAGGCCTCAGGAAGGCTCTGG - Intronic
929048360 2:37813066-37813088 CCCAGCCAGCACTGAGGCACAGG + Intergenic
931198272 2:60073582-60073604 CCAAGCCTTCAGTAAGGTTCAGG - Intergenic
931585252 2:63819370-63819392 CACAGCCATTAGTAAAGCACAGG - Intronic
931721182 2:65068909-65068931 CCCAGGCCTCAGCTGGGCACTGG - Intronic
932188364 2:69717738-69717760 CCCAGGCATCAGGAAGGCTCAGG - Intronic
932571422 2:72940433-72940455 TCCACCCCTCCGTAAGGCCCAGG + Intergenic
934668289 2:96189452-96189474 CCCAGCACTCAGAAAGGCCGAGG + Intronic
935171157 2:100612452-100612474 CACAGCCCTCATGAGGGCACAGG - Intergenic
936947427 2:117943105-117943127 CCTTGCCCTCAGCAAGCCACTGG + Intronic
937080347 2:119135896-119135918 CCCACCCCACAGAAAGGCAAGGG - Intergenic
937393910 2:121517934-121517956 CCCAGCACTCTGGAAGGCCCAGG + Intronic
938704012 2:133904552-133904574 GCCAGCACTCAGTACCGCACAGG - Intergenic
940161328 2:150716997-150717019 CCCAGCCATCATGAAGGCACTGG - Intergenic
940908443 2:159189410-159189432 CCCTGACCTCTGGAAGGCACAGG - Intronic
940984310 2:160037468-160037490 CCCAGCCCTCAGCATGTCACTGG - Intronic
941396298 2:164977906-164977928 CCCAGCACTTTGTAAGGCCCAGG + Intergenic
941666198 2:168246672-168246694 CCCCGGCCTCAGAAAAGCACTGG + Intronic
943045543 2:182857368-182857390 CCCAGCACTCTGTAAGGCCAAGG + Intronic
943408994 2:187521815-187521837 CCCAGCACTCTGGAAGGCAGAGG - Intronic
944773319 2:202935673-202935695 CCCAGCACTCTGTGAGGCAGAGG - Intronic
945252822 2:207778733-207778755 CCCAGCACTCAGGGAGGCAGAGG - Intergenic
947634611 2:231673593-231673615 CCCAGTCCTCAGTGAGGAAACGG + Intergenic
947674680 2:231967177-231967199 CCCTGCCCTCAGTAAAGTATTGG + Intronic
947724013 2:232386469-232386491 CCCAGCCCTCTGGCAGGCAGTGG - Intergenic
948454486 2:238098419-238098441 CACAGCCCTCAGGAGGGAACTGG - Exonic
948578422 2:238968787-238968809 CCCAGCCCCCAGGATGGCATTGG - Intergenic
948757905 2:240169832-240169854 CCCAGGCCCCAGGAGGGCACAGG - Intergenic
1169022374 20:2339781-2339803 CCCAGCCCTCACCAAGGTGCAGG + Intronic
1170108971 20:12784186-12784208 CCCAGCCTTCAGCCAGCCACGGG + Intergenic
1170341223 20:15329485-15329507 CCCAGCACTTAGGAAGGCAGAGG + Intronic
1171253410 20:23667887-23667909 CCCAGGCCTGAGTAAGTCACAGG + Intergenic
1171259885 20:23723141-23723163 CCCAGGCCTGAGTAAGTTACAGG + Intergenic
1171268961 20:23798672-23798694 CCCAGGCCTGAGTAAGTCACAGG + Intergenic
1171493291 20:25537331-25537353 CCCAGCCCTCTGGGAGGCCCCGG - Intronic
1173437117 20:43043242-43043264 CTCAGCCCTCAGGGAGGCATTGG + Intronic
1174534199 20:51238061-51238083 CCCAGCCCTCAGTTTGGTCCGGG - Intergenic
1174808626 20:53627010-53627032 CCCAGCTCTCAGGGAGGCAGAGG - Intergenic
1175540224 20:59743559-59743581 CCCAGCCCTAAGTAAATCAGAGG - Intronic
1176216752 20:63951684-63951706 CCCAGGGCTCAGCAGGGCACAGG + Intronic
1176216766 20:63951726-63951748 CCCAGGGCTCAGCAGGGCACAGG + Intronic
1176216780 20:63951768-63951790 CCCAGGGCTCAGCAGGGCACAGG + Intronic
1178546044 21:33493764-33493786 CCCAGCCCTCTGGGAGGCCCAGG + Intergenic
1181340853 22:22178794-22178816 CCCAGGGCTCAGGAAGGGACTGG + Intergenic
1182224161 22:28782685-28782707 CCCAGCCCTCTGGGAGGCAGAGG - Intronic
1182743143 22:32583363-32583385 CCCACGCCTCAGTAGGGCAGGGG + Intronic
1183045621 22:35217288-35217310 CCCTGGCCTCAGTCAGGGACTGG + Intergenic
1183934980 22:41256870-41256892 CCCAGCCCTCAGCAAGCCCCGGG + Intronic
1185365906 22:50436640-50436662 CCCAGCCCTGGGTGTGGCACAGG - Intronic
1185392834 22:50571878-50571900 CCCAGCCCTCGGGAAGGCACAGG - Intronic
950236554 3:11326546-11326568 CCCAGCACTCTGGAAGGCAGAGG - Intronic
951075278 3:18383419-18383441 CCCAGCCCCCATTAAGGCCTGGG - Intronic
952887676 3:38021556-38021578 CCCAACCCTTAGTAACCCACTGG + Intronic
953042738 3:39269313-39269335 CCAAGCACCCAGTAAGGCAAAGG - Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954189076 3:48943396-48943418 CCAAGCCCTCAGGAATGCACAGG - Intronic
955638485 3:61056169-61056191 CCCAGCTCTCAGGGAGGCAGAGG + Intronic
956118697 3:65944263-65944285 CCCAGCCCTTTGGAAGGCAGAGG + Intronic
956714860 3:72070144-72070166 CCCAACTCCCAGTAAGGAACTGG + Intergenic
957413403 3:79869466-79869488 CCCAGCACTCAGGGAGGCTCAGG + Intergenic
957415026 3:79890581-79890603 CCCAGCCCTCTGGAAGGCTGAGG - Intergenic
959789761 3:110345205-110345227 CCCAGTCTTCAGTAACGCAATGG + Intergenic
961051325 3:123749514-123749536 CATGGCCCTCATTAAGGCACTGG + Intronic
961245904 3:125453131-125453153 CTAAGCCCTATGTAAGGCACTGG + Intronic
961548294 3:127651612-127651634 CTCAGCCCTCTGGCAGGCACTGG - Intronic
961630416 3:128294541-128294563 CCCAGACCTAAGTCAGACACTGG + Intronic
963298906 3:143577605-143577627 CCCTGCCCTCAGTGAGTGACAGG - Intronic
967587462 3:191232863-191232885 CCCAGCACTCTGAAAGGCAGAGG - Intronic
968862404 4:3183283-3183305 GCCTGCCCCCAGTCAGGCACAGG + Intronic
969330177 4:6470358-6470380 ACCAGCCCTCAGCAGGGCACAGG - Intronic
971546802 4:27896633-27896655 GCCACCCCTCTGGAAGGCACAGG + Intergenic
972502942 4:39695171-39695193 CCCAGCTCTCAGGGAGGCAGAGG + Intergenic
975989484 4:80242536-80242558 CCCAGCCCTTTGTGAGGCCCAGG - Intergenic
977962561 4:103102616-103102638 CACAGCTCTCAGTCAGCCACGGG - Intergenic
983370660 4:166853630-166853652 CCCAGCACTCAGAGAGGCAGAGG + Intronic
984599581 4:181710797-181710819 CCCAGCTCTCAGGGAGGCAGAGG - Intergenic
985640776 5:1062655-1062677 CCCAGCCCTGGGTATGGCAGAGG - Intronic
985786448 5:1897819-1897841 CCCAGCCCTCCCTCAGGCACAGG - Intergenic
987710263 5:21495381-21495403 CCCAGCCCTCTGGAAGGCCGAGG - Intergenic
989233905 5:39122034-39122056 ACCAGACATCAGTAAGTCACAGG + Intronic
992891424 5:81207823-81207845 CCCAGCGCTCAGGAGGGCGCAGG - Intronic
994484304 5:100375479-100375501 CCCAGCCCTCTGGAAGGCCGAGG + Intergenic
995496916 5:112755857-112755879 CCCAGCTCTTAGTGAGGCAGAGG + Intronic
995983595 5:118140359-118140381 CCTAGTCCTCAGTAACTCACTGG - Intergenic
997465563 5:134085635-134085657 CCCAGCCCTCCGGAAGGCAAAGG + Intergenic
997787984 5:136730892-136730914 TGCAGTCCTCAGTAAGTCACAGG - Intergenic
997842996 5:137258969-137258991 CCCAGCACTCAGTGAGGAAATGG + Intronic
998129440 5:139643879-139643901 CCCTGTTCTCAGTGAGGCACAGG - Intergenic
998365856 5:141630301-141630323 CCAAGCCCTGTGCAAGGCACTGG + Intronic
998817075 5:146025426-146025448 ACCAGACCTCAGGAAGGCAAGGG - Intronic
999275103 5:150325013-150325035 CCCAGCTCTATGTTAGGCACTGG - Intronic
999337601 5:150735583-150735605 TCCAGCTCTCAGGAAGCCACAGG + Intronic
999449558 5:151667858-151667880 CCCAGCACCCAGTAAGGTGCAGG - Intronic
999736218 5:154515313-154515335 CCCAGCACTCTGGAAGGCCCAGG + Intergenic
999854592 5:155580276-155580298 CCCAGCCCTCAGAGTGGCAGAGG + Intergenic
1000998873 5:167986410-167986432 CCCAGCATTCTGTCAGGCACAGG - Intronic
1001386952 5:171347672-171347694 CCCAGCTCTCAGGGAGGCAGAGG + Intergenic
1002076611 5:176712263-176712285 CCCACCCCTCAGTGAGGCATTGG + Intergenic
1002096896 5:176836724-176836746 CCCAGCCCCCAGCAAAGCTCAGG + Intronic
1002212655 5:177608009-177608031 CCCACCCCTCAGCCAGTCACTGG + Intronic
1002487252 5:179547801-179547823 CCCAGCACTCTGGGAGGCACAGG - Intergenic
1002900207 6:1404637-1404659 CCCAGGGCACAGTAAGGAACAGG - Intergenic
1003948623 6:11097403-11097425 CCCAGCCCTTTGGAAGGCAGAGG + Intronic
1006166089 6:32066139-32066161 CCCAGCACTTTGTAAGGCCCAGG + Intronic
1006610477 6:35291571-35291593 CACAGCCCTCAAAAGGGCACTGG - Exonic
1006672683 6:35739138-35739160 CCCAGCCCTCAGTTTGGTCCAGG - Intronic
1006936706 6:37723670-37723692 CCCTGCCCTCAGGAAGCCCCAGG + Intergenic
1007275942 6:40673864-40673886 CCAAGCACTGTGTAAGGCACTGG + Intergenic
1010230234 6:73528003-73528025 CCCAGCTCTCAGGGAGGCAGAGG + Intergenic
1010254840 6:73745978-73746000 CCCAGCCCTTTGGAAGGCAGAGG - Intronic
1011331032 6:86206655-86206677 CCCAGCCTTCCTTAAAGCACCGG - Intergenic
1012874762 6:104713091-104713113 ACCAGACCCCAGTCAGGCACAGG - Intergenic
1013082170 6:106822333-106822355 CCCAGCTCTCAGGGAGGCAGAGG + Intergenic
1017781683 6:157720388-157720410 CCCCTCCCTCAGGAAGGCCCTGG + Intronic
1018184290 6:161252571-161252593 CCCAGCACTCTGTAAGGCCAAGG + Intronic
1018971334 6:168531522-168531544 CCCAGCCCTCCCTCAGGCTCAGG - Intronic
1019627875 7:2030244-2030266 CCCAGCCCACAGTGACGCCCGGG + Intronic
1019713208 7:2526745-2526767 CACAGCCCTGAGTGAGGCAACGG - Intronic
1020070282 7:5222951-5222973 CCCAGCCTGCTGTAAGGGACGGG + Intronic
1025987148 7:66463758-66463780 ACCAGTCATCAGAAAGGCACGGG - Intergenic
1026815644 7:73509467-73509489 CCCAGCACTTTGAAAGGCACAGG + Intronic
1027296769 7:76781940-76781962 CCCAGCACTTTGTAAGGCAGAGG + Intergenic
1027713160 7:81633434-81633456 CCCAGCACTCTGGGAGGCACAGG + Intergenic
1028536564 7:91894167-91894189 CCCAGCCATCAGTGAGGTATAGG + Intergenic
1029307051 7:99627999-99628021 CCCAGCACTCAGTGAGGCAGAGG + Intronic
1030106679 7:105993417-105993439 CCCAGCACTCAGGGAGGCAGAGG + Intronic
1031970741 7:128063173-128063195 CCCATCCCTCAGCAAGGAAGGGG - Intronic
1033995186 7:147337220-147337242 GCCAGCCCCCACTAAGGCACAGG + Intronic
1035572103 8:679411-679433 CCCAGCCCTCACAAAAGCTCTGG + Intronic
1036786822 8:11693213-11693235 CCCAGCACTTAGTGAGGCAGAGG + Intronic
1037592197 8:20322386-20322408 CCCTGCCCTCAGAATGGCCCTGG - Intergenic
1037832540 8:22197932-22197954 CCCAGCACTCAGGAAGGCCGAGG + Intronic
1038250881 8:25903282-25903304 CCCAGCTCTTAGGAAGGCAGAGG - Intronic
1038615602 8:29090966-29090988 CCCAGCCCTCAGGGAGGCCAAGG - Intronic
1039055532 8:33533350-33533372 CCCAGCCCTTTGGAAGGCCCCGG - Intergenic
1039484693 8:37901217-37901239 CCCTGCCCTCAGCAGGGCATAGG - Intergenic
1040589567 8:48778031-48778053 CCCAGCACACAGTGAGGCAGGGG + Intergenic
1041197831 8:55418712-55418734 CCCACCATTCAGTGAGGCACAGG + Intronic
1041615303 8:59899589-59899611 CCCAGCACTCAGGAAGGCCAAGG - Intergenic
1041698052 8:60758372-60758394 CCCAGCACTCAGGAAGGCCAAGG - Intronic
1042341858 8:67687902-67687924 GTCAGCCCTAAGTAAGGAACTGG + Intronic
1043515417 8:80990691-80990713 CCCAGCCCTCAGTATCTTACAGG - Intronic
1046494370 8:114994815-114994837 CCCAGCACTTTGTGAGGCACAGG - Intergenic
1047364572 8:124200390-124200412 CCCAGGCCTCAGTTAGGGAGTGG - Intergenic
1048970705 8:139643593-139643615 GCCGGCCCTCAGCAGGGCACAGG + Intronic
1048991744 8:139764541-139764563 CCCAGCACTGAGTGAGACACGGG + Intronic
1049280625 8:141742287-141742309 CACAGCCATGAATAAGGCACAGG + Intergenic
1049305137 8:141898721-141898743 CCCAGCTCTCAGAAAGGCTGTGG - Intergenic
1049375728 8:142288179-142288201 CCCAGGCCCCTGAAAGGCACTGG - Intronic
1049633392 8:143672088-143672110 CCCCGCCCTGCGCAAGGCACAGG - Intergenic
1049743787 8:144254466-144254488 CCCAGGCCTCAGGACGTCACAGG - Intronic
1050515127 9:6435374-6435396 CCCAGCACTCAGGAAGGCTGAGG - Intronic
1050538829 9:6652525-6652547 CCCAGCTCTCAGAGAGGCAGAGG + Intergenic
1051683201 9:19629209-19629231 CCCAGCACTTAGGAAGGCTCTGG - Intronic
1052867407 9:33473002-33473024 CCCTGCCCTAAGTAATGCCCAGG + Intronic
1055510390 9:76990543-76990565 CCCAGCTCTCAGAGAGGCAGAGG - Intergenic
1055594170 9:77848682-77848704 CACAGCCCTCAGAAGGGCAAAGG - Intronic
1056655109 9:88502721-88502743 CCCAGCACACAGGAAGGCGCCGG - Intergenic
1056845735 9:90036625-90036647 ACCAGCCCTCAGTAATGCTGGGG + Intergenic
1057275721 9:93675127-93675149 CCCAGCCCTCAGGATAGGACAGG - Intronic
1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG + Intergenic
1058742349 9:107956383-107956405 CCCAGCACTCAGTTAGGTGCTGG - Intergenic
1059117702 9:111614431-111614453 CCCAGCCCTTTGGAAGGCAGAGG - Intergenic
1060050715 9:120376371-120376393 CGAAGCCCTCAGTCAGGCTCAGG + Intergenic
1060494104 9:124105353-124105375 CCCAGCCCTCTGGAAGGGGCTGG + Intergenic
1060881783 9:127122748-127122770 CCCAGGCCCCAGAAAGGCTCCGG + Exonic
1061161213 9:128895497-128895519 CCCAGCCTTCCCTCAGGCACAGG - Intronic
1061168269 9:128937161-128937183 CCCAGCTCTCAGGGAGGCAGAGG + Intronic
1061269406 9:129529008-129529030 CCCAGCCCTCTGTGAGGCCGAGG + Intergenic
1061360284 9:130137302-130137324 CGCAGCCCTCAGACTGGCACGGG + Exonic
1061930245 9:133828657-133828679 CCTCTCCCTCAGGAAGGCACAGG - Intronic
1062666140 9:137673662-137673684 CCCTGCCCTCAGGGAGGCTCTGG + Intronic
1203734794 Un_GL000216v2:126455-126477 CCCAGCACTTAGTGAGGCAAAGG + Intergenic
1186518387 X:10184406-10184428 CTCAGACCTCAGCAAGGAACGGG - Intronic
1188015669 X:25105185-25105207 CCCAGCCCTATGCAAAGCACTGG + Intergenic
1188689238 X:33108623-33108645 CCCAGCCCTTTGTGAGGCCCAGG + Intronic
1188935330 X:36168675-36168697 CCCAGCTCTCAGGGAGGCAGAGG - Intergenic
1189061089 X:37754421-37754443 CCCACACCTCAGTGGGGCACAGG - Intronic
1189475318 X:41348652-41348674 ACCAGCCCTCATTAGGGCCCTGG + Exonic
1190654237 X:52597160-52597182 TCCAGCCTTCAGGAAGGCACTGG - Intergenic
1190816483 X:53934310-53934332 CCCAGCTCTCAGGGAGGCAGAGG - Intergenic
1191977396 X:66888484-66888506 CCCAGGACTGGGTAAGGCACTGG + Intergenic
1192639359 X:72847628-72847650 CCCAGACCACAGTAGGCCACAGG - Intronic
1192642352 X:72873177-72873199 CCCAGACCACAGTAGGCCACAGG + Intronic
1193171632 X:78344025-78344047 CCCAGTAGTCATTAAGGCACAGG - Intergenic
1193257718 X:79368777-79368799 TCTGGCCCTAAGTAAGGCACAGG - Intergenic
1194007059 X:88507697-88507719 CCCAGCCCTCAGTTTGGTCCAGG + Intergenic
1195129622 X:101839971-101839993 CCCAGCCCTCAGTATGGGGCAGG + Intronic
1195176616 X:102319858-102319880 CCCAGCCCTCAGTATGGGGCAGG - Intronic
1195182248 X:102367235-102367257 CCCAGCCCTCAGTATGGGGCAGG + Intronic
1195202480 X:102564549-102564571 CCCAGCCCTCAGTATGGGGCAGG - Intergenic
1197220119 X:123904185-123904207 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1198197430 X:134378860-134378882 CCCAGCTCTCAGGGAGGCAGAGG - Intronic
1199677676 X:150201449-150201471 TCCAGCCCTCAGCCAGGAACCGG + Intergenic
1200781113 Y:7216570-7216592 CCCAGCACTCTGGAAGGCAGAGG + Intergenic