ID: 1108576683

View in Genome Browser
Species Human (GRCh38)
Location 13:51797109-51797131
Sequence ATGACTGAGGGTCCTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108576683 Original CRISPR ATGACTGAGGGTCCTTTTGG GGG Intronic
908717476 1:67085914-67085936 ATTACTGAAGGTCCTTTCAGTGG + Intergenic
910494605 1:87812533-87812555 GAGAATGAGGGTCCTTTTTGGGG + Intergenic
910614324 1:89180391-89180413 TTGACTGAGGGCCCTTTTGCAGG - Intergenic
913070975 1:115298314-115298336 CTGACTAAGAGTTCTTTTGGGGG - Intronic
917581587 1:176383952-176383974 ATCACTGGGGGTCATTTTGGAGG + Intergenic
922669495 1:227498114-227498136 ATGACTGTGGGCCTTTTTAGGGG - Intergenic
922670098 1:227503188-227503210 ATGACTGTGGGCCTTTTTAGGGG + Intergenic
923411850 1:233718360-233718382 ATAACTGGGAGTCCTTTTAGAGG + Intergenic
1063876082 10:10480240-10480262 ATGACTCAGAGGCCTGTTGGAGG - Intergenic
1063941310 10:11132788-11132810 AGGCCTAAGGGTCCATTTGGTGG - Intronic
1064198204 10:13262748-13262770 ATAACTCAGGATGCTTTTGGTGG - Intergenic
1066157201 10:32690913-32690935 TTGACCAAGGGTCATTTTGGTGG + Intronic
1067044198 10:42975245-42975267 GTGACTGATGGCCCATTTGGTGG - Intergenic
1070499471 10:77057306-77057328 ATTACTTAGGGACATTTTGGTGG - Intronic
1071219746 10:83451469-83451491 AGGAGTGAGGTTTCTTTTGGGGG + Intergenic
1073694870 10:105853517-105853539 ATGACAGAGGGCCCTTTCTGTGG + Intergenic
1073849472 10:107597869-107597891 ATCAATGAGAGTCCTGTTGGTGG - Intergenic
1075272253 10:121062460-121062482 ATGGCTGCAGGTCCCTTTGGAGG - Intergenic
1078388274 11:10912348-10912370 ATCACTGAGGGTCATTATGGAGG - Intergenic
1080452454 11:32389849-32389871 ATGTCTGAGGGCTCTTTGGGTGG - Intronic
1081770130 11:45645161-45645183 ATGGCTGGGGCTCCTCTTGGTGG + Intergenic
1082745586 11:56958072-56958094 ATTACTGAGGTTTTTTTTGGGGG + Intergenic
1083335653 11:61920204-61920226 CAGACTGAGGGTCCCTCTGGAGG + Intronic
1083600490 11:63944518-63944540 ATGACTGAGGGTCCTTATGAGGG - Intronic
1084177189 11:67429023-67429045 GTGAGTGAGGGTCGTGTTGGGGG + Intronic
1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG + Intergenic
1086984839 11:93236476-93236498 ATGGCTGAAGGACCGTTTGGGGG - Intergenic
1090046518 11:123340060-123340082 ATGCCTGAGGATGGTTTTGGAGG + Intergenic
1091404189 12:198793-198815 ATACCTGAGGGTCCTTGAGGCGG + Exonic
1093440667 12:19192043-19192065 ATCACTGAGGGTCATCTTAGAGG + Intronic
1095811849 12:46380502-46380524 ATCACTGGGGGCCATTTTGGAGG + Intergenic
1099980172 12:89590788-89590810 CAGACTGAGGGTGCTTTTTGGGG - Exonic
1100825270 12:98469094-98469116 ATCACTGGGGGTCATCTTGGAGG - Intergenic
1100956391 12:99914051-99914073 AGAACTGTGGGTCCTTTAGGTGG - Intronic
1103889084 12:124225011-124225033 ATGACTGAGAAACATTTTGGCGG + Intronic
1104489636 12:129182882-129182904 TTGACTGAGGCTCCTTAGGGAGG + Intronic
1108576683 13:51797109-51797131 ATGACTGAGGGTCCTTTTGGGGG + Intronic
1108677558 13:52750398-52750420 ATGCCTGAGGATCCTCTTGGTGG - Intergenic
1108786099 13:53902983-53903005 ATCATTGAGGGCCATTTTGGAGG + Intergenic
1112065304 13:95786359-95786381 AGGAGTGAGATTCCTTTTGGTGG + Intronic
1113305253 13:109070636-109070658 ATGACTCAGGGTGCTTTTTTGGG - Intronic
1116175441 14:41464283-41464305 ATGAGTGTGGGTCCTTATGATGG - Intergenic
1116553806 14:46277500-46277522 ATTACTGAGGGTCATTTTAGCGG - Intergenic
1116865700 14:50029834-50029856 AGGATTGAGGGTCCTCTTCGTGG + Intergenic
1117730095 14:58713536-58713558 AGGACTCAGGGCCCTTTTAGTGG - Intergenic
1118002891 14:61540083-61540105 ACTACTGAGGGTCTTTTTGCTGG - Intronic
1118438992 14:65795977-65795999 CTGACTGCGGGTCATTTTAGTGG - Intergenic
1119380247 14:74223963-74223985 CTGACTAAGAATCCTTTTGGGGG - Intergenic
1120756492 14:88249445-88249467 GTGAATGAAGGTCCTCTTGGGGG + Intronic
1120966834 14:90175033-90175055 ATGACAGTGGATCCATTTGGTGG + Intronic
1125360665 15:38861239-38861261 AGGACTGAGGCTCCTCTTAGAGG + Intergenic
1126532870 15:49730920-49730942 ATGAATGAGAGCCCATTTGGGGG + Intergenic
1126537045 15:49777799-49777821 ATGACGGAGGGCTCTGTTGGAGG + Intergenic
1126801730 15:52304133-52304155 AAGAATGGGGCTCCTTTTGGAGG - Intergenic
1126852633 15:52806275-52806297 ATGACAGATGGTCATTTTCGGGG - Intergenic
1127490083 15:59454044-59454066 AGGCCTGAGGGTGCTGTTGGAGG + Intronic
1127678594 15:61270453-61270475 ATGACTCAGTGTGGTTTTGGAGG + Intergenic
1129198291 15:73983870-73983892 AAGCCTGAGGGGCCTCTTGGAGG - Exonic
1129608070 15:77034480-77034502 ATGACTCAGGGGCCTGTGGGGGG - Intronic
1131715397 15:95105056-95105078 ATGTATGAGGTTTCTTTTGGGGG + Intergenic
1132784359 16:1647072-1647094 ATGACTGAGGTGCCTGTGGGAGG + Intronic
1133013419 16:2927573-2927595 ATGACTGGGGTTGCTTTAGGAGG + Intronic
1133477554 16:6138167-6138189 ATGACTTAGGGCCCATTTGATGG + Intronic
1136630163 16:31485316-31485338 GGGACTGAGGCTCCTGTTGGAGG + Intronic
1137721458 16:50630027-50630049 ATGTCTGAGGTTCGTTTGGGAGG - Intronic
1137734904 16:50716500-50716522 ATGAATGAAAGTCTTTTTGGGGG + Intronic
1137901748 16:52276121-52276143 ATGACTGTGAGTCCTTTGGGAGG - Intergenic
1138047615 16:53742196-53742218 ATTATTGAGGGTCTTCTTGGAGG + Intronic
1139129524 16:64124419-64124441 AGGACTGAGGATCCTCTTGGTGG + Intergenic
1139750663 16:69107231-69107253 CTGGCTGAGGGACATTTTGGGGG + Intronic
1139841876 16:69888290-69888312 AAGACTGAGGCTCCTTTACGGGG + Intronic
1140486776 16:75299844-75299866 GTGACTGAGGGTTCCTTGGGTGG + Intronic
1144393857 17:14824269-14824291 ATGAGTGAGGGCCATTTTGGAGG - Intergenic
1145102584 17:20089151-20089173 ATTGCTGAGGGTCCCGTTGGGGG + Intronic
1151356495 17:73561544-73561566 ATGACACAGGGTCATTTTGGGGG + Intronic
1158446535 18:57526994-57527016 ATTACTCAGGGTTCTTTTGAGGG - Intergenic
1160963639 19:1735958-1735980 CTGACTGGGGCTCCTTTTGGTGG - Intergenic
1163090393 19:15015485-15015507 ATGAGAGAGGTTCCCTTTGGTGG - Intronic
1165489710 19:36115936-36115958 CTGACTGGGGGGTCTTTTGGAGG + Intronic
1168221708 19:54965214-54965236 ATTACTGAGAGGTCTTTTGGGGG - Intronic
1168221873 19:54966304-54966326 ATTACTGAGAGGTCTTTTGGGGG - Intronic
926443232 2:12911874-12911896 ATGAATGAGCTTCCTTTGGGAGG + Intergenic
928635731 2:33244343-33244365 ATAATTTAGGGTCATTTTGGTGG - Intronic
928975902 2:37086191-37086213 ATGACTGGGAGTCATTTTGGAGG + Intronic
933564818 2:83937412-83937434 ATGACAGACGTCCCTTTTGGGGG - Intergenic
936824235 2:116561304-116561326 AAGACTGTGCTTCCTTTTGGAGG - Intergenic
938802488 2:134775764-134775786 ATCACTTAGGATGCTTTTGGTGG - Intergenic
939459625 2:142482979-142483001 ATGACTGGGTGTCCTTTCAGTGG - Intergenic
939940554 2:148345134-148345156 ATTAGTGAGGGTTCTTTTAGAGG + Intronic
943990255 2:194680587-194680609 AGGAGGTAGGGTCCTTTTGGAGG - Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947435225 2:230067650-230067672 ATGACTGAGGGCCATTATTGGGG - Intronic
948694426 2:239726037-239726059 ATGTCTGAGAGGCCTTTTGCAGG - Intergenic
1170396442 20:15931092-15931114 TTGACTCAGAGTCCATTTGGTGG + Intronic
1173568124 20:44056230-44056252 TTGCCTGAGGGTCCCTCTGGTGG - Intronic
1175055401 20:56193106-56193128 AGGGCTGAGCGTCCTTCTGGAGG + Intergenic
1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG + Intergenic
1181768524 22:25109541-25109563 ATTACTGATGGTCATCTTGGAGG + Intronic
1182469202 22:30537132-30537154 ATCACTGATGGTCATCTTGGAGG - Intronic
1183738063 22:39654795-39654817 AGGACTCAGGGTCCTTTTGGGGG - Intronic
949416741 3:3823214-3823236 ATGACTGTGTGTCCTGTGGGAGG + Intronic
950832854 3:15892314-15892336 ATGACTGTGAGTCCATTTGGGGG + Intergenic
950901508 3:16502444-16502466 ATCACTGAGGGTCGTCCTGGAGG - Intronic
951963001 3:28349276-28349298 TTCACTCAGTGTCCTTTTGGGGG + Intronic
953355859 3:42255639-42255661 ATGACTGGGTGTCCTTTCAGTGG + Intergenic
954638033 3:52082136-52082158 ATTACTGAGGATCCTATTGAGGG + Intronic
955369898 3:58342019-58342041 ATGACTAAGGCTTCTTTTTGGGG - Intronic
957518284 3:81285141-81285163 GGGACTGAGGGACATTTTGGGGG + Intergenic
958714115 3:97758663-97758685 ATGACTGTGGCTCCTTTAAGCGG + Intergenic
962093826 3:132273105-132273127 AAGACTGAGGGACATTTTAGAGG - Intronic
962665639 3:137651126-137651148 ATGACTGACAGCCCTTTTGGGGG - Intergenic
965858276 3:173115493-173115515 AGAACAGAGGGTTCTTTTGGGGG + Intronic
967092532 3:186147447-186147469 ATGACTGTGGTTTCTTGTGGTGG - Exonic
968976132 4:3822960-3822982 AGGACTGACGGTCCTCATGGGGG - Intergenic
970097100 4:12476704-12476726 CTGAGTGAGGTTTCTTTTGGAGG + Intergenic
971910897 4:32796486-32796508 ATGGCTGTGGGTGCATTTGGTGG - Intergenic
972496773 4:39641514-39641536 ATCACTGGGGGTCCTCTTAGAGG - Intergenic
978044768 4:104113067-104113089 ATTACTCAGGGTCCTTTAGAGGG + Intergenic
979690282 4:123552162-123552184 ATGAGTGAGGGTCCATTAGGTGG - Intergenic
980588202 4:134847698-134847720 ATGGCTAAAGGTCATTTTGGGGG - Intergenic
981757335 4:148154757-148154779 TTGACCGAGGGTTCTTTTGCAGG + Exonic
982290495 4:153776765-153776787 ATGCCTGAGTCTTCTTTTGGGGG + Intergenic
984059159 4:174970542-174970564 AGGACTGAGTTTCTTTTTGGAGG - Intronic
996399049 5:123039947-123039969 TTTGCTGAAGGTCCTTTTGGGGG + Intergenic
998907651 5:146923815-146923837 ATCACTGATGGGCCTTTGGGTGG - Intronic
1000793212 5:165632340-165632362 TTGACGGAGAGCCCTTTTGGTGG - Intergenic
1004953166 6:20697599-20697621 ATGAATGTGCTTCCTTTTGGTGG - Intronic
1005868043 6:29951460-29951482 AAGATAGAGGTTCCTTTTGGTGG + Intergenic
1006830544 6:36965280-36965302 ATGACTGAGGGTGGCTTGGGTGG + Intergenic
1006861603 6:37175076-37175098 CTGACTTGGGGACCTTTTGGGGG + Exonic
1007100545 6:39243295-39243317 AGGAGTTAGGGTCCTTTTAGGGG + Intergenic
1007403701 6:41619731-41619753 ATGTCTGTGGGTCCTCTTGTTGG + Intergenic
1012736912 6:102959400-102959422 ATTACTCAGGGTTCTTTAGGGGG - Intergenic
1014873905 6:126631821-126631843 ATGACTCAGTGTTCATTTGGGGG - Intergenic
1016572996 6:145536121-145536143 ATTCCTAAGAGTCCTTTTGGAGG + Intronic
1017202630 6:151772571-151772593 ATGATTGAGGCCCCTTTTGAGGG + Intronic
1020771628 7:12403233-12403255 ATTTCTGAGGGTCCGGTTGGAGG + Intronic
1021689379 7:23217374-23217396 TTCACTGAGGATCCTTTTGAAGG - Intergenic
1021940471 7:25674003-25674025 ATGGCTGAGGATCCAGTTGGAGG - Intergenic
1023348369 7:39294651-39294673 ATGAATCAGGGTGCATTTGGTGG - Intronic
1023480693 7:40630716-40630738 TAGACTGAGAGCCCTTTTGGGGG - Intronic
1024459562 7:49646014-49646036 ATCTCTGAGAGTCCTTTTAGTGG - Intergenic
1027053124 7:75032143-75032165 ATGACTGGGGGCCATCTTGGAGG + Intronic
1027604742 7:80287140-80287162 ATGACTTTTGGTCCTTTTGAGGG - Intergenic
1033941170 7:146656123-146656145 ATGATTGAAGGTTGTTTTGGTGG - Intronic
1034277602 7:149830517-149830539 ATGACTGAGGGGACTGTTGTGGG - Intergenic
1034277649 7:149830663-149830685 ATGACTGAGGGGACTGTTGTGGG - Intergenic
1035378091 7:158420264-158420286 AAGACTGAGGGGCCTTTTCGCGG - Intronic
1038142721 8:24864088-24864110 GTGACTGAGGGAGCTTTTTGGGG - Intergenic
1040009762 8:42651667-42651689 GTGACTGAGGGGCCTTTCGGGGG + Intergenic
1041705977 8:60846810-60846832 CTGGCTGAGGGTCCTTGAGGAGG - Intronic
1043075852 8:75698554-75698576 ACCACTGAGGCTCATTTTGGAGG + Intergenic
1046548582 8:115683282-115683304 ATGTCTGAATGTCCATTTGGTGG + Intronic
1052000136 9:23268847-23268869 ATCACTGGGGGTCATCTTGGAGG - Intergenic
1052043490 9:23768045-23768067 AGGAGAGAGGGACCTTTTGGAGG - Intronic
1055470277 9:76603886-76603908 CTCACTGAGGGTCCTCTTGAAGG + Intergenic
1187360735 X:18625366-18625388 ATAACTGAGGGTCTATTTTGAGG - Intronic
1187449674 X:19385520-19385542 ATCATTGGGGGTCATTTTGGAGG + Intronic
1188058046 X:25564355-25564377 ATCACTGAGGGCCATCTTGGAGG - Intergenic
1189148700 X:38682840-38682862 ATGACTGAGGGACATTTTAGAGG + Intronic
1192063769 X:67859497-67859519 ATCACTGATGGACATTTTGGTGG + Intergenic
1194905576 X:99572495-99572517 ATGACTGCTGTTCCTTATGGGGG + Intergenic
1194939290 X:99989840-99989862 ATGAATTAGGTTTCTTTTGGGGG - Intergenic
1196314767 X:114209971-114209993 ATGCCAGAGGATCCATTTGGTGG - Intergenic
1198078553 X:133217244-133217266 ATGGCTCAGGGAACTTTTGGAGG - Exonic
1199504860 X:148550257-148550279 ATGCCTGAGTCTCCTTTTGGGGG + Intronic
1201860070 Y:18587315-18587337 ATCACTGAAGGTCTTTTTGTAGG - Intronic
1201873251 Y:18733066-18733088 ATCACTGAAGGTCTTTTTGTAGG + Intronic
1202018770 Y:20441776-20441798 AGGACTGTGTGTCTTTTTGGTGG + Intergenic
1202627632 Y:56876544-56876566 ATCACTGGGGGCCATTTTGGAGG - Intergenic