ID: 1108574706

View in Genome Browser
Species Human (GRCh38)
Location 13:51781391-51781413
Sequence CACTGGGTCTGGCACTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 857
Summary {0: 1, 1: 2, 2: 10, 3: 125, 4: 719}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108574706_1108574712 3 Left 1108574706 13:51781391-51781413 CCCACTGAGTGCCAGACCCAGTG 0: 1
1: 2
2: 10
3: 125
4: 719
Right 1108574712 13:51781417-51781439 AGTACTCAGGATACAGACTGAGG 0: 1
1: 0
2: 1
3: 5
4: 145
1108574706_1108574709 -10 Left 1108574706 13:51781391-51781413 CCCACTGAGTGCCAGACCCAGTG 0: 1
1: 2
2: 10
3: 125
4: 719
Right 1108574709 13:51781404-51781426 AGACCCAGTGCTAAGTACTCAGG 0: 1
1: 0
2: 1
3: 18
4: 176
1108574706_1108574713 4 Left 1108574706 13:51781391-51781413 CCCACTGAGTGCCAGACCCAGTG 0: 1
1: 2
2: 10
3: 125
4: 719
Right 1108574713 13:51781418-51781440 GTACTCAGGATACAGACTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1108574706_1108574714 23 Left 1108574706 13:51781391-51781413 CCCACTGAGTGCCAGACCCAGTG 0: 1
1: 2
2: 10
3: 125
4: 719
Right 1108574714 13:51781437-51781459 AGGGCGCCCTGCCCTCTGCCAGG 0: 1
1: 0
2: 2
3: 45
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108574706 Original CRISPR CACTGGGTCTGGCACTCAGT GGG (reversed) Intronic
900301452 1:1980034-1980056 GACGGCGTCTGGCACGCAGTGGG + Intronic
900376968 1:2359279-2359301 CACAGGGCCTGGCACACAGCTGG + Intronic
900615779 1:3565090-3565112 CACAGGGCCTGGCACGCAGTGGG + Intronic
900872072 1:5311305-5311327 CACTGGATGTGGGACCCAGTAGG + Intergenic
901497535 1:9630476-9630498 CCCTGTGTCTGGCACCCAGAGGG - Intergenic
901622965 1:10604054-10604076 CCAGGGGTCTGGCACACAGTAGG - Intronic
901635100 1:10666866-10666888 CACAGGGTCTGGCCCACAGAAGG - Intronic
901688151 1:10955910-10955932 CACTGTGTCAGGCTCTCAGGGGG + Intronic
901689902 1:10965988-10966010 CTCAGGGCCTGGCACACAGTAGG - Intronic
902430207 1:16357128-16357150 CACATGGTCTGGCACATAGTAGG - Intronic
902645910 1:17797826-17797848 CACAGGGCCTGGCCGTCAGTGGG + Intronic
902656521 1:17872890-17872912 CAGTGGTTGTGGGACTCAGTAGG + Intergenic
902703854 1:18191156-18191178 CAGAGGGCCTGGCACTGAGTGGG - Intronic
902719274 1:18293211-18293233 CCCAGGGCCTGGCACACAGTGGG + Intronic
902719728 1:18295943-18295965 CCCAGGGCCTGGCACACAGTGGG + Intronic
902723768 1:18322149-18322171 CACAGGGTCTCGCACACAGGAGG + Intronic
902989246 1:20174713-20174735 CACAGGGCCTGGCACTCATAAGG - Intronic
903021220 1:20396633-20396655 CACTGTGCCTGGCACATAGTAGG + Intergenic
903178930 1:21595785-21595807 CACAGTGTCTGGCACACATTAGG - Intergenic
903289249 1:22297419-22297441 ACCTGGGCCTGGCACTCAGGGGG + Intergenic
903352206 1:22724385-22724407 CACTTTGCCTGGCACACAGTAGG + Intronic
903381835 1:22902631-22902653 CCCAGGGCCTGGCACACAGTGGG - Intronic
903668901 1:25024081-25024103 CACAGTCTCTGGCACACAGTAGG + Intergenic
903673643 1:25051263-25051285 CACTGTGCCTGGCACTCAGTAGG + Intergenic
903747844 1:25600557-25600579 CACAGGGGCTGGCACACAGTAGG - Intergenic
904054391 1:27660424-27660446 CACAGCGCCTGGCACTCAGGAGG - Intergenic
904090112 1:27939150-27939172 CACAGTGTCTGGCATTCAGTAGG + Intronic
904304926 1:29582454-29582476 CACTGTGCCTGGCACACAATAGG - Intergenic
904330309 1:29754256-29754278 CGGTGGGCCTGGCACTCAGTGGG - Intergenic
904342588 1:29846470-29846492 CACAGGGCCTGGCACATAGTAGG - Intergenic
904391617 1:30189783-30189805 CACAGGGGCTGGCACACAGTAGG - Intergenic
904399552 1:30247244-30247266 CACCGGGCCTGGCACATAGTAGG + Intergenic
904447579 1:30587436-30587458 CACAGTGGCTGGCACACAGTGGG - Intergenic
904705991 1:32391234-32391256 CACTGGATTTGGCAAGCAGTAGG + Intronic
905242147 1:36588268-36588290 CTCAGGGCCTGGCACACAGTAGG + Intergenic
905278114 1:36832252-36832274 CACAGTGTCTGGCACATAGTAGG + Intronic
905284955 1:36873191-36873213 CACAGGGCCTGGCACTCAGGTGG + Intronic
905349310 1:37333654-37333676 CACAGTGCCTGGCACACAGTCGG + Intergenic
905775204 1:40663874-40663896 CACAGTGCCTGGCACTCAGGAGG - Intronic
905789109 1:40781042-40781064 GACTGGGCCTGGCACACAGATGG + Intergenic
905847306 1:41243021-41243043 CACTGCGCCTGGCACACAATTGG + Intergenic
906113356 1:43338976-43338998 CCCAGTGTCTGGCACACAGTAGG - Intronic
906212547 1:44020152-44020174 CTCAGGGCCTGGCACACAGTGGG - Intronic
906245848 1:44273551-44273573 CACTGGACCTGGCACACACTAGG - Intronic
906542528 1:46598587-46598609 CACAGTGCCTGGCACACAGTAGG - Intronic
906708948 1:47915104-47915126 AACAGGGCCTGGCACACAGTAGG + Intronic
906947267 1:50305708-50305730 CACAGGGTTTGGCAAACAGTAGG - Intergenic
907041705 1:51266875-51266897 CACGGTATCTGGCACACAGTTGG - Intronic
907297321 1:53463534-53463556 CACAGGGTCTGGCACATAGTAGG + Intronic
907337000 1:53706342-53706364 GACAGAGTCTGGCACACAGTAGG + Intronic
907725386 1:57015526-57015548 CACACAGTCTGGCACTTAGTTGG - Intronic
907776117 1:57517093-57517115 CACAGGGTCAGGCATACAGTAGG + Intronic
907817760 1:57937122-57937144 AATTGGGTCTGGCACATAGTTGG + Intronic
907919935 1:58903032-58903054 CACAGTGCCTGGCACACAGTAGG + Intergenic
908089376 1:60670359-60670381 CACAGGGCCTGGCAATGAGTGGG - Intergenic
908202779 1:61814925-61814947 CACAGTGTCTGGCACAGAGTAGG - Intronic
908403644 1:63793549-63793571 CACTGTGCCTGGCACATAGTAGG - Intronic
908774557 1:67627629-67627651 CACTGCGTTTGGCAATCAGGAGG - Intergenic
909816217 1:79997626-79997648 CACTGTATCTGGTACTTAGTAGG - Intergenic
910437379 1:87219155-87219177 TACAGGGTCTGACACACAGTAGG - Intergenic
910480719 1:87655531-87655553 CTTTGGGTCTGGCAGTCACTCGG - Intergenic
912675140 1:111672870-111672892 CACTGTGTTTGGCATTCATTGGG + Intronic
913084155 1:115419820-115419842 CATTGGGTCTGGCACATAGTAGG - Intergenic
913099147 1:115547003-115547025 CACTGGGTCTGGCAGGTAATGGG - Intergenic
915149537 1:153819074-153819096 CACAGTGCCTGGCATTCAGTAGG + Intronic
915165861 1:153947384-153947406 CCCTAGGTCTGGCAGTGAGTCGG - Intergenic
915354084 1:155245300-155245322 CAGTGGGTCTAACACTCAGTAGG - Intergenic
915478868 1:156171515-156171537 CACAGGATCTGGCACACAGTTGG - Intronic
915524727 1:156468564-156468586 CCCTGGGGCTGGCTCTCAGAAGG + Intronic
915604929 1:156944495-156944517 CACAATGTCTGGCACACAGTAGG - Intronic
915735912 1:158084833-158084855 CACGGTGTCTGGCACACAGTAGG - Intronic
916244778 1:162676653-162676675 CACTGTGCCTTGCACACAGTAGG - Intronic
916820578 1:168394289-168394311 CACAGGGCATGGCACTCAGTAGG + Intergenic
917670892 1:177272424-177272446 CACAGTTTCTGGCACACAGTAGG - Intronic
917815718 1:178708005-178708027 CACAGCCTCTGGCACACAGTAGG - Intergenic
918139902 1:181711418-181711440 AACAGGGTCTGGCACAAAGTAGG - Intronic
919811356 1:201410728-201410750 CTCCTGGTCTGGCACTCAGCAGG + Intronic
920108107 1:203568807-203568829 CACTTGAACTGCCACTCAGTGGG + Intergenic
920137096 1:203778731-203778753 CATGGGGCCTGGCACTCAGAAGG + Intergenic
920230769 1:204468396-204468418 ACCAGGGTCTGGCATTCAGTGGG + Intronic
920354693 1:205362296-205362318 CATTGTGTCTGGCACATAGTGGG - Intergenic
920360596 1:205413221-205413243 CACAGGGTCTTGCACATAGTAGG - Intronic
920442775 1:205992413-205992435 CACTGTGCCTGGCACATAGTGGG + Intronic
920493864 1:206440191-206440213 CACTGTGGCTAGCACACAGTAGG - Intronic
920505200 1:206510788-206510810 CTCTGGGCCTGGCACTCTGCTGG - Intronic
920510772 1:206550426-206550448 CACTGGGCCTTGCACATAGTAGG + Intronic
920685795 1:208108185-208108207 TACTGGGCCTGACACTCTGTGGG - Intronic
920710396 1:208289096-208289118 CTTTGGGTCTGGAACTCAGTAGG + Intergenic
921847510 1:219899625-219899647 CACTGGGACTGGAACTTAGCAGG - Intronic
922297411 1:224263346-224263368 CAGAGGGCCTGGCACTTAGTAGG + Intronic
923023698 1:230187721-230187743 CACTGGAAGTGGCTCTCAGTGGG + Intronic
923115640 1:230935226-230935248 CACTGTCTCTGGCACATAGTAGG - Intronic
923424178 1:233852463-233852485 CACTGTGTCTGGTACACAGTGGG + Intergenic
1064005872 10:11698532-11698554 AACTGTGCCTGGCACACAGTAGG + Intergenic
1064621886 10:17225691-17225713 CACAGTGTCTGTCATTCAGTTGG + Intergenic
1065048611 10:21767079-21767101 CACTGAGTATTGCAATCAGTGGG + Intronic
1065341448 10:24710603-24710625 CTCAGTGTCTGGCACTCAGAAGG + Intronic
1065865756 10:29913918-29913940 CACTGTGTCTGGCACATAGTAGG + Intergenic
1068744574 10:60515876-60515898 CACTGGGCCTGGTACATAGTTGG - Intronic
1068854428 10:61782877-61782899 CACAATGTCTGGCACCCAGTAGG + Intergenic
1068957311 10:62829832-62829854 CCCAGGGCCTGGCACTCAGTAGG - Intronic
1069009397 10:63354125-63354147 CACTGCGCCTGGCCCTGAGTTGG + Intronic
1069446707 10:68479456-68479478 CACAAGGTCTGGCACACAATTGG + Exonic
1069456511 10:68558318-68558340 AATTGTGTCTGGCACTAAGTAGG + Intergenic
1069565180 10:69459277-69459299 CACAGTGCCTGGCATTCAGTAGG - Intronic
1069747325 10:70724062-70724084 CACAGTGCCTGGCACACAGTAGG + Intronic
1070189587 10:74099594-74099616 CTCAGGGTCTGGCACATAGTAGG + Intronic
1070491677 10:76982418-76982440 CACAGGGCCTGGCACTCAGGGGG + Intronic
1070697709 10:78575038-78575060 TACTGCGCCTGGCACACAGTAGG - Intergenic
1070733577 10:78848398-78848420 CATAGGGTCTGGCACATAGTAGG - Intergenic
1071465496 10:85935953-85935975 CACTGGCTCTGGCACATAGTAGG - Intronic
1071779465 10:88826913-88826935 CACAGCGTCTGGCACATAGTAGG + Intronic
1071958730 10:90787156-90787178 CAGTGTGTCTGGCACATAGTAGG - Intronic
1072218919 10:93311079-93311101 CACAGTGGCTGGCATTCAGTAGG + Intronic
1072660551 10:97361058-97361080 CCCAGGGCCTGGCACTTAGTAGG - Intronic
1072739122 10:97899155-97899177 ATCTGGGACTGGCACTCAGCTGG - Intronic
1072790823 10:98316503-98316525 CACGGTGCCTGGCACACAGTAGG - Intergenic
1073102383 10:101013286-101013308 TACAGGGCCTGGCACTTAGTAGG - Intronic
1073571186 10:104582392-104582414 GACGGTGGCTGGCACTCAGTGGG - Intergenic
1074077014 10:110137777-110137799 CACAGGGTCTGGCACACAGATGG - Intergenic
1074149322 10:110744231-110744253 CACAGTGCCTGGCACACAGTAGG + Intronic
1074527556 10:114275418-114275440 CACTGTGTCTGGCACAATGTGGG - Intronic
1074818138 10:117159483-117159505 GACTGGGTCAGAAACTCAGTTGG + Intergenic
1075075848 10:119349644-119349666 CATTGGGTCTGCCTCTCTGTAGG + Intronic
1075591393 10:123694050-123694072 CACAGGGCCTGGCACACAGTAGG - Exonic
1075679793 10:124323842-124323864 CAAGGGGCCTGGCACGCAGTAGG + Intergenic
1075913274 10:126144844-126144866 CACCGAGCCTGGCACTCAGTCGG - Intronic
1076074863 10:127525249-127525271 CACAGTGACTGGCACACAGTAGG + Intergenic
1076989798 11:267149-267171 AACAGGGCCTGGCACCCAGTGGG - Intergenic
1077479753 11:2808031-2808053 CACTGGGCCAGGTGCTCAGTGGG - Intronic
1077544102 11:3161548-3161570 CCCAGGGGCTGGCACACAGTAGG - Intronic
1077661601 11:4073559-4073581 CACAGGGCTTGGCACTTAGTAGG + Intronic
1077795846 11:5491176-5491198 CACAGTGTCTGGCACACAGTAGG + Intronic
1078358792 11:10652527-10652549 GACAGGGCCTGGCACCCAGTAGG - Intronic
1078463681 11:11534448-11534470 CACAGGGTCTGGCATGGAGTTGG - Intronic
1078563840 11:12396602-12396624 AACAGGGCCTGGCCCTCAGTGGG + Intronic
1078740796 11:14064622-14064644 CACAGGGTGTGGCACACAGTAGG - Intronic
1079005018 11:16785447-16785469 CACAGGGCCTGGCACACAGTGGG - Intronic
1080615996 11:33945357-33945379 CACAGTGCCTGGCACACAGTAGG - Intergenic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1080752515 11:35164028-35164050 CACAGAGCCTGGCACACAGTAGG + Intronic
1081482969 11:43506187-43506209 CACTGTGTCTGGCACACAGCAGG - Intergenic
1081600364 11:44488509-44488531 CAGTGTGGCTGGCAGTCAGTGGG - Intergenic
1081670397 11:44939109-44939131 CACAGGGGCTGGCACGCAGTAGG - Exonic
1083180111 11:60979802-60979824 CACAGGGCCTGGTACTCAGCAGG - Intronic
1083190608 11:61049304-61049326 CACAGTGCCTGGCATTCAGTAGG + Intergenic
1083814535 11:65125266-65125288 CACAGGGCCTGGCACTAAGTAGG - Intronic
1083937290 11:65876564-65876586 CACTGTGGCTGGCACAGAGTGGG - Intergenic
1084105623 11:66978412-66978434 CTCTGGGCCTGGCACATAGTAGG + Intergenic
1084435577 11:69137383-69137405 CACTGTGCCTGGCACACAGTAGG + Intergenic
1084603818 11:70161523-70161545 CACTGGCACAGTCACTCAGTCGG - Intronic
1084855597 11:71983642-71983664 CACAGGGCCTGGCACACAGTAGG - Intronic
1084873710 11:72115317-72115339 AAAGGTGTCTGGCACTCAGTTGG - Intronic
1084916409 11:72432262-72432284 CACAGTGTCTGGAACTTAGTAGG - Intronic
1084967756 11:72753211-72753233 CACTGGGACTAGCATGCAGTAGG - Intronic
1085019286 11:73195093-73195115 CACTGTGCCTGGCACATAGTAGG - Intergenic
1085254187 11:75163157-75163179 CACAGCGCCTGGCACCCAGTGGG - Intronic
1085306512 11:75488992-75489014 CACTGGGCCTGGCACCAAGGAGG + Intronic
1085532123 11:77198127-77198149 CACAGGGCCTGGCACACAGCAGG - Intronic
1085548731 11:77346683-77346705 CACAGAGCCTGGCACACAGTTGG - Intronic
1085641244 11:78194336-78194358 CACTGGGTCTAGTACATAGTTGG + Intronic
1085753074 11:79178772-79178794 CACAGTATCTGGCACACAGTAGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1085786827 11:79459568-79459590 CACAGGGTTTGGCACACAGTAGG - Intergenic
1085850906 11:80118553-80118575 CACAGTGTCTGGCACATAGTAGG - Intergenic
1086336469 11:85806139-85806161 CACTGTTCCTGGCACTCAATGGG - Intronic
1086499390 11:87436598-87436620 CACAATGTCTGGCACACAGTAGG + Intergenic
1086551660 11:88059644-88059666 CACTGTGCCTGGAACACAGTAGG - Intergenic
1087373308 11:97313145-97313167 AACAGTGTCTGGCACACAGTAGG - Intergenic
1088983856 11:114888560-114888582 CACTGGGTCAGGCACTATGTTGG - Intergenic
1089342716 11:117770249-117770271 CACTGTGCCTGGCACCCAGCAGG + Intronic
1089583011 11:119493207-119493229 GACTAGGTCTGGCACAAAGTAGG + Intergenic
1089871949 11:121682787-121682809 CCCTGTGTATGGCACTCAGTAGG - Intergenic
1090137642 11:124215172-124215194 CACTGCTTCTGGCTCACAGTGGG + Intergenic
1090138392 11:124225149-124225171 CACTGCTTCTGGCTCACAGTGGG + Intergenic
1090155695 11:124436227-124436249 CACATGGTCTGGCACTTACTAGG + Intergenic
1090200679 11:124853252-124853274 CTCGGTGTCTGGCACTTAGTAGG + Intergenic
1090421747 11:126580175-126580197 CACTGTGTCTGGTCCACAGTAGG + Intronic
1090451778 11:126812535-126812557 CACGGTGTCTGGCACACAGTAGG + Intronic
1090452391 11:126818184-126818206 CACTTCGTCTGGCACGCAGCTGG - Intronic
1091641677 12:2241833-2241855 CAGTGTGCCTGGCACGCAGTGGG + Intronic
1091662654 12:2396136-2396158 CCCTGGGTCTGACACTCTGATGG + Intronic
1091784111 12:3231890-3231912 GCCTGGGCCTGGCTCTCAGTGGG + Intronic
1092291309 12:7160875-7160897 CACAGGGCCTGGCACACAGTAGG + Intergenic
1093348154 12:18065844-18065866 CACAGTGTCTGGCACATAGTTGG - Intergenic
1093484966 12:19642395-19642417 TACTGTGTCTGGCACACAGCAGG + Intronic
1094352696 12:29544452-29544474 CACTGGGGATGGCACAGAGTAGG + Intronic
1094444419 12:30514275-30514297 CACAGGGTCTGGCAGAGAGTAGG - Intergenic
1094490746 12:30959136-30959158 CACTGAGTCTCACACTCACTGGG + Intronic
1095644429 12:44526537-44526559 CACTGAGTTGGGGACTCAGTGGG + Intronic
1096103975 12:48986111-48986133 CACAGGGTCTGGCATTCAGCTGG - Intergenic
1096153225 12:49327653-49327675 AACAGAGCCTGGCACTCAGTAGG - Intronic
1096555764 12:52402739-52402761 CACAGTGTCTGGCATTGAGTAGG + Intronic
1096634122 12:52947925-52947947 AACTGGGCCTGGCTCACAGTAGG + Intronic
1096638717 12:52977386-52977408 CACTGTGTCTGACACACATTTGG - Intergenic
1097285074 12:57870865-57870887 CACAGTGCCTGGCACACAGTAGG + Intergenic
1097880001 12:64678264-64678286 CACTGGGTATTGCAGTCTGTTGG + Intronic
1098092884 12:66922868-66922890 CTCTGAGCCTGGCACACAGTGGG + Intergenic
1098307967 12:69120320-69120342 GACAGTGTCTGGCACACAGTAGG + Intergenic
1098880073 12:75908007-75908029 CACAGTGCCTGGCACTCTGTTGG + Intergenic
1099968751 12:89478523-89478545 CACAGTGCCTGGCACTGAGTAGG + Intronic
1100467228 12:94857053-94857075 CATTGGGCCTGGCACATAGTAGG - Intergenic
1100668873 12:96787646-96787668 CAGTGTCTCTGGCACACAGTAGG - Intronic
1101030101 12:100650003-100650025 CACAGTGTCTGGCACAAAGTAGG - Intergenic
1101050611 12:100859775-100859797 CACTAGGTGTGGCATTTAGTGGG + Intronic
1101262840 12:103050165-103050187 CACTGTGCCTGGCACACAGCAGG + Intergenic
1101330632 12:103755156-103755178 CTCTGTGCCTGGCACACAGTAGG - Intronic
1101786340 12:107886928-107886950 CACTGTGCCTGGCATTGAGTTGG - Intergenic
1102224855 12:111221001-111221023 CCCAGGGTCTGGCACACCGTTGG + Intronic
1102453577 12:113057714-113057736 CGCAGGGTCTGGGACGCAGTTGG + Exonic
1102548268 12:113672177-113672199 CACTGGGTCTTGTACACAGTTGG - Intergenic
1102859752 12:116325553-116325575 CACAGGGCCTGGCACACAGTAGG - Intergenic
1103158005 12:118703504-118703526 CATTGGGTCAGGCAAACAGTGGG + Intergenic
1103196610 12:119049000-119049022 AACAGTGTCTGGCACACAGTAGG - Intronic
1103587676 12:121968244-121968266 CACAGTGCCTGGCACGCAGTAGG - Intronic
1103742583 12:123101095-123101117 CACTGTGTCAGGCACTTATTAGG - Intronic
1103970863 12:124670588-124670610 CCCTGCGTCAGGCACACAGTAGG + Intergenic
1103981837 12:124741828-124741850 CACGGGGTCTGGTAGGCAGTTGG - Intergenic
1104275485 12:127323223-127323245 AACCTGGCCTGGCACTCAGTAGG - Intergenic
1104364105 12:128161593-128161615 CACAGTGCCTGGCACACAGTAGG - Intergenic
1105482887 13:20795366-20795388 CATTGTGTCTGACAATCAGTAGG - Intronic
1105539520 13:21303448-21303470 GACAGTGTCTGGCACACAGTAGG - Intergenic
1106030717 13:25999700-25999722 CATTGGGTCTCACACACAGTAGG + Intronic
1106209859 13:27631735-27631757 AACTGGGTCAGGCACACAGTAGG + Intronic
1106229028 13:27807592-27807614 CCCAGGGCCTGGCACACAGTGGG + Intergenic
1106556057 13:30809607-30809629 CACAGTGCCTGGCACACAGTAGG - Intergenic
1107555391 13:41513238-41513260 CACAGGGCCTGGCACGGAGTGGG - Intergenic
1107707488 13:43122220-43122242 CACAGGGCCTGGCACTCAGTGGG - Intergenic
1107827404 13:44340969-44340991 CACTGTGCCTGGCACTTAGTAGG - Intergenic
1107928984 13:45290856-45290878 CCCTGTGCCTGGCACACAGTGGG - Intergenic
1108574706 13:51781391-51781413 CACTGGGTCTGGCACTCAGTGGG - Intronic
1108669661 13:52672357-52672379 CACTGTTTCTGGCACAGAGTAGG + Intronic
1108681867 13:52787472-52787494 CACAGAGCCTGGCACACAGTGGG + Intergenic
1108714454 13:53065103-53065125 CACAGTGTCTAGCACACAGTAGG - Intergenic
1108969264 13:56351292-56351314 CACTGGCTCTGCCACCCAGTGGG - Intergenic
1112446189 13:99466387-99466409 CACTGCGCCTGGCCCTCAATAGG + Intergenic
1112602430 13:100869535-100869557 CTGTGGATCTGGCACACAGTGGG - Intergenic
1112727279 13:102318855-102318877 GACAGGGTTTGGCACACAGTAGG + Intronic
1112867119 13:103918090-103918112 AACATGGTCTGGCACACAGTAGG - Intergenic
1113061439 13:106326394-106326416 CACGGGATCTAGCACACAGTAGG - Intergenic
1113074129 13:106451471-106451493 CACTGTGGCTGGCACTGTGTTGG - Intergenic
1113784866 13:112997140-112997162 CTCTGGGTCTGCCACTGAGCTGG - Intronic
1114447125 14:22797447-22797469 CACAGGGCCTGGAACACAGTGGG - Intronic
1114638780 14:24205175-24205197 CACAGTGTCTGGTACTTAGTAGG + Intronic
1115607317 14:35016753-35016775 CACAGTGTCTGGCACATAGTAGG + Intronic
1115909491 14:38239967-38239989 CATTGGATCTGGCACAAAGTGGG + Intergenic
1116896799 14:50323680-50323702 CACTGGGCCTGGCCCTATGTGGG + Intronic
1117553671 14:56862396-56862418 CCCTGTGCCTGGCACACAGTGGG - Intergenic
1118040349 14:61909563-61909585 CACTGGATTTGGGACTCATTGGG + Intergenic
1118333199 14:64830259-64830281 TACTGGGCCTGGGACTTAGTAGG + Intronic
1118713952 14:68546088-68546110 CACAAAGTCTGGCACACAGTGGG + Intronic
1119273068 14:73326777-73326799 CACAGTTTCTGGCACACAGTAGG - Intronic
1119746792 14:77050367-77050389 GACAGGGTCTGGCACATAGTAGG + Intergenic
1120748906 14:88179308-88179330 CACTTGCTCTGACACACAGTTGG + Intergenic
1120875747 14:89373670-89373692 CACAGTGCCTGGCACACAGTAGG + Intronic
1121052147 14:90826523-90826545 CACTGTGTCCGGCACATAGTAGG - Intergenic
1121245851 14:92460352-92460374 CACTGTGTCTGGCACACAGTAGG + Intronic
1121248459 14:92482082-92482104 CACGGGGCCTGGCACACAGCAGG - Intronic
1121380913 14:93465353-93465375 CACACTGTCTGGCACTTAGTAGG - Intronic
1121399620 14:93661985-93662007 AACTCTGTCTGACACTCAGTAGG + Intronic
1121447411 14:93987847-93987869 CACTGCTTCTGGCACTTAGCAGG - Intergenic
1121720784 14:96107250-96107272 CACAGGGTCTAGCACACAGGAGG - Intergenic
1121736884 14:96224998-96225020 CACTGGGTGTGGCACAAAGGAGG - Intronic
1121884616 14:97532145-97532167 CACTGTGTTTGGCACTCATTTGG - Intergenic
1121935846 14:98017785-98017807 CACTGGGTCTCACACACAGTAGG - Intergenic
1122103310 14:99430960-99430982 TATTGTGTCTGGCACACAGTAGG - Intronic
1122271799 14:100571611-100571633 CACAGAGACTGGCACACAGTAGG + Intronic
1122406082 14:101501923-101501945 CACAGGGCCTGGCACTCAGCTGG + Intergenic
1124232682 15:27959010-27959032 CAGTAGGTCTGCCACGCAGTGGG - Intronic
1125748935 15:42015575-42015597 CATAGGGCCTGGCACACAGTAGG - Intronic
1126939714 15:53753787-53753809 CACAAGGTCTGGAACACAGTTGG - Intronic
1127228299 15:56959150-56959172 CACAGTGTCTGGCACACAGTAGG + Intronic
1127334709 15:57972198-57972220 TCCTGGCTCTGCCACTCAGTGGG - Intronic
1127958815 15:63875835-63875857 CACTGGGTCTGGTGCCCAATCGG - Intergenic
1128255507 15:66193372-66193394 CACAGCGTCTGGCACTTAGTAGG - Intronic
1128261000 15:66232763-66232785 CACAGGGCCTGGCACACGGTAGG - Intronic
1128453083 15:67818407-67818429 CCCAGGGCCTGGCACTTAGTAGG - Intergenic
1128474598 15:67986373-67986395 CATTGTGTCTGGCACATAGTAGG + Intergenic
1128727194 15:69997055-69997077 CACCGGGCCTGGCACTGAGAAGG - Intergenic
1128752884 15:70161545-70161567 CAAGGTGTCTGGCACACAGTAGG + Intergenic
1129685633 15:77684787-77684809 CCCTGGGCCTGGCACACAGTAGG - Intronic
1129695130 15:77736363-77736385 CCCAGGGTCTGGCACACAGTAGG - Intronic
1129704179 15:77785170-77785192 CTCAGGGCCTGGCACACAGTGGG + Intronic
1130369092 15:83268347-83268369 TTCTGGGCCTGGCACACAGTGGG - Intronic
1130944101 15:88538059-88538081 CACTGGGACTGGCACATGGTAGG + Intronic
1131118429 15:89808456-89808478 CACAGTGCCTGGCACACAGTAGG + Intronic
1131303976 15:91224791-91224813 CACATGTTCTGGCACACAGTAGG + Intronic
1131514801 15:93070152-93070174 CACTGAGTCAGGAACCCAGTAGG + Intronic
1132391434 15:101441479-101441501 CACAGGGTCCTGCACTCAGCAGG + Intronic
1132422895 15:101689221-101689243 GACTGTGTCTGGAATTCAGTGGG + Intronic
1133580638 16:7141304-7141326 CACTGTGTCTGGTATTCCGTGGG - Intronic
1133618041 16:7497607-7497629 CACTGTGTCTGGTCCCCAGTAGG - Intronic
1133743025 16:8665694-8665716 CACAGCGTCTGGCACACAGCAGG - Intergenic
1133826830 16:9285447-9285469 CACTGTGCCTGGCACACAGTTGG + Intergenic
1134017372 16:10898566-10898588 CTCTGGGCCTGGCACACAGTGGG - Intronic
1134019885 16:10914154-10914176 CCCTGGGCCTGGCACATAGTAGG + Intronic
1134051889 16:11143136-11143158 CACAGGGCGTGGCACACAGTAGG - Intronic
1134186060 16:12085913-12085935 CACCATGTCTGGCACACAGTAGG - Intronic
1134502346 16:14779151-14779173 CTTAGGGCCTGGCACTCAGTAGG + Intronic
1134578216 16:15349743-15349765 CTTAGGGCCTGGCACTCAGTAGG - Intergenic
1134724375 16:16407803-16407825 CTTAGGGCCTGGCACTCAGTAGG + Intergenic
1134943056 16:18304056-18304078 CTTAGGGCCTGGCACTCAGTAGG - Intergenic
1135020831 16:18961731-18961753 CACAGGCCCTGGGACTCAGTGGG + Intergenic
1135042489 16:19128576-19128598 GCCTGAGTCTGGCACGCAGTGGG - Intronic
1135201320 16:20439984-20440006 CACAGGGCCTGGCTCTGAGTGGG - Intronic
1135217788 16:20587880-20587902 CACAGGGCCTGGCTCTGAGTGGG + Intergenic
1135614233 16:23897049-23897071 CACAGGGTCTGGCACACAGTAGG - Intronic
1135633647 16:24055882-24055904 CACTGTGTCTGGCACTTAGTAGG - Intronic
1135953967 16:26940226-26940248 CACGGGGGCAGGCACTCAGCAGG + Intergenic
1136124702 16:28169582-28169604 CCCAGGGTCTAGCACACAGTAGG - Intronic
1136174496 16:28507682-28507704 GACTGGGACTGGGACTCAGCAGG + Intronic
1136400152 16:30012395-30012417 AACTGGGCCTGGCACGAAGTCGG + Intronic
1136538214 16:30912983-30913005 CCCTGGTGCTGGCACACAGTAGG - Intergenic
1136628306 16:31474971-31474993 CACAGTGCCTGGCACACAGTAGG - Intronic
1137576212 16:49602017-49602039 CACTGGGTCTTGCATACAGTTGG + Intronic
1137645277 16:50067794-50067816 CTCAGTGTCTGGCACACAGTTGG - Intronic
1137706626 16:50539925-50539947 CACTGTGGCTGGCACACAGTAGG - Intergenic
1137732943 16:50702678-50702700 TACAGTGTCTGGCACACAGTAGG - Intronic
1138163872 16:54781460-54781482 CATAGGATCTGTCACTCAGTTGG - Intergenic
1138337764 16:56266673-56266695 GGGAGGGTCTGGCACTCAGTAGG - Intronic
1138399281 16:56732285-56732307 ACCTAGGTCTGGCACACAGTAGG + Intronic
1138822534 16:60278958-60278980 CACAGGGCCTGGCACACAGCAGG + Intergenic
1139510861 16:67427904-67427926 CACAGGGCCTGGCATGCAGTAGG + Intergenic
1139520312 16:67479007-67479029 GACAGGGCCTGGCACACAGTTGG - Intronic
1139588083 16:67917100-67917122 CCCTGGGTCTGCTACTTAGTGGG - Intronic
1139594533 16:67950149-67950171 CCCTGGGCCTGGCACTCACCTGG - Intronic
1139657324 16:68396945-68396967 CACAGTGCCTGGCACACAGTGGG - Intronic
1139786243 16:69394580-69394602 CATAGGGTCTTGCACTCAGCAGG + Intronic
1141134046 16:81454213-81454235 CACTGTGCCCGGCACACAGTAGG - Intronic
1141158575 16:81613606-81613628 CACTGTGCCTGGTACTTAGTAGG + Intronic
1141203454 16:81914610-81914632 CACAGGGCCCGGCACACAGTAGG - Intronic
1141677695 16:85526201-85526223 AGCTGGGCCTGGCACACAGTAGG - Intergenic
1141764554 16:86049883-86049905 CACTGGGCCTGGCGCACAGGAGG - Intergenic
1142505131 17:358333-358355 CATGGGGTCTGGCACATAGTAGG - Intronic
1142612150 17:1114904-1114926 AACTGTGCCTGGCACACAGTAGG - Intronic
1143019464 17:3909354-3909376 CACAGTGCCTGGCACTCAGTGGG + Intronic
1143243343 17:5462595-5462617 CACTGTGTCCGGCACTAAGTTGG + Intronic
1143276694 17:5716741-5716763 TACAGGGTCAGGCACACAGTAGG + Intergenic
1143478208 17:7214865-7214887 CACAGGGCCTAGCACGCAGTAGG + Intronic
1143829397 17:9638963-9638985 CAGGGGGTCTGGCACATAGTAGG + Intronic
1143883981 17:10052522-10052544 CGCAGTGTGTGGCACTCAGTTGG - Intronic
1143974669 17:10821088-10821110 CACAGGGTCTGGCACAGAGGAGG + Intergenic
1144074945 17:11708888-11708910 CACTGTGTCTAGCACACAATGGG + Intronic
1144789458 17:17849380-17849402 CACAGGGCCTGTCACTCAGTAGG + Intronic
1144830374 17:18127719-18127741 GCCTGGGACTGGCACACAGTAGG - Intronic
1144830731 17:18129774-18129796 CAATGTGTCTGGCACACAGTAGG + Intronic
1144882038 17:18435318-18435340 CACAGTGTCAGGCACACAGTAGG + Intergenic
1144944815 17:18964464-18964486 CCCAGGGCCTGGCACACAGTAGG - Intronic
1145142049 17:20454460-20454482 CACAGTGCCTGGCACTCACTAGG - Intronic
1145150195 17:20509068-20509090 CACAGTGTCAGGCACACAGTAGG - Intergenic
1145260841 17:21353615-21353637 CACAGTGCCTGGCACACAGTAGG - Intergenic
1145793857 17:27644443-27644465 CACTGTGCCTGGCACTCAGTAGG + Intronic
1145811578 17:27767449-27767471 CACAGTGTCTGACACACAGTAGG + Intronic
1146406295 17:32541705-32541727 CACAGGACCTGGCACGCAGTAGG + Intronic
1146489597 17:33270849-33270871 CACTGGGCCTGGCATAGAGTAGG - Intronic
1146626548 17:34439509-34439531 CCCTGGGTGTGGCACACAGTAGG + Intergenic
1147184969 17:38708151-38708173 CACCAGGTCTGGCACATAGTAGG - Intronic
1147251024 17:39152329-39152351 GATTGGGTCTGGCCCTGAGTAGG - Intronic
1147457645 17:40548132-40548154 CACAGTGCCTGGCACTCAGTAGG + Intergenic
1147653225 17:42073626-42073648 CACAGGGTCCAGCACACAGTGGG + Intergenic
1148204577 17:45771813-45771835 CACTGGGCCCGGCACACAGCAGG - Intergenic
1148219309 17:45850646-45850668 CACTGGACCTGGCACATAGTAGG + Intergenic
1148467003 17:47871099-47871121 AACAGTGTCTGGCACACAGTAGG + Intergenic
1148697355 17:49568541-49568563 AACAGCGTCTGGCACACAGTAGG - Intergenic
1148773009 17:50077691-50077713 CTCAGGGGCTGGCACACAGTTGG - Intronic
1148780197 17:50117226-50117248 CACAGGATCTGGCACTTAGTAGG + Intronic
1148866713 17:50632630-50632652 CACTGGGTTGGGCACTCTGAGGG - Intergenic
1148905614 17:50909949-50909971 CACAGGGACTGGCACACAGGTGG - Intergenic
1149441220 17:56675703-56675725 CACAGGGCCTGGCACTGAGTAGG + Intergenic
1149512443 17:57255364-57255386 CACGGGTTCTGGCATACAGTAGG - Intergenic
1150161851 17:62905114-62905136 CATAGAGTCTGGCACACAGTAGG + Intergenic
1151680114 17:75618728-75618750 CACAGGCTCTAGCACACAGTAGG + Intergenic
1151943768 17:77308174-77308196 CCAGGGGTCTGGCACCCAGTTGG - Intronic
1152348279 17:79768258-79768280 CACAGGGCCTGGCACACAGTGGG + Intergenic
1152386433 17:79977511-79977533 CACAGGGCCTGGCACGCAGCAGG + Intronic
1152613318 17:81326394-81326416 CAACGGGTCTGGCCCTCAGAAGG + Intronic
1153528459 18:6019991-6020013 CTTAGGGTCTGGCACACAGTAGG - Intronic
1155174557 18:23291036-23291058 AACAGAGCCTGGCACTCAGTAGG + Intronic
1156221700 18:35059484-35059506 AACTGTGTGTGGCACACAGTAGG - Intronic
1156234770 18:35191804-35191826 CACAGCGTCTGGCACATAGTAGG - Intergenic
1157550075 18:48575348-48575370 CACGGGGTCTGGATCCCAGTGGG - Intronic
1157805361 18:50653933-50653955 ATCTGGAGCTGGCACTCAGTCGG - Intronic
1160737809 19:672290-672312 CCCAGGGCCTGGCACACAGTGGG + Intergenic
1161457768 19:4378102-4378124 CACAGGGCCTGGCACCCAGGTGG + Intronic
1161493046 19:4572857-4572879 CATGGGGCCTGGCACACAGTAGG + Intergenic
1161503984 19:4634180-4634202 AACAGGGCCTGGCACACAGTAGG - Intergenic
1161609633 19:5234674-5234696 CACAGTGCCTGGCACGCAGTAGG - Intronic
1161609644 19:5234742-5234764 CACAGTGCCTGGCACACAGTAGG - Intronic
1161625054 19:5321588-5321610 CTCTGGGCCTGGCACACAGTGGG - Intronic
1161631796 19:5360667-5360689 CACAGGGTCTGGCACACACAGGG - Intergenic
1161664279 19:5565480-5565502 CATGGAGTCTGGCACACAGTAGG + Intergenic
1161701423 19:5797999-5798021 CACAGGGTCTGGTACACAGGAGG + Intergenic
1162185238 19:8899813-8899835 CCTTGGGTCTGGTACACAGTAGG + Intronic
1162320230 19:9967229-9967251 CACTGGGCCAGGCACACACTAGG - Intronic
1162337223 19:10069364-10069386 AACAGGGTCTGGCACACAGTAGG - Intergenic
1163346266 19:16744498-16744520 CACTTGGCCTGGCAGTCAGATGG - Exonic
1163579963 19:18132600-18132622 CAGAGGGTCTGGCATGCAGTAGG - Intronic
1163597844 19:18230880-18230902 CACAGGGCCTGCCACCCAGTAGG + Intronic
1163598972 19:18236728-18236750 TACAGGGCCTGGCACACAGTGGG + Intronic
1163625586 19:18387649-18387671 CACTGTGCCTGGCACACAATAGG - Intronic
1164207255 19:23069259-23069281 CACTGGGTCTTGTACCCAGGTGG - Intergenic
1164210723 19:23095210-23095232 CACTGGGTCTTGTACCCAGGTGG + Intronic
1164243186 19:23408110-23408132 CACTGGGTCTTGTACCCAGATGG - Intergenic
1164616056 19:29667383-29667405 CACAGTGTCTGGCACACAGTGGG + Intronic
1164820913 19:31250783-31250805 CACTGAGCCTGACACACAGTAGG + Intergenic
1165324820 19:35108462-35108484 CCCAGGGTCTGGCACATAGTAGG - Intergenic
1165990966 19:39813446-39813468 CACAGGGCCTGGCACTCAGTAGG - Intergenic
1165995242 19:39839464-39839486 AGCAGGGTCTGGCACACAGTAGG - Intronic
1166067632 19:40369489-40369511 AACAGGGCCTGGCACACAGTAGG + Intronic
1166265851 19:41683809-41683831 CACTGCGGCTGGCACCCACTGGG + Exonic
1166271189 19:41715203-41715225 CACTGCGCCTGGCACTCACTGGG - Exonic
1166318941 19:42004483-42004505 CCCAGGGTCTGGCACACAGTTGG - Intronic
1166431639 19:42732808-42732830 CACTGCGGCTGGCACTCACTGGG + Exonic
1166434754 19:42758026-42758048 CACTGCGGCTGGCACTCACTGGG + Exonic
1166444627 19:42848047-42848069 CACTGCGGCTGGCACTCACTGGG + Intronic
1166447610 19:42871791-42871813 CACTGCGGCTGGCACTCACTGGG + Exonic
1166452065 19:42910604-42910626 CACTGCGGCTGGCACTCACTGGG + Exonic
1166454520 19:42929466-42929488 CACTGCGGCTGGCACTCACTGGG + Exonic
1166481599 19:43178903-43178925 CACTGTGGCTGGCACTCACTGGG + Intronic
1166484071 19:43198021-43198043 CACTGCGGCTGGCACTCACTGGG + Exonic
1166491181 19:43261884-43261906 CACTGCGACTGGCACTCACTGGG + Exonic
1166521460 19:43483043-43483065 CCCAGGGTCTAGCACACAGTAGG + Intronic
1166728556 19:45044202-45044224 CACTGGGTCTGGCGCACCATGGG - Intronic
1166774442 19:45303685-45303707 CACTGGGCCTGGCATGGAGTAGG - Exonic
1166838489 19:45681983-45682005 TACTGGGCCTGGCACGCAGTTGG - Exonic
1167717943 19:51155893-51155915 AACAGTGTCTGGCACACAGTAGG - Intergenic
1168180826 19:54662169-54662191 CACAGGGTCTGGGCCTCAGGAGG - Exonic
1168524286 19:57076320-57076342 CACAAGGTCTGGCAAACAGTAGG - Intergenic
925724910 2:6863333-6863355 CACAGGGCCTGCCACACAGTAGG + Intronic
925917213 2:8615362-8615384 CCCTGGATGTGGCACACAGTAGG + Intergenic
926611479 2:14952429-14952451 CACAGGGCCTGGAACTGAGTGGG - Intergenic
927091301 2:19714833-19714855 CTCCAGGTCTGGCACACAGTGGG - Intergenic
927151076 2:20196547-20196569 CACTGTGCCTGGCACATAGTAGG + Intergenic
927157551 2:20229999-20230021 CCCTGGGCCTGGCTCCCAGTAGG - Intergenic
927515491 2:23669544-23669566 CACAGGGCCCGGCACACAGTGGG + Intronic
927712125 2:25332505-25332527 GCCTGTGTCTGGCACACAGTAGG + Intronic
928088190 2:28358704-28358726 CAATGGGCCTGGCACGCAGTTGG - Intergenic
928201712 2:29251445-29251467 CTCAGGGTCTGGCACATAGTAGG - Intronic
928289753 2:30026800-30026822 CTCTGGCTCTGCCACACAGTCGG - Intergenic
929037501 2:37708615-37708637 CATGGTGTCTGGCACACAGTAGG - Intronic
929317476 2:40497319-40497341 CACAGTGTCTGACACACAGTGGG - Intronic
929575099 2:43046509-43046531 CACAGGGCCTGGCACCAAGTAGG - Intergenic
930236850 2:48896843-48896865 CACAGAGTCTGGCACATAGTAGG - Intergenic
930741489 2:54836695-54836717 CACAGGGCCTGGTACTCAGGAGG + Intronic
932216119 2:69967033-69967055 CATGGTGTCTGGCACACAGTAGG - Intergenic
933593339 2:84257663-84257685 CACTGAGTCTGGTACACAGTAGG + Intergenic
934301330 2:91778074-91778096 CACTGGGTCTGGCAGTGTGGGGG + Intergenic
934647990 2:96070446-96070468 CACTGCATCTGGAACTCAGATGG - Intergenic
934841365 2:97626267-97626289 CACTGCATCTGGAACTCAGATGG - Intergenic
934930631 2:98419715-98419737 CACAGGGGCTGGCACAGAGTGGG + Intergenic
935194378 2:100803579-100803601 CATTGGTTCCGGCACTCAGATGG + Intergenic
935645042 2:105328059-105328081 CACAGGGTCTGGCATTTAGTAGG - Intronic
937098923 2:119253882-119253904 CCCAGGGCCTGGCACACAGTAGG + Intronic
939256806 2:139754562-139754584 CACTGGGTCTCTCCCACAGTAGG - Intergenic
940134879 2:150424990-150425012 CACAGTGCCTGGCACACAGTGGG - Intergenic
940290299 2:152071993-152072015 AACTGTGTCTGGCACATAGTGGG - Intronic
940389517 2:153115672-153115694 CATTGGTCCTGGCACACAGTAGG + Intergenic
941962420 2:171266807-171266829 CACAGGGCCTGGTACACAGTAGG + Intergenic
942375043 2:175328109-175328131 AACAGTGTCTGGCACACAGTAGG + Intergenic
942569372 2:177297861-177297883 CACAGTTCCTGGCACTCAGTAGG + Intronic
942659015 2:178244476-178244498 CACTGTGTCTGGCACATATTAGG + Intronic
944422101 2:199542305-199542327 CACAGGGTCTGGCACATAGTAGG + Intergenic
944615286 2:201452527-201452549 CACGGTGCCTGGCACCCAGTAGG + Intronic
944846614 2:203674803-203674825 AACTGTCTCTGGCACTTAGTAGG - Intergenic
946177277 2:217929420-217929442 CCCTGGGCCTGGCACTCCATAGG - Intronic
946340779 2:219066766-219066788 AACAGTGTCTGGCACTTAGTAGG - Intergenic
946408819 2:219506543-219506565 CACAGGGCCTGGCACACAGCAGG - Intronic
946451770 2:219786000-219786022 CACTGTGCCTGGCACACAGTAGG + Intergenic
946716292 2:222557283-222557305 CACTGTGTTTGGCAAACAGTAGG + Intronic
947363653 2:229372122-229372144 CACTGTGCCTGGCACATAGTAGG - Intronic
947718058 2:232351665-232351687 CACGGGGCCTGGCACGTAGTGGG + Intergenic
947724326 2:232387817-232387839 CACGGGGCCTGGCACGTAGTGGG + Intergenic
947855978 2:233324738-233324760 CACTGGGTCTGGGATTCATGAGG + Intronic
948292063 2:236832841-236832863 CACTGGCTCTGGCACGTAGTAGG + Intergenic
948513346 2:238487835-238487857 CACTGTGGCTGGCGCTCAGGAGG - Intergenic
948634014 2:239322581-239322603 CACTGGGTGTGGCAATGGGTGGG + Intronic
948908804 2:240992806-240992828 CTCAGGGCCTGGCACTTAGTAGG + Intronic
1168797303 20:620221-620243 CACGGTGCCTGGCACACAGTAGG + Intergenic
1168798534 20:628671-628693 CACAGGGCCTGGCACACAGTAGG + Intergenic
1168958362 20:1850271-1850293 CAGAGGGCCTGGCACTGAGTAGG - Intergenic
1168966854 20:1903975-1903997 CACAGGGCCTGACACACAGTAGG + Intronic
1169000895 20:2167310-2167332 CACTAGGCTTGGCACACAGTAGG - Intronic
1169290200 20:4343187-4343209 CACAGTGCCAGGCACTCAGTAGG - Intergenic
1169900504 20:10547824-10547846 TACTGGGTCTGGCACACAGATGG - Intronic
1169948272 20:11012950-11012972 CACAGCGTTTGGCACACAGTAGG + Intergenic
1170212433 20:13858794-13858816 CACTGGGTCATGTACACAGTAGG + Intronic
1170859647 20:20090759-20090781 AACAGGGTCTGGCACACAGTTGG + Intronic
1171162459 20:22940555-22940577 CACTCTCTCTGGCACACAGTAGG - Intergenic
1171246539 20:23614488-23614510 CACTGGTCCTGGCTCTCACTGGG + Intergenic
1171392509 20:24810837-24810859 CACTGCGCCTGGAACTCAGCTGG - Intergenic
1171820057 20:29827877-29827899 TACAGTGTCTGGCACACAGTAGG - Intergenic
1171959965 20:31486168-31486190 CACTGTGCCCGGCACTTAGTAGG - Intergenic
1171991506 20:31700186-31700208 CACAGGGCCTGGCACATAGTTGG + Intronic
1172012732 20:31855719-31855741 CACTGTGCCTGGCACATAGTAGG - Intronic
1172113225 20:32559711-32559733 CACTGTTCCTGGCACTTAGTAGG + Intronic
1172173542 20:32959105-32959127 CACAAGGTCTGGCAGTCAGTAGG - Intronic
1172212975 20:33213949-33213971 CACAGTGCCTGGCACACAGTTGG + Intergenic
1172287844 20:33753497-33753519 CACAGTGTCTGGCACACAGCTGG - Intronic
1172441225 20:34967964-34967986 CCTTGGGTCTGCCACTCTGTAGG - Intergenic
1172621734 20:36321959-36321981 CACAGGGTCTGGCATCAAGTGGG - Intronic
1172771084 20:37383039-37383061 CATGGGGTGTGGCACACAGTAGG - Intronic
1172832342 20:37846547-37846569 CACAGGGCCTGGCACACAGAAGG + Intronic
1173081571 20:39873379-39873401 TGCAGGGTCTGGCACTAAGTAGG + Intergenic
1173152729 20:40581719-40581741 CACAGGGTCTGAGACTCACTGGG + Intergenic
1173438934 20:43057920-43057942 CACTGGGTTAGGCATTGAGTGGG - Intronic
1173521092 20:43700916-43700938 CACTGGCTCCGGCAATCAGTGGG - Intronic
1173564457 20:44028995-44029017 GACTTGGTCTGGCAGTCACTGGG - Intronic
1173658833 20:44719205-44719227 CACAGGGCCTGGCATGCAGTAGG - Intronic
1173839375 20:46147382-46147404 CTCAGGGCCTGGCACACAGTAGG - Intergenic
1174034909 20:47662946-47662968 CACCGGCTCAGGGACTCAGTGGG + Intronic
1174202930 20:48819807-48819829 CACAGTGCCTGGCACACAGTGGG + Intronic
1174275499 20:49400839-49400861 CACAGGGTCGGGCACAGAGTAGG + Intronic
1174305166 20:49609841-49609863 CACTGTGTCTGGCACTCAGTAGG - Intergenic
1174409333 20:50323405-50323427 CACAGCATCTGGCACACAGTAGG - Intergenic
1174423788 20:50417895-50417917 GACAGGGCCTGGCACTTAGTAGG - Intergenic
1174485238 20:50856819-50856841 CAGAGGGCCTGGCACACAGTAGG - Intronic
1174520078 20:51122542-51122564 CGCAGTGTCTGGCACACAGTAGG + Intergenic
1174585106 20:51602339-51602361 CCTTGGGCCTGGCACTTAGTAGG - Intronic
1174600996 20:51724696-51724718 CACAGGGCCTGGCACACAGCAGG + Intronic
1175105446 20:56611525-56611547 CACTGTGCCTGGCACAGAGTCGG + Intergenic
1175131981 20:56796256-56796278 CATTGTGCCTGGCACCCAGTAGG + Intergenic
1175215541 20:57390210-57390232 GACTGGGAGTGGCACTCCGTGGG - Intergenic
1175517610 20:59578910-59578932 CACTGGGACTGGCGCTCAGTAGG - Intronic
1175563758 20:59955557-59955579 CACGGGGCCTGGAACTCAGCTGG - Intergenic
1175821683 20:61913469-61913491 CACTGGGCCAGGCCCTCAGCAGG + Intronic
1176660455 21:9630230-9630252 CACAGTGTCTGGCAATTAGTTGG - Intergenic
1177868083 21:26536906-26536928 ATCTGGGCCTGGCACACAGTAGG - Intronic
1178189649 21:30265762-30265784 AACTGGGTCTGCCACCCAGAAGG + Intergenic
1179796414 21:43787198-43787220 CACAGTGTCAGGCACACAGTGGG - Intergenic
1180815108 22:18784645-18784667 CACTGGGTCTGGCAGTGTGGGGG - Intergenic
1181201298 22:21218982-21219004 CACTGGGTCTGGCAGTGTGGGGG - Intronic
1181463922 22:23100683-23100705 CAGAGGGCCTGGCACACAGTGGG + Intronic
1181570412 22:23765162-23765184 CATAGGGGCTGGCACACAGTAGG + Intronic
1181700450 22:24617981-24618003 CACTGGGTCTGGCAGTGTGGGGG + Intronic
1181727367 22:24820757-24820779 CACAGAGTCTGGTACACAGTAGG - Intronic
1181727707 22:24823013-24823035 CACTGAGCCTGGCACACAGTAGG - Intronic
1181765788 22:25090980-25091002 CACAGGGCCTGGAACACAGTAGG + Intronic
1181784892 22:25219872-25219894 CACAGTGCCTGGCACACAGTGGG + Intronic
1181923285 22:26337617-26337639 CACTTGTTCTTGCACACAGTAGG - Intronic
1181991525 22:26840515-26840537 CTCTGGGCCTGGCACACAGGAGG - Intergenic
1182061465 22:27401228-27401250 CACAGGGACTGGCACACAGTGGG + Intergenic
1182751284 22:32644192-32644214 CACAGTTTCTGGCACTCAGTGGG - Intronic
1182953047 22:34395706-34395728 CACAGGGCCTGGCACAGAGTAGG + Intergenic
1183003559 22:34881241-34881263 CGCTGGGACTGGCCCACAGTTGG - Intergenic
1183208627 22:36436064-36436086 CACCGGGTCTGGCACGCGGCAGG + Intergenic
1183262697 22:36806089-36806111 CACAGTGCCTGGCACACAGTGGG + Intronic
1183317872 22:37146740-37146762 CACAGGGCCGGGCACACAGTCGG + Intronic
1183369337 22:37423629-37423651 AACCGGGCCTGGCTCTCAGTAGG + Intronic
1183780580 22:39996121-39996143 CACAGGGCCAGGCACACAGTAGG - Intronic
1183904464 22:41029992-41030014 CACAGCCTCTGGCACCCAGTAGG - Intergenic
1184101825 22:42344796-42344818 CTCTGGGCCTGGCCCACAGTAGG + Intergenic
1184188038 22:42877630-42877652 CACTGGGCCTGGCAAACAGTAGG - Intronic
1184275923 22:43409832-43409854 CACAGGGCCTGGCACTCTGTAGG - Intergenic
1184449353 22:44573793-44573815 CACAGGGCCTGGCACACAGTTGG + Intergenic
1184797532 22:46740707-46740729 CCCTGGGTCTGACACACAGCAGG - Intergenic
1184873204 22:47254583-47254605 CACTGTGCCTGGCCATCAGTTGG + Intergenic
1185125023 22:49005183-49005205 CAGTGGCTCTGCCACCCAGTGGG + Intergenic
1185255570 22:49828819-49828841 CACCGGGCCTGACACTCACTAGG - Intergenic
1203225616 22_KI270731v1_random:76448-76470 CACTGGGTCTGGCAGTGTGGGGG + Intergenic
1203265214 22_KI270734v1_random:10336-10358 CACTGGGTCTGGCAGTGTGGGGG - Intergenic
949613298 3:5726596-5726618 CACAATGTCTGGCACTTAGTAGG - Intergenic
950444952 3:13031603-13031625 CCCTGTGCCTGGCACACAGTAGG - Intronic
950638172 3:14330660-14330682 CACAGGGTCCGGCACATAGTAGG - Intergenic
950651396 3:14409576-14409598 CCCTGTGCCTGGCACACAGTAGG - Intronic
950808847 3:15632329-15632351 CCCTGGGGCTGGCCCACAGTTGG + Intronic
951612087 3:24501420-24501442 CACGGTGCCTGGCACACAGTAGG + Intergenic
951875731 3:27422787-27422809 CACTGGGTGTGGGACTCAAGAGG - Intronic
952157155 3:30655781-30655803 CACAGTGGCTGGCACACAGTAGG + Intronic
952827647 3:37537573-37537595 CAGGGTGTCTGGCACTCTGTAGG - Intronic
953107821 3:39902518-39902540 CACAGGGCCTGGCACACCGTGGG + Intronic
954075358 3:48174610-48174632 CACAGGGCCTGGCACATAGTAGG + Intronic
954744598 3:52780003-52780025 CACAGGGCCTGGTACTCAGTAGG - Intronic
954823744 3:53353153-53353175 CACTGAGTCTGCCTCTGAGTGGG + Intergenic
954941259 3:54375321-54375343 CACAGTGCCTGGCACCCAGTAGG + Intronic
955070903 3:55571815-55571837 CACAGGGCCTAGCACACAGTAGG + Intronic
955213450 3:56963226-56963248 CAGGGAGTCTGGCACTTAGTAGG + Intronic
955309061 3:57865964-57865986 CGCAGGGTCTGGCACATAGTTGG - Intronic
955821820 3:62904438-62904460 CACAGTGCCTGGCACACAGTAGG - Intergenic
956662054 3:71608663-71608685 CACAGTGCCTGGCACTGAGTGGG + Intergenic
957367624 3:79246882-79246904 CATGGTGTTTGGCACTCAGTGGG - Intronic
958107620 3:89097590-89097612 AACTGTGTCTGGCACATAGTAGG - Intergenic
958921571 3:100112023-100112045 CACGGGGCCTGGCACAGAGTAGG + Intronic
959894928 3:111594731-111594753 CACTGGGTCTTGCTCAAAGTAGG + Exonic
960048491 3:113219359-113219381 CACAAGGCCTGGCACACAGTAGG - Intronic
960243700 3:115375772-115375794 CACCGTGTCAGGCACACAGTAGG - Intergenic
960263111 3:115590488-115590510 AACTGTGTCTGGTACACAGTAGG + Intergenic
961006915 3:123411628-123411650 TGCTGGGCCTGGCACTCTGTGGG - Intronic
961809024 3:129510808-129510830 CACAGGGTCTGTCACGTAGTAGG - Intronic
962198592 3:133383445-133383467 CACAGTGTCTGGCACACAATGGG - Intronic
962284844 3:134076965-134076987 CACAGGGCCTGGCACATAGTAGG - Intronic
962375337 3:134854177-134854199 CACAGGGCCTGGCTCACAGTAGG + Intronic
962609212 3:137059274-137059296 CATTGTGTTTGACACTCAGTGGG - Intergenic
962623680 3:137203582-137203604 CACTGTGCCTGGAACACAGTAGG + Intergenic
963287409 3:143446520-143446542 CACAGTGCCTGGCACCCAGTAGG - Intronic
963328686 3:143890317-143890339 CACAGCGCCTGGCACTCAGGAGG + Intergenic
963341561 3:144040626-144040648 TGCAGGGCCTGGCACTCAGTAGG + Intronic
964392988 3:156216682-156216704 CCCAGTGTCTGGCACTAAGTAGG - Intronic
964824667 3:160811952-160811974 CACTTGGTGTGGCACTGAGTGGG + Intronic
965389967 3:168093386-168093408 CACTGTGCCTGACACTCATTAGG - Intronic
965677947 3:171219415-171219437 CACTGGCACTGGCACCTAGTAGG - Intronic
966619535 3:181948747-181948769 CACTGTGTCAGGCACTGTGTGGG - Intergenic
966621164 3:181965797-181965819 CACAGTGTCTGGTACACAGTAGG + Intergenic
966657006 3:182370476-182370498 AACAGTGTCTGGCACACAGTAGG + Intergenic
966818028 3:183905161-183905183 CACAGGGCCTGGCACTTAGTAGG + Intergenic
966869178 3:184278782-184278804 CACTGGACCTGGCACACAGTAGG - Intronic
967113967 3:186319771-186319793 CACTGTGTCTTGCACTGAATTGG + Intronic
967149457 3:186635530-186635552 CACAGCGCCTGGCATTCAGTAGG + Intergenic
967931631 3:194694409-194694431 CATGGGGTCTGGCACCTAGTAGG + Intergenic
968391722 4:198386-198408 CACTGGGTCTGGACCTGAGGGGG - Intergenic
968405266 4:335524-335546 CACTGGGTCTGGACCTGAGGGGG - Intergenic
968935312 4:3607240-3607262 CACTGGGCCAGGCACTCTGTGGG + Intergenic
968962020 4:3750507-3750529 CCCAGGGCCTGGCACACAGTAGG - Intergenic
969063052 4:4454499-4454521 CACTGGGTCTCACACTCACCAGG - Intronic
969066403 4:4485262-4485284 CACTGTGTCTGGCACACAGTAGG + Intronic
969089636 4:4684241-4684263 CACAGGGCCTGGCACACAGCAGG - Intergenic
969171234 4:5365370-5365392 CACAGTGCCTGGCACACAGTAGG + Intronic
969452595 4:7283400-7283422 CAAAGTGCCTGGCACTCAGTAGG + Intronic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
969586622 4:8097695-8097717 CACAGAGTCTAGCACACAGTAGG - Intronic
970094454 4:12446351-12446373 TGCTGGGTCTGGCACTCATGCGG - Intergenic
970264702 4:14268661-14268683 CACAGTGACTGGCACACAGTAGG - Intergenic
970341978 4:15116900-15116922 CACAGTGCCTGGCACCCAGTGGG + Intergenic
970436505 4:16040739-16040761 CACCGGGCCTGGCACACAGTGGG + Intronic
970440621 4:16078232-16078254 CACTGGGCATGGCACGTAGTCGG + Intronic
970740883 4:19236349-19236371 CACAGTGGCTGGCACACAGTAGG + Intergenic
970935528 4:21565694-21565716 CTCTGTGTCTGGCACTGTGTTGG + Intronic
971144844 4:23965361-23965383 CACTATGTCTGGCCCACAGTGGG + Intergenic
971242268 4:24899510-24899532 CACTGGGTGTGGCAGTTAGGAGG + Intronic
971642859 4:29157953-29157975 CACTGAGTCTGTCTCTTAGTAGG + Intergenic
971955932 4:33418313-33418335 CACTGTATCTAGCACACAGTAGG - Intergenic
973065119 4:45780529-45780551 CACTGGGTCTTGTACTCAAGAGG - Intergenic
975673095 4:76801668-76801690 CACTGTGCCTGGCCCTCAGCAGG + Intergenic
975902586 4:79170180-79170202 CACAGGGTCCTGCACTCAGAAGG + Intergenic
976360250 4:84169686-84169708 CAGAGTGTTTGGCACTCAGTAGG - Intergenic
976729933 4:88251677-88251699 CACAGGGTCTGACACATAGTAGG - Intergenic
976774057 4:88687976-88687998 CACTATGGCTGGCACACAGTGGG - Intronic
977377187 4:96220637-96220659 CACAATGTCTGGCACTCAGAAGG - Intergenic
977890728 4:102308370-102308392 CCCAGGGCCTGGCACCCAGTAGG + Intronic
977988499 4:103414546-103414568 CACAGGATCTGGCACACAGTAGG + Intergenic
978053242 4:104230244-104230266 CACTGGGAGTGGAACTCACTGGG - Intergenic
980076466 4:128298953-128298975 CACAGGGCCTGGCACCCAGCAGG - Intergenic
980161868 4:129174035-129174057 AACTGTGTCTTGCACGCAGTAGG - Intergenic
980165563 4:129222526-129222548 CACAGTGCCTGGCACACAGTAGG + Intergenic
980995304 4:139774383-139774405 CACTGTGGCTGGCACGTAGTAGG + Intronic
982137439 4:152285135-152285157 CATGGGGCCTGGCACACAGTAGG + Intergenic
982222297 4:153135325-153135347 CACAGTGTCTGGTACACAGTAGG - Intergenic
982849151 4:160290102-160290124 CACTGGGCCTCGCATACAGTTGG - Intergenic
983562594 4:169116020-169116042 CACTGAGTCTGGCAAGTAGTGGG + Intronic
984705462 4:182844488-182844510 CCCAGGGTCTGGAACTCAGGAGG - Intergenic
985003574 4:185510311-185510333 CACTATGTCTGGCACACAGTAGG - Intronic
985826817 5:2198165-2198187 AACAGGGCCTGGCACACAGTAGG + Intergenic
985933345 5:3076686-3076708 CACAGTGCCTGGCACACAGTAGG - Intergenic
986447066 5:7830960-7830982 CACTGGGTGGGGCACACACTGGG + Exonic
986646534 5:9921634-9921656 CAGTGGGTCAGTCACTCATTAGG - Intergenic
986724432 5:10583481-10583503 CACTGGTGCTGGCATCCAGTGGG - Intronic
986998242 5:13632060-13632082 CACTGGATTTGGCAGTCAGTAGG + Intergenic
987864774 5:23524929-23524951 AACATGGTCTGGCACTGAGTAGG - Intronic
988513667 5:31887020-31887042 CACTGGTTCTTGCACCCAGGCGG - Intronic
989441218 5:41474345-41474367 AACTGTGTCTGCCACCCAGTAGG - Intronic
989695739 5:44198776-44198798 CACAGTGTCTGGTACTTAGTAGG + Intergenic
990472361 5:56127764-56127786 CAGAGGGTCTGGTACTCAGATGG - Intronic
990714724 5:58624127-58624149 CACAGTGCCTGGCACACAGTAGG - Intronic
990811241 5:59726019-59726041 CACTGTGTCTGGCACTGAGAAGG + Intronic
990947684 5:61266224-61266246 CACAGTGTCTGGCACAGAGTAGG + Intergenic
992103446 5:73429742-73429764 CACTATGCCTGGCACACAGTAGG + Intergenic
993013264 5:82508072-82508094 CACTGAGTCTGCCTCTGAGTAGG - Intergenic
993619803 5:90154723-90154745 CACAGGGTCTGGAACATAGTAGG - Intergenic
994046732 5:95318536-95318558 CAGAGGGTCTGGCACTTGGTTGG - Intergenic
995845036 5:116484462-116484484 CATAGGGTCTTGCCCTCAGTTGG + Intronic
997076962 5:130690286-130690308 CATTGTGTTTGGCACTCAGTGGG - Intergenic
997321099 5:132979288-132979310 CACGGTGTCTGGCCCTCAGTAGG + Intergenic
997657477 5:135566242-135566264 CACAGGGTCTGGCTCACAGTAGG + Intergenic
997658149 5:135570235-135570257 CACAGGGTCTGGCTCACAGTAGG + Intergenic
997660490 5:135585579-135585601 CACAGGGCCGGGCACACAGTAGG + Intergenic
997675429 5:135709216-135709238 CTCAGGTTCTGCCACTCAGTGGG - Intergenic
997695446 5:135857552-135857574 CCCTGTGCCTGGCACCCAGTAGG - Intronic
997740451 5:136248390-136248412 CACAGGGTCTGGCACACAGCAGG + Intronic
998165149 5:139838529-139838551 CACTGGGCCTGGCACTGAGAAGG - Intronic
998194981 5:140060989-140061011 CCCTGGGGCTGGTACACAGTTGG - Intergenic
998405430 5:141871747-141871769 CCCTGGACCTGGCACACAGTGGG + Intronic
998444515 5:142188204-142188226 CACTGGTTCCGCCACTCAGTTGG + Intergenic
998911659 5:146966699-146966721 CACTGGGCCTGGCACAGCGTAGG + Intronic
999114766 5:149152987-149153009 CACAGTGTCTGGCACATAGTAGG + Intronic
999232349 5:150069212-150069234 GCCAGGGTCTGGCACACAGTGGG + Intronic
999695596 5:154186144-154186166 TCCTGGGTCTGGCACACAGTAGG - Intronic
999701955 5:154236311-154236333 CATTGGGTCAGGCACTGAGCTGG - Intronic
999719243 5:154386468-154386490 TACTGGGACAGGCACTCAGGAGG - Intronic
999800110 5:155025835-155025857 CTCTGCATCTGGCACTAAGTAGG - Intergenic
1000012123 5:157242864-157242886 CACCGTGTCCGGCACACAGTAGG + Intronic
1000152947 5:158520981-158521003 CACAGGGTCTGGCACCTAGTAGG + Intergenic
1000283343 5:159801945-159801967 CACTGTGTTTGGCATACAGTGGG - Intergenic
1000284931 5:159818906-159818928 CACAGTGTCTGGCACGTAGTAGG - Intergenic
1000306831 5:160002385-160002407 CACAGTGTCTGGCACACAATAGG - Intergenic
1000335784 5:160240325-160240347 CACAGGGTATGGCACACAGAAGG + Intergenic
1000885835 5:166746325-166746347 CACAGTGTCTGGCACATAGTAGG - Intergenic
1001244844 5:170098370-170098392 GACAGTGTCTGGCACACAGTAGG - Intergenic
1001304497 5:170561688-170561710 CACGGTGCCTGGCACACAGTAGG + Intronic
1001381205 5:171307824-171307846 CACTGGGCCTGGCACGTAGTAGG - Exonic
1001417348 5:171555375-171555397 TACAGGGTCTGGCACTTGGTAGG + Intergenic
1001445873 5:171782521-171782543 CCCTGGGTCAGGCGCACAGTAGG + Intergenic
1001871597 5:175160788-175160810 CACAGTGTCTGGCACATAGTAGG - Intergenic
1002015572 5:176319236-176319258 CATTGGGTTGGGCATTCAGTGGG + Intronic
1002314485 5:178334232-178334254 CACTGCGCCGGGCACACAGTGGG - Intronic
1002548067 5:179965275-179965297 CACAGTGCCTGGCACACAGTGGG + Intronic
1003105568 6:3212433-3212455 CACTGTGTCAGGCACATAGTAGG + Intergenic
1003837011 6:10082239-10082261 TACTGTGTCTGGCACATAGTTGG + Intronic
1003992449 6:11499453-11499475 AGCTGGGTCTGGCACAGAGTGGG - Intergenic
1005162746 6:22883457-22883479 CACAGGGTCCTGCACTCAGAGGG - Intergenic
1005997431 6:30939919-30939941 GACAGTGTCTGGCACACAGTAGG - Intergenic
1006338206 6:33431888-33431910 GACTGGGGCTGGCAGTCAGCAGG - Intronic
1006514463 6:34538259-34538281 CCCTGGGCCAGGCACTCAGATGG + Exonic
1006946223 6:37786064-37786086 CACAGTGCCTGGCACTTAGTAGG + Intergenic
1007075394 6:39062991-39063013 CACAGGGCCTGGCATACAGTAGG - Intronic
1007225386 6:40310021-40310043 CCCAGGGCCTGGCAATCAGTGGG - Intergenic
1007257567 6:40539515-40539537 GACTGTGTCTGGCACATAGTGGG - Intronic
1007632376 6:43279627-43279649 CACAAGGCCTGGCACACAGTTGG + Intronic
1007692084 6:43708988-43709010 CACAGGGCCTGGCATGCAGTAGG + Intergenic
1008075358 6:47139806-47139828 CAATGGGTCTGACACATAGTGGG + Intergenic
1008578371 6:52882737-52882759 CACAGAATCTGGCACTTAGTAGG + Intronic
1008685674 6:53923734-53923756 CACTGGTTCAGACATTCAGTGGG + Exonic
1011644251 6:89442592-89442614 CCCAGGGTCTGACACTCTGTTGG - Intronic
1012990294 6:105919069-105919091 GACAGGGTCTGGCACACAGCAGG - Intergenic
1015737780 6:136419461-136419483 CACAGGGCCTGACACACAGTAGG + Intronic
1015941977 6:138461954-138461976 CTCAGGGCCTGGCACACAGTAGG - Intronic
1016254194 6:142084165-142084187 CCCTGGGTCTAACACTCACTAGG - Intronic
1019411812 7:909885-909907 CAGTGGGACCGGCACACAGTAGG - Intronic
1019919671 7:4155432-4155454 GCCTGGGTCTGGCACTGAGCCGG - Intronic
1019943919 7:4311870-4311892 CACGGTGTCTGGACCTCAGTTGG - Intergenic
1020280377 7:6647213-6647235 CACTGGGCCTGCCCCTCACTGGG - Intronic
1020417409 7:7961679-7961701 CACTGGGTCTGGCAATATGGAGG + Intronic
1020476423 7:8600357-8600379 CAGTGGGTCAGGCACTGAATGGG - Intronic
1021433340 7:20586448-20586470 CAGTAGGTATGGAACTCAGTGGG - Intergenic
1022475306 7:30706090-30706112 CACAGGGTCTTGCACATAGTAGG - Intronic
1022488271 7:30797189-30797211 TGGTGGGTCTGGCACACAGTAGG - Intronic
1022809217 7:33852369-33852391 CACTGTGCCTGGCACATAGTTGG + Intergenic
1022888993 7:34676701-34676723 CACTGTGTCTGGCATAGAGTAGG + Intronic
1024168655 7:46761557-46761579 AACTGGGTCTGGCACATAGTGGG + Intergenic
1024295404 7:47837707-47837729 CACAGTGTCTGGCACACAGTGGG + Intronic
1024566659 7:50687005-50687027 CCCTGAGTCTGGCACACAGCAGG + Intronic
1025936288 7:66040439-66040461 CATTGCATCTGGCACACAGTAGG - Intergenic
1025947880 7:66118466-66118488 CATTGCATCTGGCACACAGTAGG + Intronic
1025963576 7:66246982-66247004 CACAGTGTCTGGCACATAGTAGG - Intronic
1026144551 7:67735202-67735224 CACTGGGCTTTGCACACAGTAGG + Intergenic
1026948661 7:74332872-74332894 CACAGAGTCTGGCACCTAGTAGG + Intronic
1028199865 7:87948884-87948906 CACTGTGCCTGACACACAGTTGG + Intronic
1029094395 7:98073546-98073568 CACTGTGTCTGGCCTTCACTGGG - Intergenic
1029647839 7:101869352-101869374 CACAGTGCCTGGCACACAGTAGG + Intronic
1029670170 7:102024680-102024702 CATGGGGCCTGGCACACAGTGGG - Intronic
1030651532 7:112121079-112121101 CACTGTGTCTGGCATATAGTAGG - Intronic
1031327201 7:120416587-120416609 CACTGGGTCAGGCATATAGTAGG - Intronic
1031967737 7:128039937-128039959 CTATAGCTCTGGCACTCAGTGGG - Intronic
1032114370 7:129104232-129104254 CACTGGGTAAAGCACTGAGTAGG + Intergenic
1032610357 7:133405945-133405967 CACAGTGTCTGGCTCACAGTAGG - Intronic
1032765791 7:134991659-134991681 CACTGGGTCTGGCACATAGTAGG + Intronic
1033155909 7:138956887-138956909 CACTGGGCCTGGCAGAGAGTAGG - Intronic
1034420410 7:150987591-150987613 CACTGGGTCTGTCAGCCAGGAGG - Intergenic
1034861187 7:154596081-154596103 CACAGGTTCTGACATTCAGTAGG + Intronic
1036946692 8:13100799-13100821 CACTGGGGCTGGCAGCCAGCAGG + Intronic
1037748455 8:21664458-21664480 CACTGTGCCTGGCACACATTTGG + Intergenic
1037996678 8:23357456-23357478 CATTGGAACTGGCACTTAGTAGG + Intronic
1038010626 8:23473003-23473025 CACAGTTTCTGGCACTTAGTAGG + Intergenic
1038488010 8:27950182-27950204 CCCTGGGGCTGGCATGCAGTTGG - Intronic
1038740294 8:30211280-30211302 CTCAGGGTCTGGCACACAGTAGG + Intergenic
1039683387 8:39767424-39767446 CACATGGTCTGGCAATTAGTAGG - Intronic
1039892285 8:41693835-41693857 CAGTGCGTCTGGAACACAGTAGG - Intronic
1041121301 8:54589107-54589129 GACTGGGCCTGGCACACAGCAGG + Intergenic
1042382238 8:68130483-68130505 CACCGTGTCTGGCACTGAGTAGG - Intronic
1043084139 8:75806237-75806259 CACATTGTCTGGCACACAGTAGG - Intergenic
1045240061 8:100392434-100392456 CATGGGGTCTGGCACACATTAGG + Intronic
1045376713 8:101581678-101581700 CAAAGGGTCTGGCACATAGTAGG - Intronic
1046920374 8:119721535-119721557 CACAGGATCTGCCACTCAGCAGG + Intergenic
1047432738 8:124806837-124806859 CACAGGGTCCTGCACTCAGAAGG + Intergenic
1047450187 8:124958495-124958517 CATTGTGTCTGCCACTCAGTGGG - Intergenic
1047739230 8:127793992-127794014 CACTGGAGCTGGAGCTCAGTCGG + Intergenic
1047773079 8:128046235-128046257 GACAGTGTCTGGCACACAGTAGG - Intergenic
1048319096 8:133384746-133384768 CACAGTTTCTGGCACACAGTAGG + Intergenic
1048319674 8:133388459-133388481 CACAGGGTATGGTATTCAGTAGG + Intergenic
1049201174 8:141341381-141341403 CCCAGGGCCTGGCACTCAGCAGG - Intergenic
1049249687 8:141581719-141581741 CTCTGGGCCTGGCACCCAGACGG - Intergenic
1049534140 8:143170241-143170263 GACTGTGGGTGGCACTCAGTAGG + Intergenic
1049969783 9:811730-811752 CACACGGCTTGGCACTCAGTGGG + Intergenic
1050302613 9:4274717-4274739 CACAGGGTCCTGCACTCAGAAGG - Intronic
1051222014 9:14858843-14858865 CACAGTGTCTGGCTCACAGTAGG - Intronic
1051318217 9:15866857-15866879 CACTGTGCCTGGTACCCAGTAGG + Intronic
1051399762 9:16668018-16668040 CATTGCGTCTGGCACTTAGTAGG - Intronic
1051591367 9:18779393-18779415 CACTATGTCTGGCATACAGTTGG - Intronic
1051741228 9:20254358-20254380 CACAGAGCCTGGCACACAGTGGG - Intergenic
1051742788 9:20267649-20267671 CACTGTGTCTGCCACATAGTAGG + Intergenic
1052337254 9:27332680-27332702 CACTGGGACTGGCAAACAGCAGG - Intronic
1052352543 9:27471919-27471941 CAGCGGGTCTGGCACACTGTAGG + Intronic
1052460180 9:28752944-28752966 AACTGTGTCTGGCATACAGTAGG + Intergenic
1052956119 9:34254366-34254388 CACAGGGTCTGGCTCTAAGACGG + Exonic
1053004844 9:34597584-34597606 CTCTAGGCCTGGCACACAGTAGG - Intergenic
1053545073 9:39014322-39014344 CATAGTGTCTGGCACACAGTTGG + Intergenic
1053809472 9:41837515-41837537 CATAGTGTCTGGCACACAGTTGG + Intergenic
1054454872 9:65424662-65424684 CACTGGGCCAGGCACTCTGTGGG - Intergenic
1054621120 9:67349913-67349935 CATAGTGTCTGGCACACAGTTGG - Intergenic
1055508854 9:76974711-76974733 CACTAGGTCTTGCACACAGTTGG + Intergenic
1056276085 9:84995571-84995593 CGCTGGGTCTGCCACACACTTGG + Intronic
1056786262 9:89594708-89594730 CACTGTGTCAGGCTCTCAGCTGG - Intergenic
1057291462 9:93809954-93809976 CAATGGGGCTGGCACTTAGTGGG - Intergenic
1057311611 9:93946566-93946588 CACAGTGTCTGGCACGCAGAGGG + Intergenic
1057428689 9:94975316-94975338 TATTGTGTCTGGCACACAGTAGG + Intronic
1057495712 9:95559554-95559576 CACTGGGCCTGGCATATAGTGGG - Intergenic
1057775880 9:98009009-98009031 CACAGGGCCTGACACTGAGTAGG + Intronic
1058114691 9:101071479-101071501 CACTATGTCTGGCACGTAGTGGG - Intronic
1058476380 9:105337946-105337968 CACTGTGTCTTGCACAAAGTAGG + Intronic
1058914153 9:109549421-109549443 TACTGAATCTGGCACCCAGTAGG + Intergenic
1059184209 9:112251911-112251933 CACAGTGTCTGGCACTCAATTGG - Intronic
1059457945 9:114411659-114411681 CACGGGGCCTGGCGCACAGTAGG - Intronic
1059461377 9:114432702-114432724 AACAGGGTCTGGCACATAGTAGG + Intronic
1059472007 9:114512384-114512406 CACAGTGCCTGGCACACAGTAGG - Intergenic
1059491427 9:114670831-114670853 CTCAGGGTCTGGCACAGAGTAGG - Intergenic
1059686636 9:116643994-116644016 CACAGTATCTGGCACACAGTAGG + Intronic
1059946615 9:119415065-119415087 CACAGGGTCTGGTACACAGCAGG - Intergenic
1060151615 9:121292527-121292549 CACTGTGTTTGGCACACAGCAGG - Intronic
1060254581 9:122015890-122015912 CACAGTGCCTGGCACACAGTAGG - Intronic
1060485547 9:124044275-124044297 CACTGGGCCTGGCACAAAGTAGG + Intergenic
1061224659 9:129273862-129273884 CATGGGGCCTGGCACACAGTAGG + Intergenic
1061250953 9:129426121-129426143 CACTCTGCCTGGCACACAGTAGG - Intergenic
1061303908 9:129721927-129721949 CCCTGGGCCTGGCTCTCAGCAGG - Intronic
1061614414 9:131770465-131770487 CACAGGGTCTGGCACAGAGCAGG - Intergenic
1061912583 9:133732850-133732872 CACGGGGCTTGGCACACAGTAGG - Intronic
1061976678 9:134071703-134071725 CACAGGGCCTGGCACATAGTAGG - Intergenic
1062429527 9:136520863-136520885 CACTGGCTGAGGCACACAGTGGG + Intronic
1203371724 Un_KI270442v1:313143-313165 TACAGTGTCTGGCACACAGTAGG - Intergenic
1203638025 Un_KI270750v1:132073-132095 CACAGTGTCTGGCAATTAGTTGG - Intergenic
1186930933 X:14389257-14389279 CACTGTGTCTGAAACTCTGTGGG - Intergenic
1187164009 X:16787579-16787601 CACTTGTTCTGGAGCTCAGTGGG + Intronic
1187455496 X:19437760-19437782 AACTGGATCTGGCACAAAGTAGG + Intronic
1189397210 X:40633588-40633610 AACTGTGCCTGGCACACAGTAGG + Intronic
1189585630 X:42458855-42458877 CATAGGGTCTGGGACACAGTAGG - Intergenic
1189709051 X:43790481-43790503 CACTGTGTCTGGCATACAATAGG + Intronic
1192142431 X:68657375-68657397 CACAGTGTCTGGCACATAGTAGG - Intronic
1192270034 X:69570412-69570434 CACTGTGTCTGTCACATAGTAGG + Intergenic
1192270206 X:69571952-69571974 CACAGGGCCTGGCACACAGTGGG + Intergenic
1192589370 X:72347078-72347100 CACAGTGTGTGGCACACAGTAGG + Intronic
1195399839 X:104449384-104449406 CAGTGGGTCTGGCATATAGTAGG + Intergenic
1196345193 X:114647541-114647563 CACAGTGTCTGGCCCACAGTAGG - Intronic
1196594507 X:117528009-117528031 CACTGGGTCTTGGATTCACTAGG - Intergenic
1197020672 X:121684127-121684149 CAAAGTGTCTGGCACTTAGTAGG - Intergenic
1197275847 X:124478028-124478050 CACAGTGTATGGCACACAGTAGG + Intronic
1197312230 X:124918692-124918714 CACAGTGTCTGGCACAAAGTAGG - Intronic
1197626962 X:128813026-128813048 CACAGTGTCTGGAACACAGTAGG + Intergenic
1197703216 X:129615618-129615640 CACTGTGCCTGGCACACAATGGG - Intergenic
1198118175 X:133564708-133564730 CATGGTGTCTGGCACACAGTAGG + Intronic
1198394514 X:136208378-136208400 CACAGTGCCTGGCACGCAGTAGG + Intronic
1198399673 X:136256714-136256736 CACTGGGCCTCCCACTGAGTAGG - Intergenic
1198517970 X:137427696-137427718 CACTGGGTCTGGCACACAGTAGG - Intergenic
1199492515 X:148416534-148416556 GACTGTGTCTGGCACTGACTAGG + Intergenic
1199536997 X:148913961-148913983 AACTGTGTCTGGCACATAGTAGG - Intronic
1199574240 X:149297993-149298015 CACAGAGCCTGGCACACAGTAGG + Intergenic
1199816125 X:151397924-151397946 CACTGAGCCTGGCATACAGTAGG - Intronic
1200182250 X:154157745-154157767 GACAGAGTCTGGCACACAGTGGG + Intronic
1200187904 X:154194859-154194881 GACAGAGTCTGGCACACAGTGGG + Intergenic
1200193554 X:154231999-154232021 GACAGAGTCTGGCACACAGTGGG + Intronic
1200199309 X:154269803-154269825 GACAGAGTCTGGCACACAGTGGG + Intronic