ID: 1108574727

View in Genome Browser
Species Human (GRCh38)
Location 13:51781513-51781535
Sequence GGTAAGTGCTAGAGTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108574725_1108574727 -6 Left 1108574725 13:51781496-51781518 CCTACACTCACGGTCGAGGTAAG 0: 1
1: 0
2: 0
3: 3
4: 19
Right 1108574727 13:51781513-51781535 GGTAAGTGCTAGAGTGCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 74
1108574721_1108574727 26 Left 1108574721 13:51781464-51781486 CCCAGGCATTACACATGTTACTA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1108574727 13:51781513-51781535 GGTAAGTGCTAGAGTGCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 74
1108574722_1108574727 25 Left 1108574722 13:51781465-51781487 CCAGGCATTACACATGTTACTAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1108574727 13:51781513-51781535 GGTAAGTGCTAGAGTGCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108574727 Original CRISPR GGTAAGTGCTAGAGTGCTAT GGG Intronic
903737000 1:25536258-25536280 GGTGAGTGCTGGAGTGGCATTGG + Intergenic
905322497 1:37128023-37128045 TGTCAGTGGTAGAGAGCTATTGG + Intergenic
905957799 1:42013697-42013719 TGTAAGTGGAAGACTGCTATGGG - Intronic
911365870 1:96936720-96936742 GGTAAGCTCAAGAGTGATATGGG + Intergenic
913357909 1:117944359-117944381 TCTAAGTGTTAGAGTGCTTTAGG + Intronic
913384923 1:118249178-118249200 GGTAAGATCTAGAGAGTTATTGG - Intergenic
921644802 1:217601756-217601778 GGTAAGTGTTAGAGAATTATAGG - Intronic
1064966811 10:21022398-21022420 CGCAAGTGCTAGCGTGCTTTGGG - Intronic
1066011086 10:31193861-31193883 GGTCTCTGATAGAGTGCTATTGG - Intergenic
1067123109 10:43491590-43491612 GGTAAGGGCTAGAGGGGTCTCGG - Intergenic
1074239609 10:111624219-111624241 GGTAAATGCTAGAATGCTCCTGG + Intergenic
1080124322 11:28713685-28713707 GCTAAGGTCTAGAGAGCTATAGG - Intergenic
1084068864 11:66720949-66720971 GGGAATTGATAGAGTGCTCTGGG + Intronic
1090592040 11:128282459-128282481 GGCATGAGTTAGAGTGCTATTGG + Intergenic
1094542107 12:31371226-31371248 GGTTAGTGTTAGAGTTCTATAGG + Intergenic
1098743796 12:74209361-74209383 AGTAAGTTCTAGAGACCTATTGG - Intergenic
1099544686 12:83963826-83963848 AGTAAGTGCTAGACTGACATTGG + Intergenic
1104274580 12:127313622-127313644 GATTTGTGCTAGTGTGCTATAGG - Intergenic
1105602044 13:21896190-21896212 GGACAGTGCTAGAGTTCTTTGGG - Intergenic
1108574727 13:51781513-51781535 GGTAAGTGCTAGAGTGCTATGGG + Intronic
1110412215 13:75217015-75217037 GGTCCGTGCTAGGGTGCTACCGG - Intergenic
1112737022 13:102431535-102431557 GGAGAGTGCTAGAGTGCAGTGGG - Intergenic
1114034864 14:18614349-18614371 GGTAAGTGCTAGAGGAGAATAGG - Intergenic
1117005985 14:51421600-51421622 CGTAAGAGCCTGAGTGCTATAGG + Intergenic
1119458324 14:74776410-74776432 GACAAGTGCTACAGTGCTGTTGG - Intronic
1123771791 15:23536618-23536640 GATAATTGCTAGCTTGCTATTGG - Intergenic
1127209175 15:56754700-56754722 TTTAAATTCTAGAGTGCTATGGG + Intronic
1129619262 15:77128939-77128961 GGTTAGAGGTAGAGTGCTATGGG + Intronic
1130977799 15:88790547-88790569 GGTGAGGGTTAGACTGCTATAGG + Intergenic
1135242134 16:20817024-20817046 GGTGAGTGATAGAGTAGTATAGG + Intronic
1137945844 16:52732510-52732532 GGTGAGTGTTAGAGTTCTAAAGG - Intergenic
1139370750 16:66467979-66468001 GGTCAGTGCTAGAAAGGTATGGG + Intronic
1148180035 17:45598408-45598430 GGTAAGTACTATAGTACTCTTGG - Intergenic
1149082570 17:52676855-52676877 GGAGAGTGCTAGAGTGCAGTGGG + Intergenic
1149890707 17:60387491-60387513 ATTAAGTGCTGCAGTGCTATAGG - Intronic
1156929036 18:42618596-42618618 GGTAAGAGCTTGAGTGACATAGG - Intergenic
1164056906 19:21629701-21629723 GGTGAGTGTTATAGTTCTATTGG - Intergenic
1168502785 19:56907611-56907633 GGCACGAGCTATAGTGCTATTGG + Intergenic
944082997 2:195811135-195811157 GGTGAGTGATACAGTGATATAGG + Intronic
945144940 2:206728287-206728309 TGTAAGTGCAAGAGAGATATGGG - Intergenic
947262437 2:228238669-228238691 GGGAAGTGCCAGAGTGAAATTGG - Intergenic
947559344 2:231133366-231133388 GGTAAGTGCCACAGTGTTAGAGG - Intronic
948554989 2:238803143-238803165 ACAAAGTGCTAGAGTGCTTTTGG + Intergenic
1173241486 20:41301407-41301429 TGTAAGTTCTTGAGTGATATGGG + Intronic
1182071178 22:27464853-27464875 GGTGAGTCCTAGACTGCTTTGGG - Intergenic
951401793 3:22241585-22241607 GTTAAGGGCCAGAGGGCTATTGG - Intronic
956507661 3:69959915-69959937 GGCATGAGCTACAGTGCTATTGG + Intronic
958858624 3:99418258-99418280 GGTGAGTACTAAAGTGCTATAGG + Intergenic
961936367 3:130588748-130588770 AGTCAGTGCTAGAGTGAGATGGG + Intronic
963886514 3:150588757-150588779 TGTAAGTGCTAGACTTTTATAGG - Intronic
964273778 3:154987085-154987107 GGAAAGTGCTAGAGTGCAGCAGG + Intergenic
974720880 4:65736741-65736763 GGCAACTCCTAGAGTGCTTTTGG - Intergenic
977522987 4:98109429-98109451 GGTAAATGCTAAAGTGCTCTTGG + Intronic
983565796 4:169150562-169150584 AGTAAGTTCAAGAGTTCTATAGG - Intronic
984843006 4:184085564-184085586 GGTAACTGCTAGTGTACTAATGG + Intergenic
990191421 5:53264225-53264247 AGAAAGTGCTAGACTGCTAAAGG - Intergenic
1009667610 6:66704343-66704365 GGTAAGTGCTAAAGTTCTTAAGG + Intergenic
1011629285 6:89308978-89309000 GGTAAGGAATAGAGAGCTATGGG + Intronic
1015002743 6:128239352-128239374 TGTCAGTGCTAGGGTGCTAGGGG - Intronic
1018034443 6:159869490-159869512 AATAAGTGCTAGTGTTCTATGGG - Intergenic
1020188115 7:5974183-5974205 GGCCAGGGCTGGAGTGCTATGGG - Intronic
1020294803 7:6750586-6750608 GGCCAGGGCTGGAGTGCTATGGG + Intergenic
1027410713 7:77914811-77914833 GGTTTGTGCTAGAGTTATATCGG + Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1032479924 7:132238151-132238173 GGTATGTGTTATAGTGCTGTTGG + Intronic
1032808675 7:135385193-135385215 GGTCAGTGGTAGAGAACTATAGG - Intronic
1036568161 8:9955973-9955995 GGAATGTGCAACAGTGCTATTGG - Intergenic
1038180997 8:25227507-25227529 TGTCAGTGCTAGATTGCTTTGGG + Intronic
1039967767 8:42295974-42295996 CTTAAGTGCTTGTGTGCTATAGG + Intronic
1041115839 8:54535713-54535735 GGTAGGAGTTACAGTGCTATTGG - Intergenic
1041291995 8:56316999-56317021 GGTAAGTGATATAGAGCTGTTGG - Intronic
1043638339 8:82414802-82414824 AGGAAGTGCTAGGGTGCTGTTGG + Intergenic
1046751378 8:117930532-117930554 GATCAGTGCTAGAGTGATGTGGG + Intronic
1050800048 9:9599410-9599432 GGTAAGGGCTTGAGTGCTTGAGG - Intronic
1051354782 9:16231783-16231805 GGTAAGGGCTGGAGTGTGATTGG + Intronic
1056416938 9:86386020-86386042 GGAGAGTGCTAGAGTGCAGTGGG - Intergenic
1059321835 9:113476213-113476235 GGTGCGTGCTAGAGGGCTGTGGG + Intronic
1186781807 X:12919913-12919935 GGGAAGTGCTAGAGAGGTTTAGG - Exonic
1188199392 X:27280496-27280518 GGTAAGTGCTAGAGTTGTAGGGG + Intergenic
1188596627 X:31908935-31908957 GGTAAGTGCTAAAGGGATATCGG + Intronic
1196243167 X:113366944-113366966 GCCAAGGGCTAAAGTGCTATGGG - Intergenic