ID: 1108585705

View in Genome Browser
Species Human (GRCh38)
Location 13:51867851-51867873
Sequence ACCTGGACGGTGTGGGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108585698_1108585705 -4 Left 1108585698 13:51867832-51867854 CCAGGGGCCCACACTCAAGACCT 0: 1
1: 1
2: 0
3: 19
4: 193
Right 1108585705 13:51867851-51867873 ACCTGGACGGTGTGGGCCATTGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108585705 Original CRISPR ACCTGGACGGTGTGGGCCAT TGG Intergenic
900410378 1:2509985-2510007 AGCTGGGCAGAGTGGGCCATGGG - Intronic
902734469 1:18391103-18391125 ACCTGGGCACTGTGGGCCATTGG - Intergenic
906191282 1:43900988-43901010 ACCTGGTCTGTGTGGGCAGTGGG - Intronic
920456741 1:206107394-206107416 GCCTGGACAGTCTGGGCCAGTGG - Intergenic
921947312 1:220894873-220894895 AGCTGGACCCTGTGGGCCTTCGG + Intergenic
923842824 1:237692525-237692547 ACGAGGACGGAGTGGCCCATGGG - Intronic
924646344 1:245880970-245880992 TCCTGGACAGTGTGTGCCCTGGG - Intronic
1065124885 10:22564818-22564840 ACCTGGTCGGTGAGGGCGAGTGG - Intronic
1070130624 10:73653227-73653249 ACCAGGTCGGAGGGGGCCATGGG + Exonic
1070157364 10:73843728-73843750 ACCTGGAAAGAGTGGGCCAAGGG - Intronic
1075598191 10:123747577-123747599 ACATGGACGCTGTGGGGCAGAGG + Intronic
1076443677 10:130497513-130497535 ACCTGGACGTTGTGGGGAGTAGG + Intergenic
1078578594 11:12521559-12521581 ACCTGGACGTTTTTGGCCAGGGG - Intronic
1080428113 11:32174470-32174492 ACCTGGAGGGTGTGGCCAAGGGG - Intergenic
1081740645 11:45437444-45437466 ACCTGGAAGGAGTGTGCCAGAGG + Intergenic
1083595199 11:63915716-63915738 TCCTGGAAGGTGGGGGCCCTGGG - Intronic
1084742993 11:71151100-71151122 ACCTGGATGGTGAGGGGCAGTGG - Intronic
1088545688 11:110956475-110956497 AAGGGGATGGTGTGGGCCATGGG + Intergenic
1088820158 11:113449653-113449675 ACCAAGACGGTGTCAGCCATGGG + Intronic
1088963422 11:114693460-114693482 ACGTGGACAGTCTGGGACATGGG - Intronic
1089284388 11:117396214-117396236 ACCAGGATGGTGTGGGGCATTGG + Intronic
1090618815 11:128542798-128542820 ACATGGAGGGTGTGTTCCATGGG - Intronic
1095690324 12:45081161-45081183 ACTTGGAAGGTGAGGACCATTGG + Intergenic
1095964297 12:47856831-47856853 ACCTCCACGGAGGGGGCCATGGG + Intronic
1097057162 12:56257248-56257270 AGCTGGAAGGTGTGGCACATAGG - Intronic
1097175394 12:57139406-57139428 CCCTGGAGGGTGGGGGCCAGGGG + Intronic
1104885353 12:132104211-132104233 ACCTGCAGGGCGTGGGCCCTGGG + Intronic
1108585705 13:51867851-51867873 ACCTGGACGGTGTGGGCCATTGG + Intergenic
1117315675 14:54568222-54568244 ACCTGGACGGCGTGGCCCCGAGG + Intronic
1119744455 14:77034030-77034052 CCCAGGTCGGTGTGGGCCAGTGG - Intergenic
1122059474 14:99127033-99127055 ACCTTTACGTTGTGGGCCAGAGG - Intergenic
1122822890 14:104356025-104356047 ACCTGGAGGGAGTGGGCCTCTGG - Intergenic
1124608869 15:31193787-31193809 AACTGTACAGTGTGGGGCATAGG - Intergenic
1126274437 15:46860425-46860447 CCTTGGCCAGTGTGGGCCATTGG - Intergenic
1129826935 15:78640620-78640642 ACCTGGGCGGTGTAGGCGCTTGG - Intronic
1132808835 16:1788087-1788109 ACCTGGCCGGTGGGGGCTTTGGG + Intronic
1132826545 16:1908159-1908181 ACCAGGATGGCGTGGGCCACGGG - Intergenic
1132886558 16:2184826-2184848 ACCTGCCCGGCGTGGGCCACTGG + Exonic
1140224432 16:73066730-73066752 GCCTGGGCGGCGTGGGCCCTGGG - Intergenic
1141176202 16:81720872-81720894 ACCTGGTAGGTGTCTGCCATTGG + Intergenic
1143294786 17:5862813-5862835 ATCTGGACTGAGGGGGCCATAGG - Intronic
1146854904 17:36254200-36254222 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146865716 17:36334176-36334198 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1146870804 17:36378092-36378114 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146878163 17:36429174-36429196 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146882112 17:36450320-36450342 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1147073688 17:37978716-37978738 ACCTGGACGTAGAGGGCCCTTGG - Intronic
1147080108 17:38014325-38014347 ACCTGGACGTAGAGGGCCCTTGG + Intronic
1147085209 17:38058254-38058276 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG + Intergenic
1147101156 17:38182220-38182242 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147790791 17:43013353-43013375 ACCTGGATGGTGGTGACCATGGG - Exonic
1147882874 17:43665321-43665343 CCCTGGACGGGGTGGGCCCTGGG + Intergenic
1148044485 17:44734406-44734428 GCCTGGACTGCCTGGGCCATGGG + Intronic
1153763894 18:8356756-8356778 ACCTGGAGGATTTGGGCTATTGG - Intronic
1154065414 18:11102733-11102755 GGCTGCAGGGTGTGGGCCATAGG - Intronic
1160036024 18:75302519-75302541 CCCTGGACAGTGGGGGCCCTTGG + Intergenic
1160687718 19:444471-444493 CCCTGAACTGTGTGGTCCATGGG + Intronic
1163716867 19:18878122-18878144 ATTTGGCCGGTGGGGGCCATCGG - Exonic
1165126908 19:33604555-33604577 ACCAGGATGGTGGGGGCTATGGG + Intergenic
1165135429 19:33665474-33665496 GGCTGGAGGGTGTGGTCCATGGG + Intronic
1165324171 19:35104566-35104588 ACCTGGACTGTGATGGCCAAGGG - Intergenic
1168378908 19:55903807-55903829 ACCAGGAGGGAGTGGCCCATGGG - Intronic
931227141 2:60341331-60341353 ACCTGGCAGGTGTCGGCCCTGGG - Intergenic
936618514 2:114072372-114072394 ACCTGGATGCTGTGGCACATAGG + Intergenic
938154110 2:128914760-128914782 ACCTTGAAGGTGTGGGAAATGGG - Intergenic
938168566 2:129055352-129055374 TCCTGGACAGTGGGGGGCATGGG + Intergenic
944880832 2:204011317-204011339 ACCTGGACGCTGTGGGCTTGGGG + Intergenic
946431479 2:219629063-219629085 AGCTGGAAGGTGTGTGCCCTCGG + Intronic
948401895 2:237691387-237691409 GCCTGGACGGTGTGGACCCCGGG + Intronic
948587058 2:239026190-239026212 CCCTGGACAGGGTGGGCCAACGG - Intergenic
1171143772 20:22764589-22764611 ACCTGGACGGCGTGAGGCCTGGG + Intergenic
1172132335 20:32664176-32664198 ACCTGGGAGGTGAGGGCCCTGGG + Intergenic
1173790321 20:45823977-45823999 ACTTCGACGGTGAGGGCCAACGG - Exonic
1179727117 21:43346834-43346856 TCCTGGATGGTGTGTGCCGTGGG - Intergenic
1180127862 21:45804342-45804364 ACATGGATGGTGTGGGCACTAGG - Intronic
1183200129 22:36380232-36380254 CCTTGGATGGTGTGGGCCCTGGG - Intronic
1183333117 22:37231906-37231928 AGCTGGACAGGGTGGGCCTTGGG - Intronic
1184297606 22:43535077-43535099 CCCAGGACAGTGTGGGCCAGCGG - Intronic
1185199870 22:49494702-49494724 ACCTGGAGACTCTGGGCCATGGG + Intronic
1185326713 22:50229173-50229195 CCCTGGGCTGTGTGGGCCCTGGG - Intronic
954638191 3:52083011-52083033 AACTGGTCAGTTTGGGCCATTGG - Intronic
969373229 4:6747223-6747245 ACCTGGACGCTGAGGGCCCTTGG - Intergenic
970951720 4:21764663-21764685 CCCTGGAAGGAATGGGCCATAGG + Intronic
986579956 5:9255571-9255593 ACCTGGACAGGATGAGCCATGGG - Intronic
1000043879 5:157505602-157505624 ACCTGGACAGTGTGACCCAGGGG - Intronic
1002043314 5:176529410-176529432 ACCTCCACGCTGAGGGCCATGGG + Intronic
1003084811 6:3052882-3052904 CCCTCCACGGTGTGCGCCATGGG - Intergenic
1018396810 6:163384223-163384245 AACTGAACGGTGTGGGCCTAGGG - Intergenic
1018855025 6:167669035-167669057 TCCTGGACGGGGTGGGCCGGGGG - Intergenic
1019835707 7:3381242-3381264 ACCTGGAGGGTGTGGACCAGTGG + Intronic
1021896957 7:25246105-25246127 ACCTGGATGGTGTGAGCCCCAGG + Intergenic
1022474350 7:30700199-30700221 ACCTGGAGGCTGTGGGCTGTGGG - Intronic
1026443140 7:70460950-70460972 ACCTGGCAGGTGTGAGCCCTGGG + Intronic
1030098639 7:105924127-105924149 ACATGGAGCCTGTGGGCCATGGG - Intronic
1034224746 7:149473869-149473891 CCCTGGGCAGTGAGGGCCATTGG - Exonic
1035664747 8:1372685-1372707 ACATGGACGGCGTGGGCTAGAGG + Intergenic
1049288348 8:141788662-141788684 AGCTGGACAGTGTGGTCCAGCGG + Intergenic
1053028924 9:34757942-34757964 ACCTGGCAGGGGTGGTCCATGGG + Intergenic
1059346521 9:113632629-113632651 CCCTGGAAGGTGGGGGCCCTAGG + Intergenic
1061259986 9:129474880-129474902 ACCTAGAGGGTGTGGGGCGTGGG + Intergenic
1061931616 9:133835834-133835856 ACCTGCAGGGACTGGGCCATTGG + Intronic
1186111129 X:6257155-6257177 CCATGGAAGGTGTGGGTCATGGG - Intergenic
1186383512 X:9086063-9086085 AGCTGGACTCTGTGGGCCACAGG - Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1192165966 X:68828025-68828047 ACCTGGAAGGTCTGAGCTATGGG + Intergenic
1195962664 X:110402060-110402082 ACCTGGAAAGTGTGGGACAGAGG - Intronic
1201146731 Y:11068857-11068879 ACCTGGATGGTGAGGGGCAGTGG - Intergenic